Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Overexpression of Macrophage Colony-stimulating Factor Receptor on Microglial Cells Induces an Inflammatory Response

2001; Elsevier BV; Volume: 276; Issue: 32 Linguagem: Inglês

10.1074/jbc.m104265200

ISSN

1083-351X

Autores

Olivera M. Mitrasinovic, Grace V. Perez, Feifei Zhao, Yuen Ling Lee, Clara Poon, Greer M. Murphy,

Tópico(s)

Immune cells in cancer

Resumo

Microglia are important in the inflammatory response in Alzheimer's disease (AD). We showed previously that macrophage colony-stimulating factor receptor (M-CSFR), encoded by the c-fms protooncogene, is overexpressed on microglia surrounding amyloid β (Aβ) deposits in the APPV717F mouse model for AD. The M-CSFR is also increased on microglia after experimental brain injury and in AD. To determine the relevance of these findings, we transiently expressed M-CSFR on murine BV-2 and human SV-A3 microglial cell lines using an SV40-promoted c-fms construct. M-CSFR overexpression resulted in microglial proliferation and increased expression of inducible nitric-oxide synthase, the proinflammatory cytokines interleukin-1α, macrophage inflammatory protein 1-α, and interleukin-6 and of macrophage colony-stimulating factor (M-CSF) itself. Antibody neutralization of M-CSF showed that the M-CSFR-induced proinflammatory response was dependent on M-CSF in the culture media. By using a co-culture of c-fms-transfected murine microglia and rat organotypic hippocampal slices and a species-specific real time reverse transcriptase-polymerase chain reaction assay and enzyme-linked immunosorbent assay, we showed that M-CSFR overexpression on exogenous microglia induced expression of interleukin-1α by the organotypic culture. These results show that increased M-CSFR expression induces microglial proliferation, cytokine expression, and a paracrine inflammatory response, suggesting that in APPV717F mice increased M-CSFR on microglia could be an important factor in Aβ-induced inflammatory response. Microglia are important in the inflammatory response in Alzheimer's disease (AD). We showed previously that macrophage colony-stimulating factor receptor (M-CSFR), encoded by the c-fms protooncogene, is overexpressed on microglia surrounding amyloid β (Aβ) deposits in the APPV717F mouse model for AD. The M-CSFR is also increased on microglia after experimental brain injury and in AD. To determine the relevance of these findings, we transiently expressed M-CSFR on murine BV-2 and human SV-A3 microglial cell lines using an SV40-promoted c-fms construct. M-CSFR overexpression resulted in microglial proliferation and increased expression of inducible nitric-oxide synthase, the proinflammatory cytokines interleukin-1α, macrophage inflammatory protein 1-α, and interleukin-6 and of macrophage colony-stimulating factor (M-CSF) itself. Antibody neutralization of M-CSF showed that the M-CSFR-induced proinflammatory response was dependent on M-CSF in the culture media. By using a co-culture of c-fms-transfected murine microglia and rat organotypic hippocampal slices and a species-specific real time reverse transcriptase-polymerase chain reaction assay and enzyme-linked immunosorbent assay, we showed that M-CSFR overexpression on exogenous microglia induced expression of interleukin-1α by the organotypic culture. These results show that increased M-CSFR expression induces microglial proliferation, cytokine expression, and a paracrine inflammatory response, suggesting that in APPV717F mice increased M-CSFR on microglia could be an important factor in Aβ-induced inflammatory response. Alzheimer's disease macrophage colony-stimulating factor macrophage colony-stimulating factor receptor amyloid β peptide interleukin-1 interleukin-6, MIP-1α, macrophage inflammatory protein-1α inducible nitric-oxide synthase glyceraldehyde-3-phosphate dehydrogenase lactate dehydrogenase enzyme-linked immunosorbent assay reverse transcriptase-polymerase chain reaction phosphate-buffered saline In Alzheimer's disease (AD)1 inflammation mediated by microglia may play a central role in neuronal injury and cognitive decline (1Eikelenboom P. Veerhuis R. Exp. Gerontol. 1999; 34: 453-461Crossref PubMed Scopus (32) Google Scholar, 2Gahtan E. Overmier J.B. Neurosci. Biobehav. Rev. 1999; 23: 615-633Crossref PubMed Scopus (94) Google Scholar, 3Gonzalez-Scarano F. Baltuch G. Annu. Rev. Neurosci. 1999; 22: 219-240Crossref PubMed Scopus (894) Google Scholar, 4Akiyama H. Barger S. Barnum S. Bradt B. Bauer J. Cole G.M. Cooper N.R. Eikelenboom P. Emmerling M. Fiebich B.L. Finch C.E. Frautschy S. Griffin W.S. Hampel H. Hull M. Landreth G. Lue L. Mrak R. Mackenzie I.R. McGeer P.L. O'Banion M.K. Pachter J. Pasinetti G. Plata-Salaman C. Rogers J. Rydel R. Shen Y. Streit W. Strohmeyer R. Tooyoma I. Van Muiswinkel F.L. Veerhuis R. Walker D. Webster S. Wegrzyniak B. Wenk G. Wyss-Coray T. Neurobiol. Aging. 2000; 21: 383-421Crossref PubMed Scopus (3704) Google Scholar). Numerous activated microglia are found in clusters surrounding Aβ plaques in AD (5McGeer P.L. Akiyama H. Itagaki S. McGeer E.G. Can. J. Neurol. Sci. 1989; 16: 516-527Crossref PubMed Scopus (430) Google Scholar, 6Haga S. Akai K. Ishii T. Acta Neuropathol. 1989; 77: 569-575Crossref PubMed Scopus (256) Google Scholar). Cytokines and reactive oxygen and nitrogen species released by microglia are thought to be toxic to neurons, as well as important in sustaining the inflammatory response through autocrine and paracrine effects. Anti-inflammatory medications reduce the risk for AD in humans and slow the progression of AD-like pathology in transgenic mice modeling AD (7Lim G.P. Yang F. Chu T. Chen P. Beech W. Teter B. Tran T. Ubeda O. Ashe K.H. Frautschy S.A. Cole G.M. J. Neurosci. 2000; 20: 5709-5714Crossref PubMed Google Scholar, 8Pratico D. Trojanowski J.Q. Neurobiol. Aging. 2000; 21 (, 451–453): 441-445Crossref PubMed Scopus (110) Google Scholar, 9Anthony J.C. Breitner J.C. Zandi P.P. Meyer M.R. Jurasova I. Norton M.C. Stone S.V. Neurology. 2000; 54: 2066-2071Crossref PubMed Scopus (207) Google Scholar). Identification of molecular targets involved in the initiation and maintenance of inflammation may lead to new therapeutic options for AD. M-CSFR, expressed on cells of the monocyte-macrophage lineage, belongs to the tyrosine kinase type III family of receptors (10Rothwell V.M. Rohrschneider L.R. Oncogene Res. 1987; 1: 311-324PubMed Google Scholar, 11Bourette R.P. Rohrschneider L.R. Growth Factors. 2000; 17: 155-166Crossref PubMed Scopus (107) Google Scholar) and interacts with multiple signal transduction proteins includingsrc kinases, STAT1, Grb2, and phosphoinositide 3-kinase (11Bourette R.P. Rohrschneider L.R. Growth Factors. 2000; 17: 155-166Crossref PubMed Scopus (107) Google Scholar,12Hamilton J.A. Immunol. Today. 1997; 18: 313-317Abstract Full Text PDF PubMed Scopus (27) Google Scholar). We recently showed that microglia surrounding Aβ plaques in the APPV717F transgenic mouse model of AD show increased immunoreactivity for M-CSFR (13Murphy Jr., G.M. Zhao F. Yang L. Cordell B. Am. J. Pathol. 2000; 157: 895-904Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). Increased M-CSFR expression by microglia has been reported on activated microglia after ischemic and mechanical brain injury in mice (14Wang Y. Berezovska O. Fedoroff S. J. Neurosci. Res. 1999; 57: 616-632Crossref PubMed Scopus (69) Google Scholar, 15Raivich G. Haas S. Werner A. Klein M.A. Kloss C. Kreutzberg G.W. J. Comp. Neurol. 1998; 395: 342-358Crossref PubMed Scopus (101) Google Scholar). Furthermore, the M-CSFR is increased on microglia in AD brain, suggesting that overexpression of this receptor is integral to AD pathophysiology (16Akiyama H. Nishimura T. Kondo H. Ikeda K. Hayashi Y. McGeer P.L. Brain Res. 1994; 639: 171-174Crossref PubMed Scopus (111) Google Scholar). The hematopoietic cytokine M-CSF (CSF-1) is expressed by cultured neurons, astrocytes, endothelia, and microglia (17Hao C. Guilbert L.J. Fedoroff S. J. Neurosci. Res. 1990; 27: 314-323Crossref PubMed Scopus (97) Google Scholar, 18Nohava K. Malipiero U. Frei K. Fontana A. Eur. J. Immunol. 1992; 22: 2539-2545Crossref PubMed Scopus (42) Google Scholar, 19Thery C. Stanley E.R. Mallat M. J. Neurochem. 1992; 59: 1183-1186Crossref PubMed Scopus (53) Google Scholar, 20Chung Y. Albright S. Lee F. J. Neuroimmunol. 1994; 52: 9-17Abstract Full Text PDF PubMed Scopus (69) Google Scholar, 21Du Yan S. Zhu H. Fu J. Yan S.F. Roher A. Tourtellotte W.W. Rajavashisth T. Chen X. Godman G.C. Stern D. Schmidt A.M. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5296-5301Crossref PubMed Scopus (404) Google Scholar, 22Lee S.C. Dickson D.W. Liu W. Brosnan C.F. J. Neuroimmunol. 1993; 46: 19-24Abstract Full Text PDF PubMed Scopus (344) Google Scholar). M-CSF induces proliferation, migration, and activation of microglia (23Giulian D. Ingeman J.E. J. Neurosci. 1988; 8: 4707-4717Crossref PubMed Google Scholar, 24Sawada M. Suzumura A. Yamamoto H. Marunouchi T. Brain Res. 1990; 509: 119-124Crossref PubMed Scopus (180) Google Scholar, 25Ganter S. Northoff H. Mannel D. Gebicke-Harter P.J. J. Neurosci. Res. 1992; 33: 218-230Crossref PubMed Scopus (218) Google Scholar, 26Kloss C.U. Kreutzberg G.W. Raivich G. J. Neurosci. Res. 1997; 49: 248-254Crossref PubMed Scopus (109) Google Scholar, 27Shafit-Zagardo B. Sharma N. Berman J. Bornstein M. Brosnan C. Int. J. Dev. Neurosci. 1993; 22: 189-198Crossref Scopus (38) Google Scholar). M-CSF is up-regulated in AD brain (28Deleted in proof.Google Scholar). Furthermore, treatment of cultured microglia with M-CSF results in a dramatic augmentation of Aβ-induced cytokine and nitric oxide production (29Murphy Jr., G.M. Yang L. Cordell B. J. Biol. Chem. 1998; 273: 20967-20971Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). To examine biological relevance of increased M-CSFR abundance on microglia, we overexpressed M-CSFR gene, c-fms(10Rothwell V.M. Rohrschneider L.R. Oncogene Res. 1987; 1: 311-324PubMed Google Scholar), in murine BV-2 and human SV-A3 microglial cell cultures. The effects of increased c-fms expression on microglial proliferation and expression of IL-1α, MIP-1α, iNOS, and IL-6 were determined with real time RT-PCR (30Livak K.J. Flood S.J. Marmaro J. Giusti W. Deetz K. PCR Methods Appl. 1995; 4: 357-362Crossref PubMed Scopus (1331) Google Scholar) and ELISA. We also used a co-culture system consisting of c-fms-transfected BV-2 cells integrated into organotypic hippocampal slices to determine the paracrine effects of c-fms overexpression on cytokine expression in an organotypic environment. Our results indicate that increased expression of c-fms on microglia has powerful proliferative and proinflammatory effects that may contribute to the microglial response in AD and other neurologic disorders. The c-fms expression plasmid pTK1 was a gift from Dr. Rao Tekmal, Emory University School of Medicine. The pTK1 construct contains an SV40-promoted wild-type mouse c-fmssequence that encodes the M-CSFR protein (31Keshava N. Gubba S. Tekmal R.R. J. Soc. Gynecol. Invest. 1999; 6: 41-49Crossref PubMed Scopus (23) Google Scholar). Transfections were performed using mouse BV-2 and human SV-A3 microglial cell lines. The immortalized mouse BV-2 cell line has been characterized extensively (29Murphy Jr., G.M. Yang L. Cordell B. J. Biol. Chem. 1998; 273: 20967-20971Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 32Blasi E. Barluzzi R. Bocchini V. Mazzolla R. Bistoni F. J. Neuroimmunol. 1990; 27: 229-237Abstract Full Text PDF PubMed Scopus (832) Google Scholar, 33Bocchini V. Mazzolla R. Barluzzi R. Blasi E. Sick P. Kettenmann H. J. Neurosci. Res. 1992; 31: 616-621Crossref PubMed Scopus (319) Google Scholar, 34Bitting L. Naidu A. Cordell B. Murphy Jr., G.M. J. Biol. Chem. 1996; 271: 16084-16089Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar, 35Murphy Jr., G.M. Jia X.C. Song Y. Ong E. Shrivastava R. Bocchini V. Lee Y.L. Eng L.F. J. Neurosci. Res. 1995; 40: 755-763Crossref PubMed Scopus (43) Google Scholar). The human SV-A3 cell line was a gift from Dr. Robert Nelson (Pfizer Central Research, Groton, CT). To generate the SV-A3 line, mixed glial cultures were prepared from human fetal brain essentially according to McCarthy and DeVellis (36McCarthy K.D. de Vellis J. J. Cell Biol. 1980; 85: 890-902Crossref PubMed Scopus (3392) Google Scholar). Microglia were shaken off the confluent astrocyte monolayer at day 14 post-plating, replated, and washed after 1 h, and then the cells were immortalized with SV40 T-antigen and adenovirus E1b. The cell line was developed by dilution cloning. The cells are CD68-positive and glial fibrillary acidic protein-negative. SV-A3 cells also express cell surface receptors CD16, CD32, and CD64. 2O. M. Mitrasinovic, G. V. Perez, F.-F. Zhao, Y.-L. Lee, C. Poon, and G. M. Murphy, Jr. unpublished observations. After 6 h of treatment with 1 unit/ml recombinant human IL-1α (R & D Systems, Minneapolis, MN), SV-A3 cells show a 3-fold increase in IL-1α mRNA expression. Thus, SV-A3 cells have many phenotypic features of primary human microglia (37Lee S.C. Liu W. Dickson D.W. Brosnan C.F. Berman J.W. J. Immunol. 1993; 150: 2659-2667PubMed Google Scholar, 38Ulvestad E. Williams K. Mork S. Antel J. Nyland H. J. Neuropathol. Exp. Neurol. 1994; 53: 492-501Crossref PubMed Scopus (107) Google Scholar, 39Williams K. Bar-Or A. Ulvestad E. Olivier A. Antel J.P. Yong V.W. J. Neuropathol. Exp. Neurol. 1992; 51: 538-549Crossref PubMed Scopus (152) Google Scholar). The transient transfections were performed with the LipofectAMINE PLUS® reagent (Life Technologies, Inc.). Mouse BV-2 and human SV-A3 microglia were grown to 60% confluency in 6-well tissue culture dishes. BV-2 cells were grown as described previously (34Bitting L. Naidu A. Cordell B. Murphy Jr., G.M. J. Biol. Chem. 1996; 271: 16084-16089Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). SV-A3 cells were grown in Dulbecco's modified Eagle's medium/Ham's F-12 (Life Technologies, Inc.) supplemented with 10% fetal calf serum (HyClone, Logan, UT) and 1% penicillin/streptomycin (Sigma). Approximately 0.2 µg of the SV40-promoted c-fms expression construct pTK1 was used per 5 × 105 microglial cells for transfection reaction. LipofectAMINE PLUS reagent alone was used as a control treatment. The pZeoSV plasmid (Invitrogen, Carlsbad, CA) (31Keshava N. Gubba S. Tekmal R.R. J. Soc. Gynecol. Invest. 1999; 6: 41-49Crossref PubMed Scopus (23) Google Scholar) used to develop the pTK1 expression construct was included as a second control. BV-2 cells were transfected with 0.2 µg of the pZeoSV vector per 5 × 105 cells using an identical procedure as described above for pTK1. Cells were harvested after 24 h in all experiments except for the c-fms expression kinetics study when additional 12- and 44-h incubation time points were included. At the end of the incubation, cells were either harvested for RNA isolation or fixed, as described below for immunohistochemistry. Because serum contains M-CSF (40Wiktor-Jedrzejczak W. Bartocci A. Ferrante A.W. Ahmed-Ansari A. Sell K.W. Pollard J.W. Stanley E.R. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 4828-4832Crossref PubMed Scopus (887) Google Scholar), the same serum lot was used for all experiments to minimize variation in the amount of ligand available to transfected cells. After 24 h of transfection, cell growth medium was removed, and cells were washed 4 times with 1× PBS buffer (Life Technologies, Inc.) and then fixed with 4% paraformaldehyde in 1× PBS for 20 min at 4 °C. Cells were incubated with a blocking 10% normal goat serum (Zymed Laboratories Inc., South San Francisco, CA) and then washed 3 times for 5 min each in 0.5 m Tris buffer, pH 7.6. Then a rabbit anti-mouse M-CSFR antiserum (Upstate Biotechnology Inc., Lake Placid, NY) was added at a dilution of 1:1000 and reacted during overnight incubation at 4 °C. Cells were subsequently washed 3 times for 10 min each with 0.5 m Tris buffer, pH 7.6, and then incubated for 1 h at 37 °C with a 1:1000 dilution of Cy3-labeled secondary goat anti-rabbit antibody (Jackson ImmunoResearch, West Grove, PA). In the final step, cells were washed 4 times for 10 min each with 0.5m Tris buffer, pH 7.6, and once with equilibration buffer (Molecular Probes, Eugene, OR) before mounting on a glass slide using antifade reagent (Molecular Probes). Sections were examined with confocal microscopy as described previously (13Murphy Jr., G.M. Zhao F. Yang L. Cordell B. Am. J. Pathol. 2000; 157: 895-904Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar). Approximately 1 × 106 BV-2 cells pTK1 transfected for 24 h were pelleted and then resuspended in lysis buffer containing 50 mm mannitol, 5 mm Hepes, pH 7.4, and the enzyme inhibitors phenylmethylsulfonyl fluoride, leupeptin, and pepsin A. The cell lysate was passed 10 times through a 25-gauge needle, after which CaCl2 was added to a final concentration of 10 mm. Cell homogenate was centrifuged at 15,600 × g for 1 min at 4 °C, and the resulting supernatant was subjected to ultracentrifugation at 430,000 ×g for 6 min. The pellet was resuspended in lysis buffer. All protein extractions were performed at 4 °C using ice-cold reagents. Protein concentration was determined by the BCA protein assay (Pierce) before electrophoresis on a polyacrylamide 5% stacking and 8% resolving gel using 50 µg of protein per lane. After protein transfer to polyvinylidene difluoride membrane, immunodetection was performed by overnight incubation at 4 °C with a polyclonal reagent to the extracellular domain of mouse M-CSFR (Upstate Biotechnology, Inc.; dilution 1:1000) or a polyclonal reagent to the intracellular domain of M-CSFR (Santa Cruz Biotechnology, Santa Cruz, CA; dilution 1:200). Blots were then treated for 1 h at room temperature with goat anti-rabbit IgG secondary serum conjugated to horseradish peroxidase (1:500) (Santa Cruz Biotechnology) and visualized with diaminobenzidine as the chromogen. BV-2 cells were grown to 40% confluency in a 6-well tissue culture dish and were subsequently transfected with c-fms expression plasmid pTK1 as described above. After 12, 24, and 44 h, cells were collected by centrifugation and resuspended in 0.5 ml of 1× PBS. The relative cell number was measured using a Coulter particle characterization counter (Beckman Coulter, Miami, FL). The counter was gated for cell size so as to exclude dead cells. Average values were obtained from five independent c-fms transfections, each measured in triplicate, and were compared with the values obtained for control cells (LipofectAMINE PLUS treatment only) that were grown in parallel. The CytoTox 96 kit was used to measure c-fms-induced cytotoxicity in microglia (Promega Corp., Madison, WI). This assay is based on colorimetric measurement of the cytosolic enzyme lactate dehydrogenase (LDH) that is released into culture media after cell injury. BV-2 and SV-A3 microglia were grown to 60% confluency and transfected with pTK1 plasmid as described above. After 24 h, 50 µl of the cell growth media was removed from each sample and assayed for LDH according to the manufacturer's instructions. Colorimetric measurements were performed on a THERMOmax microplate reader (Molecular Devices Corporation, Sunnyvale, CA). The number of lysed cells present in culture was determined by use of a standard curve for LDH and cell numbers. Cytotoxicity experiments were performed three times, and each sample was subsequently assayed in triplicate. Total RNA was isolated using the TRIzol reagent following the manufacturer's instructions (Life Technologies, Inc.). This yielded 10–12 µg of total RNA from 5 × 105 microglial cells. RNA samples were diluted to a final concentration of 1 µg/µl in RNase-free water and stored at −80 °C until use. Synthesis of cDNA was performed using 1 µg of total RNA. The 20-µl reverse transcription reaction consisted of 5× first strand buffer, 0.5 mm dNTP, 50 nmrandom primers, and 20U Superscript reverse transcriptase (all reagents from Life Technologies, Inc.). RNA and primers were mixed and denatured by heating at 70 °C for 10 min, and then the reverse transcription reaction was incubated for 10 min at 25 °C, followed by 50 min at 42 °C and then for 15 min at 70 °C. For the quantitative SYBR Green real time PCR, 250 ng of cDNA was used per reaction. Each 25-µl SYBR Green reaction consisted of 5 µl of cDNA (50 ng/µl), 12.5 µl of 2× Universal SYBR Green PCR Master Mix (PE Biosystems, Foster City, CA), and 3.75 µl of 50 nmforward and reverse primers. Optimization was performed for each gene-specific primer prior to the experiment to confirm that 50 nm primer concentrations did not produce nonspecific primer-dimer amplification signal in no-template control tubes. Primer sequences were designed using Primer Express Software (PerkinElmer Life Sciences) and are presented in Table I. Quantitative PCR was performed on ABI 5700 PCR Instrument (PerkinElmer Life Sciences) by using 3-stage program parameters provided by the manufacturer as follows: 2 min at 50 °C, 10 min at 95 °C, and then 40 cycles of 15 s at 95 °C, and 1 min at 60 °C. Specificity of the produced amplification product was confirmed by examination of dissociation reaction plots. A distinct single peak indicated that single DNA sequence was amplified during PCR. In addition, end reaction products were visualized on ethidium bromide-stained 1.4% agarose gels. Appearance of a single band of the correct molecular size confirmed specificity of the PCR. Each sample was tested in triplicate with quantitative PCR, and samples obtained from at least three independent experiments were used to calculate the means and S.D.Table IReal time RT-PCR primersGene nameGenBank™ accession numberPrimer orientationNucleotide sequence (from 5′ to 3′)Starting sequence positionSize of the PCR ampliconbpM GAPDHM32599ForwardTGAAGCAGGCATCTGAGGG825102ReverseCGAAGGTGGAAGAGTGGGAG926Mc-fmsX06368ForwardTCCACCGGGACGTAGCA239375ReverseCCAGTCCAAAGTCCCCAATCT2467M IL-1αNM_010554ForwardCACAACTGTTCGTGAGCGCT26969ReverseTTGGTGTTTCTGGCAACTCCT337M MIP-1αX12531ForwardCGTTCCTCAACCCCCATC60591ReverseTGTCAGTTCATGACTTTGTCATCAT695M M-CSFX05010ForwardCCCATATTGCGACACCGAA138068ReverseAAGCAGTAACTGAGCAACGGG1447M iNOSNM_010927ForwardGGCAGCCTGTGAGACCTTTG220072ReverseGCATTGGAAGTGAAGCGTTTC2271M IL-6X54542ForwardCTGCAAGAGACTTCCATCCAGTT4570ReverseGAAGTAGGGAAGGCCGTGG114R IL-1αD00403ForwardACATCCGTGGAGCTCTCTTTACA162587ReverseTTAAATGAACGAAGTGAACAGTACAGATT1711R-GAPDHAF106860ForwardAAGAGAGAGGCCCTCAGTTGCT189273ReverseTTGTGAGGGAGATGCTCAGTGT1964H IL-1αX02531ForwardCAGTTGCCCATCCAAACTTGT70776ReverseATAGAGGGTGGCCCCCC782H iNOSL09210ForwardGAGATCAACATTGCTGTGATCCATAG1455115ReverseCACGGGACCGGTATTCATTC1569H 18 S rRNAM10098ForwardCGGCTACCACATCCAAGGAA551187ReverseGCTGGAATTACCGCGGCT737The abbreviations used are: M, mouse; H, human; R, rat. Open table in a new tab The abbreviations used are: M, mouse; H, human; R, rat. M-CSF in serum containing culture media was neutralized by the addition of 1 µg of M-CSF antibody (Santa Cruz Biotechnology) per 1 ml of media. After 24 h of incubation at 37 °C, M-CSF neutralized media were used to culture c-fms-transfected and non-transfected BV-2 cells. Total RNA was harvested, and gene expression was quantified using quantitative RT-PCR as described above. Hippocampal organotypic cultures were prepared from 7-day-old rats using the protocol of Stoppini et al. (41Stoppini L. Buchs P.A. Muller D. J. Neurosci. Methods. 1991; 37: 173-182Crossref PubMed Scopus (2523) Google Scholar) and were 15 days in vitro at the time of assembly of the co-culture with microglia. At 15 daysin vitro, inflammatory cells in organotypic culture are in a resting state (42Czapiga M. Colton C.A. J. Neurosci. Res. 1999; 56: 644-651Crossref PubMed Scopus (68) Google Scholar, 43Coltman B.W. Ide C.F. Int. J. Dev. Neurosci. 1996; 14: 707-719Crossref PubMed Scopus (36) Google Scholar). BV-2 cells were grown to 60% confluency in a 6-well tissue culture dish and were subsequently transfected with c-fms expression plasmid pTK1 as described above 24 h prior to the addition to the co-culture. For the co-culture assembly, BV-2 cells were detached by gentle pipetting and then overlaid on the organotypic hippocampal slice so that final cell density was 250–400 cells/mm2. This density was chosen to simulate the density of activated microglia in AD (44Carpenter A.F. Carpenter P.W. Markesbery W.R. J. Neuropathol. Exp. Neurol. 1993; 52: 601-608Crossref PubMed Scopus (83) Google Scholar). The co-culture was maintained in hippocampal medium containing 50% minimal essential medium, 25% Hanks' balanced salt solution (both from Life Technologies, Inc.), 25% Defined Equine serum (HyClone), 0.5% glucose (Sigma), 0.5%l-glutamine (Applied Scientific, South San Francisco, CA), 0.5% each of penicillin and streptomycin and incubated at 37 °C. To visualize integration of microglia into the organotypic slice, BV-2 cells were labeled by the addition of 20 µg/ml Mini Ruby (Molecular Probes) 24 h prior to co-culturing. To visualize neurons, 24- and 48-h-old co-cultures were fixed with 4% paraformaldehyde for 30 min and then immunostained as described above using a neurofilament primary antibody (Sternberger Monoclonals, Baltimore, MD), and a Cy5-labeled secondary antibody (Jackson ImmunoResearch). To confirm viability of neurons in the BV-2 hippocampal co-culture, cresyl violet staining was utilized on 24- and 48-h co-cultures. Co-cultures were fixed with 1% buffered formalin acetate for 2.5 h at room temperature, stained with cresyl violet acetate (Acros Organics, Fisher Scientific, NJ), differentiated with 95% ethanol, and mounted with aqua-mount (Lerner Laboratories, Pittsburgh, PA) on microslides. Total RNA was isolated from the organotypic co-culture after 24 h of incubation using the TRIzol reagent and was used to prepare cDNA by reverse transcription as described above. Co-culture samples assembled with BV-2 cells overexpressing c-fms were compared using a rat IL-1α specific quantitative PCR assay to control samples containing either non-transfected or transfection media only transfected BV-2 cells. Rat IL-1α-specific primer sequences were designed from a unique sequence segment in rat IL-1α gene (D00403, sequence position 1625–1771) that does not produce alignment in a BLAST search with the mouse version of the IL-1α gene (Table I). SYBR Green quantitative PCR assay was performed as described above. Amplification of cDNA derived from mouse c-fms-transfected BV-2 cells yielded no signal for IL-1α when real time PCR was performed, demonstrating species specificity. IL-1α protein was measured in conditioned media from co-cultures of mouse BV-2 cells and rat hippocampal slices using a rat-specific IL-1α ELISA kit (Endogen, Woburn, MA). Culture supernatant was collected after incubation for 48 h from co-cultures assembled with BV-2 microglia overexpressing c-fms and from co-cultures containing non-transfected BV-2 cells. Media samples were first cleared at 2000 rpm for 5 min and then assayed for rat IL-1α according to the manufacturer's instructions. Concentrations of IL-1α are presented as fold change relative to levels measured in control samples. The experiment was performed five times, and each sample was assayed in triplicate. Fig.1 A shows real time RT-PCR quantification of c-fms expression in mouse microglial BV-2 cells after transient transfection with pTK1 plasmid, whereas Fig.1 B shows expression of endogenous c-fms mRNA in nontransfected cells. Increased expression of c-fms in transfected cells occurred rapidly. Twelve hours from the start of transfection, c-fms mRNA levels increased on average 40-fold and continued to increase to 115-fold higher than base line at 44 h after transfection. As shown in Fig. 1 B, over the same interval endogenous c-fms mRNA in BV-2 cells did not increase more than 2-fold. We also demonstrated increased expression of the M-CSFR after transfection using immunocytochemistry. As shown in Fig. 1 C, a strong increase in the intensity of the M-CSFR immunolabeling was observed in pTK1-transfected BV-2 cells in comparison to control cells. Finally, we confirmed overexpression of M-CSFR protein by Western blot. Fig. 1, D and E,demonstrates expression of the ∼165-kDa M-CSFR after transfection as detected by two different M-CSFR antibodies. Non-transfected BV-2 cells divide as long as sufficient nutrients are available. However, proliferation of BV-2 microglia was increased after pTK1 transfection. As shown in Fig.2, BV-2 proliferation rate increased between 2- and 3-fold after overexpression of c-fms. Fig. 3 Ademonstrates that after 24 h of c-fms transfection there was no major change in toxicity as measured by LDH despite an increase in c-fms mRNA levels of over 80-fold in BV-2 cells. The 2-fold increase in number of dead cells after 24 h was most likely due to the rapid increase in BV-2 cell density that occurred after c-fms transfection. No increase in toxicity was seen after c-fms transfection in human SV-A3 cells. Overexpression of c-fms strongly induced expression of IL-1α mRNA. At 24 h post-transfection with pTK1, the expression of IL-1α mRNA increased 25-fold on average in mouse BV-2 cells (Fig.4 A) and ∼17-fold in SV-A3 human microglia (Fig. 4 B). It should be noted that in SV-A3 cells the transfection medium itself decreased expression of IL-1α, which may have inhibited the level of IL-1α expression after c-fms transfection. Overexpression of c-fms also increased expression of the chemokine MIP-1α (Fig.5 A) and of iNOS, the enzyme responsible for production of nitric oxide by microglia (Fig. 5,C and D). There was a smaller increase of 1.9-fold in the expression of pro-inflammatory cytokine IL-6 (Fig.5 B). Because transfection of macrophages with plasmid DNA can induce a proinflammatory response (45Stacey K.J. Sweet M.J. Hume D.A. J. Immunol. 1996; 157: 2116-2122PubMed Google Scholar), we performed control experiments using pZeoSV vector that was originally used to make pTK1 plasmid (31Keshava N. Gubba S. Tekmal R.R. J. Soc. Gynecol. Invest. 1999; 6: 41-49Crossref PubMed Scopus (23) Google Scholar). No changes in expression of the mRNAs quantified in this study

Referência(s)