Covalent Modification of p73α by SUMO-1
2000; Elsevier BV; Volume: 275; Issue: 46 Linguagem: Inglês
10.1074/jbc.m004293200
ISSN1083-351X
AutoresA Minty, Xavier Dumont, Mourad Kaghad, Daniel Caput,
Tópico(s)Ubiquitin and proteasome pathways
ResumoTwo-hybrid screening in yeast with p73α isolated SUMO-1 (small ubiquitin-likemodifier 1), the enzyme responsible for its conjugation, Ubc-9, and a number of novel SUMO-1-interacting proteins, including thymine DNA glycosylase, PM-Scl75, PIASx, PKY, and CHD3/ZFH. A subset of these proteins contain a common motif,hhXSXS/Taaa, where h is a hydrophobic amino acid and a is an acidic amino acid, that is shown to interact with SUMO-1 in the two-hybrid system. We show here that p73α, but not p73β, can be covalently modified by SUMO-1. The major SUMO-1-modified residue in p73α is the C-terminal lysine (Lys627). The sequence surrounding this lysine conforms to a consensus SUMO-1 modification siteb(X)XXhKXE, whereb is a basic amino acid. SUMO-1-modified p73 is more rapidly degraded by the proteasome than unmodified p73, although SUMO-1 modification is not required for p73 degradation. SUMO-1 modification does not affect the transcriptional activity of p73α on an RGC-luciferase reporter gene in SK-N-AS cells. Instead, SUMO-1 modification may alter the subcellular localization of p73, because SUMO-1-modified p73 is preferentially found in detergent-insoluble fractions. Alternatively, it may modulate the interaction of p73 with other proteins that are substrates for SUMO-1 modification or which interact with SUMO-1, such as those identified here. Two-hybrid screening in yeast with p73α isolated SUMO-1 (small ubiquitin-likemodifier 1), the enzyme responsible for its conjugation, Ubc-9, and a number of novel SUMO-1-interacting proteins, including thymine DNA glycosylase, PM-Scl75, PIASx, PKY, and CHD3/ZFH. A subset of these proteins contain a common motif,hhXSXS/Taaa, where h is a hydrophobic amino acid and a is an acidic amino acid, that is shown to interact with SUMO-1 in the two-hybrid system. We show here that p73α, but not p73β, can be covalently modified by SUMO-1. The major SUMO-1-modified residue in p73α is the C-terminal lysine (Lys627). The sequence surrounding this lysine conforms to a consensus SUMO-1 modification siteb(X)XXhKXE, whereb is a basic amino acid. SUMO-1-modified p73 is more rapidly degraded by the proteasome than unmodified p73, although SUMO-1 modification is not required for p73 degradation. SUMO-1 modification does not affect the transcriptional activity of p73α on an RGC-luciferase reporter gene in SK-N-AS cells. Instead, SUMO-1 modification may alter the subcellular localization of p73, because SUMO-1-modified p73 is preferentially found in detergent-insoluble fractions. Alternatively, it may modulate the interaction of p73 with other proteins that are substrates for SUMO-1 modification or which interact with SUMO-1, such as those identified here. ubiquitin-activating enzyme ubiquitin ubiquitin-protein isopeptide ligase promyelocytic leukemia gene product PML oncogenic domain histone deacetylase complex Covalent modification of proteins is widely used as a way of modifying their stability, activity, or localization. Examples of this are phosphorylation, acetylation, lipid modification, or glycosylation. Modification by covalent linkage to a second "tagging" protein was first observed with ubiquitin, a 76-amino acid polypeptide that is covalently linked to lysine residues in an acceptor protein by an enzymatic system involving two to three ubiquitin-activating and -conjugating enzymes (E1, E2, and E3).1 Subsequent poly-ubiquitination usually signals the modified protein for degradation by the proteasome (1Ciechanover A. EMBO J. 1998; 17: 7151-7160Crossref PubMed Scopus (1200) Google Scholar). Alternate outcomes for ubiquitinated proteins are activation or transport via an intracellular membrane vesicular system (2Hochstrasser M. Cell. 1996; 84: 813-815Abstract Full Text Full Text PDF PubMed Scopus (243) Google Scholar). It has now become apparent that several other "ubiquitin-like" tagging molecules exist that are conjugated using enzymatic systems similar but nonidentical to those used by ubiquitin (3Hochstrasser M. Genes Dev. 1998; 12: 901-907Crossref PubMed Scopus (112) Google Scholar, 4Saitoh H. Pu R.T. Dasso M. Trends Biochem. Sci. 1997; 22: 374-376Abstract Full Text PDF PubMed Scopus (126) Google Scholar). Two groups initially determined the nature of a modification of the Ran GTPase-activating protein (RanGAP1) involved in the interaction of this protein with RanBP2/Nup358 at the nuclear pore complex (5Matunis M.J. Coutavas E. Blobel G. J. Cell Biol. 1996; 135: 1457-1470Crossref PubMed Scopus (961) Google Scholar, 6Mahajan R. Delphin C. Guan T. Gerace L. Melchior F. Cell. 1997; 88: 97-107Abstract Full Text Full Text PDF PubMed Scopus (1010) Google Scholar). They called the modifying molecule GMP1 (GAP-modifying protein1) or SUMO-1 (small ubiquitin-likemodifier 1). SUMO-1 has since been identified several times as an interacting partner in the yeast two-hybrid system and given different names: with the promyelocytic leukemia gene product (PML) (PIC-1) (7Brody M.N. Howe K. Etkin L.D. Solomon E. Freemont P.S. Oncogene. 1996; 13: 971-982PubMed Google Scholar), with the death domain of the FAS antigen or TNF-receptor (sentrin, DAP-1) (8Okura T. Gong L. Kamitani T. Wada T. Okura I. Wei C.F. Chang H.M. Yeh E.T. J. Immunol. 1996; 157: 4277-4281PubMed Google Scholar, 9Liou M.-L. Liou H.-C. J. Biol. Chem. 1999; 274: 10145-10153Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar), and with the RAD51 and RAD52 proteins involved in DNA recombination and repair (UBL-1) (10Shen Z. Pardington-Purtymun P.E. Comeaux J.C. Moyzis R.K. Chen D.J. Genomics. 1996; 37: 183-186Crossref PubMed Scopus (126) Google Scholar). A budding yeast homologue of SUMO-1 (Smt3p) was identified by Meluh and Koshland (11Meluh P.B. Koshland D. Genes Dev. 1997; 11: 3401-3412Crossref PubMed Scopus (153) Google Scholar) as a suppressor of mutations in Mif2 (mitotic instability factor2), a protein thought to be the yeast equivalent of the CENP-C mammalian centromere protein. One putative role for SUMO-1/Smt3p is thus in assembly or maintenance of the centromere/kinetochore structure involved in chromosome segregation. Similarly, the fission yeast (Schizosaccharomyces pombe) equivalent of Smt3p, Pmt3p, has recently been shown to be involved in chromosomal segregation and the control of telomere length (12Tanaka K. Nishide J. Okazaki K. Kato H. Niwa O. Nakagawa T. Matsuda H. Kawamukai M. Murakami Y. Mol. Cell. Biol. 1999; 19: 8660-8672Crossref PubMed Scopus (169) Google Scholar). Enzymes involved in Smt3p/SUMO-1 conjugation have been identified in yeast and mammalian cells (13Desterro J.M. P Rodriguez M.S. Kemp G.D. Hay R.T. J. Biol. Chem. 1999; 274: 10618-10624Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar, 14Johnson E.S. Blobel G. J. Biol. Chem. 1997; 272: 26799-26802Abstract Full Text Full Text PDF PubMed Scopus (411) Google Scholar, 15Desterro J.M.P. Thomson J. Hay R.T. FEBS Lett. 1997; 417: 297-300Crossref PubMed Scopus (304) Google Scholar). The SUMO-1-activating enzyme (E1) consists of a heterodimer of the Aos1p/SAE1 and Uba2p/SAE2 proteins that together reconstitute the equivalent of the ubiquitin-activating enzyme Uba1 (13Desterro J.M. P Rodriguez M.S. Kemp G.D. Hay R.T. J. Biol. Chem. 1999; 274: 10618-10624Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar). The SUMO-1-conjugating enzyme (E2) in yeast, mammalian cells, and Xenopus is Ubc9 (14Johnson E.S. Blobel G. J. Biol. Chem. 1997; 272: 26799-26802Abstract Full Text Full Text PDF PubMed Scopus (411) Google Scholar, 15Desterro J.M.P. Thomson J. Hay R.T. FEBS Lett. 1997; 417: 297-300Crossref PubMed Scopus (304) Google Scholar). So far no E3 enzymes have been identified. Ubc9, originally thought to be a ubiquitin-conjugating enzyme, was shown to be essential gene in yeast (16Seufert W. Futcher B. Jentsch S. Nature. 1995; 373: 78-81Crossref PubMed Scopus (429) Google Scholar) because temperature-sensitive mutants of Ubc9 arrested in mitosis, as did mutants of a SUMO-1-cleaving protease Ulp1 (17Li S.-J. Hochstrasser M. Nature. 1999; 398: 246-251Crossref PubMed Scopus (608) Google Scholar). In yeast and mammalian cells, there is very little free Smt3p/SUMO-1. Most (>90%) of the SUMO-1 detected on Western analysis of extracts from mammalian cells is conjugated to the RanGAP1 nuclear pore protein (18Kamitani T. Nguyen H.P. Yeh E.T.H. J. Biol. Chem. 1997; 272: 14001-14004Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar). Other proteins subject to modification by SUMO-1 are the PML and Sp100 proteins, which form part of the nuclear structures known as PODs (PML oncogenic domains) or nd10s (19Seeler J.S. Dejean A. Curr. Opin. Genet. Dev. 1999; 9: 362-367Crossref PubMed Scopus (121) Google Scholar). For PML, it has been shown that SUMO-1 modification is essential for its localization in PODs, with free PML being found in the nucleoplasm. Another substrate for SUMO-1 is Iκβα (20Desterro J.M. Rodriguez M.S. Hay R.T. Mol. Cell. 1998; 2: 233-239Abstract Full Text Full Text PDF PubMed Scopus (919) Google Scholar), an inhibitor of NFκβ, which is modified by SUMO-1 on the lysine residue also modified by ubiquitin. SUMO-1 modification prevents ubiquitination and thus results in stabilization of Iκβα and consequently in inhibition of NF-κβ (20Desterro J.M. Rodriguez M.S. Hay R.T. Mol. Cell. 1998; 2: 233-239Abstract Full Text Full Text PDF PubMed Scopus (919) Google Scholar). In the present communication, we describe SUMO-1 modification of the p53-related p73α protein. p53 is the most widely studied tumor suppressor and is mutated in over 50% of human tumors (21May P. May E. Oncogene. 1999; 18: 7621-7636Crossref PubMed Scopus (551) Google Scholar). It plays a key role in both the regulation of cell cycle checkpoints and the initiation of apoptotic cell death in response to DNA damage. The activity of p53 has been shown to be finely tuned by a variety of post-translational modifications (phosphorylation, acetylation, and glycosylation) and to be highly sensitive to conformational changes (22Lakin N.D. Jackson S.P. Oncogene. 1999; 18: 7644-7655Crossref PubMed Scopus (802) Google Scholar). The p53 molecule contains a number of well defined domains including an N-terminal transcriptional activation domain and a central core, corresponding to the DNA-binding domain, which is highly conserved in evolution and which contains the majority of the mutation hot spots in cancer cells. The rest of the molecule contains a linker region including the major nuclearization signal, an oligomerization domain, and a regulatory C-terminal region containing multiple phosphorylation and acetylation sites (21May P. May E. Oncogene. 1999; 18: 7621-7636Crossref PubMed Scopus (551) Google Scholar, 22Lakin N.D. Jackson S.P. Oncogene. 1999; 18: 7644-7655Crossref PubMed Scopus (802) Google Scholar). Recently, this region has been shown to contain a lysine residue (386) that can be covalently modified by SUMO-1 (23Rodriguez M.S. Desterro J.M.P. Lain S. Midgley C.A. Lane D.P. Hay R.T. EMBO J. 1999; 18: 6455-6461Crossref PubMed Scopus (561) Google Scholar, 24Gostissa M. Hengstermann A. Fogal V. Sandy P. Schwartz S.E. Scheffner M. Del Sal G. EMBO J. 1999; 18: 6462-6471Crossref PubMed Scopus (438) Google Scholar). We previously reported the existence of a p53-related gene, p73, mapping to a chromosomal locus (1p36.3) often deleted in neuroectodermal human cancers such as neuroblastomas (24Gostissa M. Hengstermann A. Fogal V. Sandy P. Schwartz S.E. Scheffner M. Del Sal G. EMBO J. 1999; 18: 6462-6471Crossref PubMed Scopus (438) Google Scholar). Subsequent work from several laboratories has described the existence of another p53 family member, more closely related to p73 than to p53, variously described as p63, KET, and p51 (25Kaghad M. Bonnet H. Yang A. Creancier L. Biscan J.-C. Valent A. Minty A. Chalon P. Lelias J.-M. Dumont X. Ferrara P. McKeon F. Caput D. Cell. 1997; 90: 809-819Abstract Full Text Full Text PDF PubMed Scopus (1539) Google Scholar). p73 shows structural similarities with p53, including the presence of transcription-activating, DNA-binding, and oligomerization domains. It exists as multiple isoforms, resulting from differential splicing of C-terminal exons, of which the two major forms are the α and β isoforms containing 636 and 499 amino acids (25Kaghad M. Bonnet H. Yang A. Creancier L. Biscan J.-C. Valent A. Minty A. Chalon P. Lelias J.-M. Dumont X. Ferrara P. McKeon F. Caput D. Cell. 1997; 90: 809-819Abstract Full Text Full Text PDF PubMed Scopus (1539) Google Scholar, 26Kaelin W.G. Oncogene. 1999; 18: 7701-7705Crossref PubMed Scopus (158) Google Scholar). p73 differs from p53 in that its levels of expression are not elevated in response to environmental stresses such as UV irradiation and actinomycin D treatment (25Kaghad M. Bonnet H. Yang A. Creancier L. Biscan J.-C. Valent A. Minty A. Chalon P. Lelias J.-M. Dumont X. Ferrara P. McKeon F. Caput D. Cell. 1997; 90: 809-819Abstract Full Text Full Text PDF PubMed Scopus (1539) Google Scholar). However, in interaction with the protein kinase c-Abl it mediates an apoptotic response to ionizing radiation and to genotoxic agents such as cisplatin (27White E. Prives C. Nature. 1999; 399: 734-737Crossref PubMed Scopus (62) Google Scholar). In contrast to p53, no functionally significant p73 mutations have so far been reported in cancer cells, but a monoallelic pattern of expression is sometimes observed (26Kaelin W.G. Oncogene. 1999; 18: 7701-7705Crossref PubMed Scopus (158) Google Scholar). Analysis of p73 knock-out mice does not show an increased susceptibility to spontaneous tumorigenesis (28Yang A. Walker N. Bronson R. Kaghad M. Oosterwegel M. Bonnin J . Vagner C. Bonnet H. Dikkes P. Sharpe A. McKeon F. Caput D. Nature. 2000; 404: 99-103Crossref PubMed Scopus (888) Google Scholar). However, these studies reveal that p73 plays key roles in a number of developmental processes that are nonoverlapping with the roles played by other p53 family members (28Yang A. Walker N. Bronson R. Kaghad M. Oosterwegel M. Bonnin J . Vagner C. Bonnet H. Dikkes P. Sharpe A. McKeon F. Caput D. Nature. 2000; 404: 99-103Crossref PubMed Scopus (888) Google Scholar). The activities of p73 may be exerted at multiple levels. Firstly, p73 is a transcriptional activator eliciting a response different from that obtained with p53 (29Yu J. Zhang L. Hwang P.M. Rago C. Kinzler K.W. Vogelstein B. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 14517-14522Crossref PubMed Scopus (416) Google Scholar). Secondly, the major form of p73 is often an N-terminally truncated form that would be incapable of transcriptional activation (28Yang A. Walker N. Bronson R. Kaghad M. Oosterwegel M. Bonnin J . Vagner C. Bonnet H. Dikkes P. Sharpe A. McKeon F. Caput D. Nature. 2000; 404: 99-103Crossref PubMed Scopus (888) Google Scholar), suggesting the possibility of other nontranscriptional roles for p73. During yeast two-hybrid screens using p73 as a bait, we isolated the cDNA for SUMO-1. Here we show that p73 can be covalently modified by SUMO-1, with the major modification occurring on the terminal lysine residue. A number of other SUMO-1-interacting proteins were isolated in the p73 two-hybrid screening, and we have been able to deduce and confirm a novel SUMO-1 interaction motif. The nature of the proteins identified here suggests that one role for SUMO-1 may be in transcriptional regulation, perhaps co-ordinating this with other key cellular processes such as cell cycle checkpoints, chromosome segregation, DNA recombination and repair, and the induction of apoptosis. The SK-N-AS neuroblastoma cell line (30Sugimoto T. Tatsumi E. Kemshead T. Helson L. J. Natl. Cancer Inst. 1984; 73: 51-57PubMed Google Scholar) and the 293 embryonic kidney cell line (American Type Culture Collection CRL 1573) were grown in Dulbecco's modified Eagle's medium (Life Technologies, Inc.) containing 1 mm sodium pyruvate and 10% fetal calf serum. The U937 monocytic cell line (American Type Culture Collection CRL 1593) was grown in RPMI (Life Technologies, Inc.) containing 10% fetal calf serum. Total cellular RNA was extracted from SK-N-AS and U937 cells by the guaninidium thiocyanate/acid phenol method (31Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (63232) Google Scholar). Poly(A)+RNAs were isolated using oligo(dT) magnetic beads (Dynal). 1 μg of each poly(A)+ RNA was transcribed into cDNA using reverse transcriptase (Superscript, Life Technologies, Inc.) and the primer GATCCGGGCCCATTTTCTAC[ACGT][ACGT][ACGT][ACGT][ACGT][ACGT]. cDNAs were fractionated on Sephacryl S400 (Amersham Pharmacia Biotech), and fractions containing cDNA of approximately 500–1500 nucleotides were selected for cloning in the pJGC cloning vector, derived from the pJG4-5 activation domain vector (32Gyuris J. Golemis E. Chertkov H. Brent R. Cell. 1993; 75: 791-803Abstract Full Text PDF PubMed Scopus (1324) Google Scholar) by insertion of a polylinker containing ApaI and BamHI cloning sites between the EcoRI and HindIII sites. cDNA libraries were constructed by the primer adapter method (33Caput D. Beutler B. Hartog K. Thayer R. Brown-Shimer S. Cerami A. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 1670-1674Crossref PubMed Scopus (1218) Google Scholar). Sequences corresponding to p73α (amino acids 85–636), p73β (amino acids 85–499), and p53 (amino acids 73–393) were inserted in the pEG202 vector between either the EcoRI or BamHI sites and the XhoI site (32Gyuris J. Golemis E. Chertkov H. Brent R. Cell. 1993; 75: 791-803Abstract Full Text PDF PubMed Scopus (1324) Google Scholar) creating fusion proteins with the LexA DNA-binding domain. The pEG202.p73α bait was introduced using lithium acetate/polyethylene glycol transformation with sheared single-stranded DNA carrier (34Schiestl R.H. Gietz R.D. Curr. Genet. 1989; 16: 339-346Crossref PubMed Scopus (1776) Google Scholar) into the EGY48 strain of Saccharomyces cerevisiae (containing the LEU2 gene under the control of six LexA operators) along with a reporter plasmid pSH18-34 containing the LacZ gene under the control of eight LexA operators. cDNA libraries were then similarly introduced, and yeast colonies were selected on Yeast Nitrogen Base (Difco) medium containing 2% glucose and leucine (but lacking tryptophan, histidine, and uracil). Approximately 106transformed yeast were obtained with the U937 library and 2 × 106 transformed yeast with the SK-N-AS library. After 3–4 days, colonies were replicated to nitrocelulose filters (Protran BA85; Schleicher & Schull), replated on dishes containing 2% galactose, 1% raffinose, 1 mg/ml 5-bromo-4-chloro-3-indolyl β-d-galactopyranoside (X-gal) (Life Technologies, Inc.) lacking leucine, and grown for 4–5 days. 20 yeast colonies from each cDNA library transformation showing a blue coloration were selected for further study. Plasmid DNA was extracted using a glass bead disruption method (35Hoffman C.S. Winston F. Gene (Amst.). 1987; 57: 267-272Crossref PubMed Scopus (2057) Google Scholar), and cDNA inserts in the pJGC plasmid were amplified by polymerase chain reaction using oligonucleotides flanking the cDNA insert and sequenced. The pJGC plasmid was isolated by selection in the KC8 bacterium in minimal A medium containing vitamin B1 and supplemented with uracil, histidine, and leucine but lacking tryptophan. It was then tested for interaction with the p73α, p73β, and p53 pEG202 bait plasmids by measurements of the β-galactosidase levels in transformed EGY48 24 h after galactose induction of the GAL1 promoter in pJGC, as described by Kippert (36Kippert F. FEMS Microbiol. Lett. 1995; 128: 201-206PubMed Google Scholar). Amino acid substitutions were performed by limited polymerase chain reaction amplification of plasmid DNA using Pfu DNA polymerase and oligonucleotides containing the mutated codons, followed by digestion of remaining input plasmid DNA using the methylation sensitive enzyme Dpn1 (QuikChange; Stratagene). The p73α, p73β, p53, and SUMO-1 cDNAs were introduced into the pcDNA3 vector (Invitrogen) or an epitope-tagged vector derived from pcDNA3 by insertion of an optimalized ATG codon (CCACCATGGCG) and a c-Myc 9E10 epitope (EQKLISEEDL) between the HindIII andEcoRI sites. Plasmid DNA preparations were performed using the QIAfilter Plasmid Midi Kit (Qiagen). Approximately 106cells were transfected in six-well dishes using 1–2 μg of plasmid DNA and LipofectAMINE Plus reagents (Life Technologies, Inc.) as described by the manufacturer. Cells were scraped from the dish 20–30 h after transfection, resuspended in denaturing SDS gel buffer (Bio-Rad) with 0.7 m β−mercaptoethanol and analyzed on SDS-polyacrylamide gels. Proteins were transferred from polyacrylamide gels to nitrocellulose membranes (Hybond-C-extra; Amersham Pharmacia Biotech). These were analyzed with the following primary antibodies: anti-c-Myc (9E10) (Santa Cruz or Invitrogen), anti-GMP1 (anti-SUMO-1) (Zymed Laboratories Inc.), anti-p73α (a rabbit polyclonal antibody: (25Kaghad M. Bonnet H. Yang A. Creancier L. Biscan J.-C. Valent A. Minty A. Chalon P. Lelias J.-M. Dumont X. Ferrara P. McKeon F. Caput D. Cell. 1997; 90: 809-819Abstract Full Text Full Text PDF PubMed Scopus (1539) Google Scholar)), anti-PCNA (Santa Cruz), and secondary anti-mouse IgG and anti-rabbit IgG coupled to horseradish peroxidase (Transduction Laboratories) and visualized by enhanced chemiluminesence (Amersham Pharmacia Biotech). The anti-p73 antibody was generated against a C-terminal p73α () glutathione S-transferase fusion protein (25Kaghad M. Bonnet H. Yang A. Creancier L. Biscan J.-C. Valent A. Minty A. Chalon P. Lelias J.-M. Dumont X. Ferrara P. McKeon F. Caput D. Cell. 1997; 90: 809-819Abstract Full Text Full Text PDF PubMed Scopus (1539) Google Scholar). p73 forms were quantified by scanning of different film exposures and analysis using BioImage (Kodak) software. SK-N-AS cells were transfected in six-well dishes as described above using the RGC firefly luciferase reporter gene (200 ng) and a pRL-CMV Renilla luciferase control (100 ng) (Promega). 20 h after transfection, cells were scraped in 250 μl of Passive Lysis Buffer (Promega) and subjected to two cycles of freeze-thawing. 20 μl of cell extract were analyzed with the Dual Luciferase Reporter Assay system, using a Lumistar luminometer. Luciferase activities of the RGC-luciferase vector were normalized based on the luciferase activities of the co-transfected pRL-CMV, to correct for variations in cell number and/or transfection efficiency between wells. While performing two-hybrid screens using a p73α protein sequence fused to the LexA DNA binding domain (32Gyuris J. Golemis E. Chertkov H. Brent R. Cell. 1993; 75: 791-803Abstract Full Text PDF PubMed Scopus (1324) Google Scholar), we isolated cDNAs encoding SUMO-1, Ubc9 (the SUMO-1-conjugating enzyme), and a SUMO-1-activating enzyme SAE2 (15Desterro J.M.P. Thomson J. Hay R.T. FEBS Lett. 1997; 417: 297-300Crossref PubMed Scopus (304) Google Scholar). Both SUMO-1 and Ubc-9 were found to interact with p73α and p53 but not with p73β (Fig. 1 A). Surprisingly, most of the other proteins isolated in the p73α two-hybrid screen also showed interaction with p73α and p53 but not with p73β (Fig. 1 B). These proteins include PIASx (37Liu B. Liao J. Rao X. Kushner S.A. Chung C.D. Chang D.D. Shuai K. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10626-10631Crossref PubMed Scopus (636) Google Scholar), PKY (38Begley D.A. Berkenpas M.B. Sampson K.E. Abraham I. Gene (Amst .). 1997; 200: 35-43Crossref PubMed Scopus (23) Google Scholar), CHD3/ZFH (39Aubry F. Matthei M.G. Galibert F. Eur. J. Biochem. 1998; 254: 558-564Crossref PubMed Scopus (19) Google Scholar, 40Woodage T. Basrai M.A. Baxevanis A.D. Hieter P. Collins F. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11472-11477Crossref PubMed Scopus (308) Google Scholar), PM-Scl75 (41Alderuccio F. Chan E.K.L. Tan E.M. J. Exp. Med. 1991; 173: 941-952Crossref PubMed Scopus (106) Google Scholar), and thymine DNA glycosylase (42Neddermann P. Gallinari P. Lettieri T. Schmid D. Truong O. Hsuan J.J. Wiebauer K. Jiricny J. J. Biol. Chem. 1996; 271: 12767-12774Abstract Full Text Full Text PDF PubMed Scopus (235) Google Scholar). This suggested that these proteins may have been isolated via interaction with p73 modified by the yeast SUMO-1 equivalent (Smt3p), because higher molecular mass forms of p73 are detected in these yeast (not shown). Indeed, when tested directly with a SUMO-1 bait, all of these proteins gave a positive result (Fig. 1 B). When the cDNA sequences of the SUMO-1-interacting proteins were examined for the presence of common sequences, an 11-amino acid motif was detected in a subset of the proteins. This contained a central serine doublet separated by one amino acid (SXS), within which one serine was replaced by threonine in the human PKY cDNA (Fig.2 A). This SXS triplet is flanked on the N-terminal side by predominantly hydrophobic amino acids and on the C-terminal side by acidic amino acids (D/E) (Fig. 2 A). This motif is evolutionarily conserved in the PKY and PIAS gene families (Fig. 2 A). In view of the subsequent mutagenesis experiments (see below), it is unclear whether the motif in SAE2 that served to derive this consensus would in fact be sufficient on its own to interact with SUMO-1.Figure 1Interaction of p73α, p73β, p53, and SUMO-1 with proteins encoded by cDNAs isolated in the p73α two-hybrid screen. A, Ubc9 (U45328; amino acids 1–143), SUMO-1 (U61937; amino acids 4–101), and p73β (amino acids 85–499) in the pJGC vector were transformed in the yeast EGY48 along with pSH18-34 and different pEG202 bait proteins (p53, p73α, p73β, and SUMO-1). Interactions were measured by β-galactosidase levels (36Kippert F. FEMS Microbiol. Lett. 1995; 128: 201-206PubMed Google Scholar) 24 h after galactose induction of the GAL1 promoter in the pJGC vector and expressed as a percentage of the β-galactosidase level obtained for the dimerization of p53 (amino acids 73–393) in this system.B, thymine DNA glycosylase (TDG) (42Neddermann P. Gallinari P. Lettieri T. Schmid D. Truong O. Hsuan J.J. Wiebauer K. Jiricny J. J. Biol. Chem. 1996; 271: 12767-12774Abstract Full Text Full Text PDF PubMed Scopus (235) Google Scholar) (U51166) amino acids 127–410; PM-Scl75 (41Alderuccio F. Chan E.K.L. Tan E.M. J. Exp. Med. 1991; 173: 941-952Crossref PubMed Scopus (106) Google Scholar) (U09215) amino acids 258–361; PIASx (37Liu B. Liao J. Rao X. Kushner S.A. Chung C.D. Chang D.D. Shuai K. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10626-10631Crossref PubMed Scopus (636) Google Scholar) (AF077953) amino acids 107–572; PKY (38Begley D.A. Berkenpas M.B. Sampson K.E. Abraham I. Gene (Amst .). 1997; 200: 35-43Crossref PubMed Scopus (23) Google Scholar) (AF004849) amino acids 646–1055 and ZFH/CHD3 (39Aubry F. Matthei M.G. Galibert F. Eur. J. Biochem. 1998; 254: 558-564Crossref PubMed Scopus (19) Google Scholar, 40Woodage T. Basrai M.A. Baxevanis A.D. Hieter P. Collins F. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 11472-11477Crossref PubMed Scopus (308) Google Scholar) (U91543/AF006515) amino acids 1863–2000, were similarly assessed for interactions with p53, p73α, p73β, and SUMO-1.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 2Identification and testing of a SUMO-1 interaction motif. A, the cDNAs described in Fig. 1and two other cDNAs also identified in the p73 two-hybrid screen PML-3 (81de Thé H. Lavau C. Marchio A. Chomienne C. Degos L. Dejean A. Cell. 1991; 66: 675-684Abstract Full Text PDF PubMed Scopus (1202) Google Scholar) (M79464) and the SUMO-1-activating enzyme SAE2 (13Desterro J.M. P Rodriguez M.S. Kemp G.D. Hay R.T. J. Biol. Chem. 1999; 274: 10618-10624Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar) (AF090384) were compared in order to identify potential common motifs. One such motif was identified and found to be evolutionarily conserved. Sequences are from PKY (38Begley D.A. Berkenpas M.B. Sampson K.E. Abraham I. Gene (Amst .). 1997; 200: 35-43Crossref PubMed Scopus (23) Google Scholar), PKM (61Trost M. Kochs G. Haller O. J. Biol. Chem. 2000; 275: 7373-7377Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar), homeodomain-interacting protein kinases (62Kim Y.H. Choi C.Y. Lee S.-J. Conti M.A. Kim Y. J. Biol. Chem. 1998; 273: 25875-25879Abstract Full Text Full Text PDF PubMed Scopus (254) Google Scholar), PIAS (37Liu B. Liao J. Rao X. Kushner S.A. Chung C.D. Chang D.D. Shuai K. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 10626-10631Crossref PubMed Scopus (636) Google Scholar), SAE2 (13Desterro J.M. P Rodriguez M.S. Kemp G.D. Hay R.T. J. Biol. Chem. 1999; 274: 10618-10624Abstract Full Text Full Text PDF PubMed Scopus (285) Google Scholar), PML-3 (81de Thé H. Lavau C. Marchio A. Chomienne C. Degos L. Dejean A. Cell. 1991; 66: 675-684Abstract Full Text PDF PubMed Scopus (1202) Google Scholar), and PM-Scl75 (41Alderuccio F. Chan E.K.L. Tan E.M. J. Exp. Med. 1991; 173: 941-952Crossref PubMed Scopus (106) Google Scholar).B, this motif from the PM-Scl75 protein was inserted in the pEG202 vector and tested with SUMO-1 in the pJGC vector in the two-hybrid system. Different amino acids in this motif were substituted with alanine, and the interaction with SUMO-1 was again tested by measuring β-galactosidase levels. These were normalized to that for the initial interaction of the PM-Scl75 motif. A similar motif from the protein furin (43Voorhees P. Deignan E. van Donselaar E. Humphrey J. Marks M.S. Peters P.J. Bonifacino J.S. EMBO J. 1995; 14: 4961-4975Crossref PubMed Scopus (187) Google Scholar) was also tested (sequence b).View Large Image Figur
Referência(s)