Portal de Periódicos da CAPES

Novel Baculovirus DNA Elements Strongly Stimulate Activities of Exogenous and Endogenous Promoters

2002; Elsevier BV; Volume: 277; Issue: 7 Linguagem: Inglês

10.1074/jbc.m108895200

1083-351X

Huei-Ru Lo, C. H. Chou, Tzong‐Yuan Wu, Joyce Pui-Yee Yuen, Yu‐Chan Chao,

Protein purification and stability

A DNA sequence upstream from the polyhedrin gene of baculovirus Autographa californicanucleopolyhedrovirus (AcMNPV) was found to activate strongly the expression of full or minimal promoters derived from AcMNPV and other sources. Promoters tested included the minimal CMV (CMVm) promoter from human cytomegalovirus, the full heat shock 70 promoter fromDrosophila, and the minimal p35 promoter from baculovirus. Deletion and mutagenesis analyses showed that this functional polyhedrin upstream (pu) activator sequence contains three open reading frames (ORFs), ORF4, ORF5, andlef2. In plasmid transfection assays, the pusequence was able to confer high level luciferase expression driven by all of these full or minimal promoters in insect Sf21 cells. A known baculovirus enhancer, the homologous region (hr) of AcMNPV, further enhanced the expression of these promoters. Experiments showed that although multiple hr sequences function in an additive manner, pu and hr together function synergistically, resulting in as much as 18,000-fold promoter activation. Furthermore, a modified CMVm promoter containingpu and/or hr was inserted into the baculovirus genome to drive the luciferase coding region. The CMVm promoter expressed luciferase much earlier, and although it expressed a bit less than did the p10 promoter, the CMVm promoter gave rise to greater luciferase activity. Therefore, we have uncovered a cryptic viral sequence capable of activating a diverse group of promoters. Finally, these experiments demonstrate that synthetic sequences containing pu, hr, and different full or minimal promoters can generate a set of essentially unlimited novel promoters for weak to very strong expression of foreign proteins using baculovirus. A DNA sequence upstream from the polyhedrin gene of baculovirus Autographa californicanucleopolyhedrovirus (AcMNPV) was found to activate strongly the expression of full or minimal promoters derived from AcMNPV and other sources. Promoters tested included the minimal CMV (CMVm) promoter from human cytomegalovirus, the full heat shock 70 promoter fromDrosophila, and the minimal p35 promoter from baculovirus. Deletion and mutagenesis analyses showed that this functional polyhedrin upstream (pu) activator sequence contains three open reading frames (ORFs), ORF4, ORF5, andlef2. In plasmid transfection assays, the pusequence was able to confer high level luciferase expression driven by all of these full or minimal promoters in insect Sf21 cells. A known baculovirus enhancer, the homologous region (hr) of AcMNPV, further enhanced the expression of these promoters. Experiments showed that although multiple hr sequences function in an additive manner, pu and hr together function synergistically, resulting in as much as 18,000-fold promoter activation. Furthermore, a modified CMVm promoter containingpu and/or hr was inserted into the baculovirus genome to drive the luciferase coding region. The CMVm promoter expressed luciferase much earlier, and although it expressed a bit less than did the p10 promoter, the CMVm promoter gave rise to greater luciferase activity. Therefore, we have uncovered a cryptic viral sequence capable of activating a diverse group of promoters. Finally, these experiments demonstrate that synthetic sequences containing pu, hr, and different full or minimal promoters can generate a set of essentially unlimited novel promoters for weak to very strong expression of foreign proteins using baculovirus. In a previous study, we established a tetracycline-responsive expression system (TRES) 1The abbreviations used are:TREStetracycline-responsive expression systemAcMNPVAutographa californica nucleopolyhedrovirusCMVmminimal CMV promoterhpihours postinfectionhrhomologous regionLucluciferaseORFopen reading framePCmpromoter contains pu and CMVmPHCmpromoter contains pu, hr, and CMVmPHHpromoter contains pu, hr, and heat shock 70 promoterpupolyhedrin upstream activator sequenceSf21Spodoptera frugiperda celltetOtetracycline operatorTREa sequence containing seven copies of thetetO elementTricineN-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl] glycinetTAtetracycline-controllable transactivator in insect cells (1Wu T.Y. Lin D.G. Chen S.L. Chen C.Y. Chao Y.C. J. Biotechnol. 2000; 80: 75-83Crossref PubMed Scopus (26) Google Scholar). The insect TRES contains two components. The first component is a plasmid containing the p10 promoter, which drives the tetracycline-controllable transactivator (p10-tTA); the second component is a plasmid containing the tetracycline operator (tetO) DNA sequence fused to a minimal CMV (CMVm) promoter and a reporter luciferase sequence further downstream from the promoter (tetO-CMVm-Luc (2Gossen M. Bujard H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5547-5551Crossref PubMed Scopus (4268) Google Scholar)). The CMVm is a sequence derived from the human cytomegalovirus immediate-early promoter (2Gossen M. Bujard H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5547-5551Crossref PubMed Scopus (4268) Google Scholar). In the insect TRES, tTA is expressed from a transfected plasmid and binds to the fusedtetO and CMVm (tetO-CMVm) promoter to activate the expression of luciferase. Essentially no luciferase activity can be detected if the second component, tetO-CMVm-Luc, is transfected alone; with cotransfection of the first component (p10-tTA), which expresses tTA, strong luciferase activity can be observed (1Wu T.Y. Lin D.G. Chen S.L. Chen C.Y. Chao Y.C. J. Biotechnol. 2000; 80: 75-83Crossref PubMed Scopus (26) Google Scholar). In a previous set of experiments, we found that other than plasmid transfection, the first component, p10-tTA, can also be expressed in a recombinant baculovirus to make the TRES functional (1Wu T.Y. Lin D.G. Chen S.L. Chen C.Y. Chao Y.C. J. Biotechnol. 2000; 80: 75-83Crossref PubMed Scopus (26) Google Scholar). In the present study, we tested whether the second component, tetO-CMVm, could be inserted and expressed in the genome of baculovirus for TRES functioning. Surprisingly, although we found that the activity of the full CMV promoter is extremely weak in insect cells (1Wu T.Y. Lin D.G. Chen S.L. Chen C.Y. Chao Y.C. J. Biotechnol. 2000; 80: 75-83Crossref PubMed Scopus (26) Google Scholar), the CMVm promoter can be stimulated strongly in the genome of a baculovirus without tTA activation. The strong expression of the CMVm promoter could be seen by either inserting this minimal promoter in the transfer plasmid pAcUW21 (PharMingen) or in the baculovirus genome. We reason that this may be caused by the functioning of some genes or unknown enhancer sequences in the baculovirus genome, and thus the structure and function of these auxiliary sequence are worthy of further investigation. tetracycline-responsive expression system Autographa californica nucleopolyhedrovirus minimal CMV promoter hours postinfection homologous region luciferase open reading frame promoter contains pu and CMVm promoter contains pu, hr, and CMVm promoter contains pu, hr, and heat shock 70 promoter polyhedrin upstream activator sequence Spodoptera frugiperda cell tetracycline operator a sequence containing seven copies of thetetO element N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl] glycine tetracycline-controllable transactivator Baculoviruses consist of a group of viruses that contain circular double-stranded DNA genomes of 90–160 kb (3Blissard G.W. Rohrmann G.F. Annu. Rev. Entomol. 1990; 35: 127-155Crossref PubMed Scopus (442) Google Scholar). The circular 131-kb DNA genome of Autographa californica nucleopolyhedrovirus (AcMNPV) is composed almost entirely of unique DNA sequences, except for several small repeats known as homologous regions (hrs). The hrs, interspersed within the viral genome (4Ayres M.D. Howard S.C. Kuzio J. Lopez-Ferber M. Possee R.D. Virology. 1994; 202: 586-605Crossref PubMed Scopus (854) Google Scholar, 5Cochran M.A. Faulkner P. J. Virol. 1983; 45: 961-970Crossref PubMed Google Scholar, 6Guarino L.A. Summers M.D. J. Virol. 1986; 60: 215-223Crossref PubMed Google Scholar), have been found to be enhancers for early gene transcription (6Guarino L.A. Summers M.D. J. Virol. 1986; 60: 215-223Crossref PubMed Google Scholar, 7Guarino L.A. Gonzalez M.A. Summers M.D. J. Virol. 1986; 60: 224-229Crossref PubMed Google Scholar) and as origins of DNA replication (8Kool M. Voeten J.T. Goldbach R.W. Tramper J. Vlak J.M. J. Gen. Virol. 1993; 74: 2661-2668Crossref PubMed Scopus (86) Google Scholar, 9Pearson M. Bjornson R. Pearson G. Rohrmann G. Science. 1992; 257: 1382-1384Crossref PubMed Scopus (156) Google Scholar). The hrs form a complex directly or indirectly with IE-1, an early viral regulatory protein (10Choi J. Guarino L.A. J. Virol. 1995; 69: 4548-4551Crossref PubMed Google Scholar, 11Kovacs G.R. Choi J. Guarino L.A. Summers M.D. J. Virol. 1992; 66: 7429-7437Crossref PubMed Google Scholar), and with insect cellular proteins (12Guarino L.A. Dong W. J. Virol. 1991; 65: 3676-3680Crossref PubMed Google Scholar). In infection of host insect cells by baculoviruses, three phases of viral gene expression, namely early, late, and very late, can be distinguished (13Morris T.D. Miller L.K. J. Virol. 1992; 66: 7397-7405Crossref PubMed Google Scholar). Cells undergo significant changes during the first 6 h of infection, a time period that constitutes the early phase of infection and precedes viral DNA replication. This early phase is followed by the late phase, a period of extensive viral DNA replication, late gene expression, and budding virus production. The late phase extends from 6 h postinfection (hpi) to ∼20–24 hpi. The very late phase, also known as occlusion-specific phase, begins around 20 hpi. In this phase, the very late gene products, p10 and polyhedrin, are produced in large amounts, and there is a clear microscopic indication of the formation of inclusion bodies. The baculovirus expression vector system is one of the most popular systems for production of recombinant proteins. Recombinant proteins are expressed at very high levels under the control of two very late polyhedrin and p10 promoters (11Kovacs G.R. Choi J. Guarino L.A. Summers M.D. J. Virol. 1992; 66: 7429-7437Crossref PubMed Google Scholar, 12Guarino L.A. Dong W. J. Virol. 1991; 65: 3676-3680Crossref PubMed Google Scholar). Various sources have suggested that the expression from a very late promoter is 10–20-fold (13Morris T.D. Miller L.K. J. Virol. 1992; 66: 7397-7405Crossref PubMed Google Scholar) or 50-fold (14Jarvis D.L. Weinkauf C. Guarino L.A. Protein Expression Purif. 1996; 8: 191-203Crossref PubMed Scopus (127) Google Scholar) stronger than that from an early promoter or from an insect promoter. However, the cellular machinery critical for post-translational processing is generally in a deteriorated condition during the late and very late phases of baculovirus infection. Therefore, the use of early promoters for recombinant protein expression is an alternative approach to improve protein quality, although activities of the currently available early promoters are low compared with those of the very late promoters. In this article, we found that although the full CMV promoter is not functioning properly in insect cells or baculoviruses, by the stimulation of a baculovirus sequence upstream of the polyhedrin gene, the CMVm promoter can be strongly activated. This polyhedrin gene upstream activator sequence contains at least three open reading frames (ORFs) and can strongly enhance the expression of various exogenous and endogenous promoters. Some of these promoters could be activated synergistically by this upstream sequence and hr and become stronger than the p10 promoter in transient expression assays. During the early phase of viral infection, CMVm was expressed strongly in the recombinant baculoviruses. The proteins expressed by the CMVm promoter were much less degraded with an activity better than those produced by the p10 promoter. Thus, this upstream activator sequence is a novel type of activator identified from baculovirus. The Spodoptera frugiperda IPLB-Sf21 (Sf21) cell line was cultured as monolayers in TNM-FH insect medium containing 8% heat-inactivated fetal bovine serum (15Lee J.C. Chen H.H. Chao Y.C. J. Virol. 1998; 72: 9157-9165Crossref PubMed Google Scholar, 16Lin J.L. Lee J.C., Li, M.L. Chao Y.C. J. Virol. 1999; 73: 128-139Crossref PubMed Google Scholar). It was used for propagation and infection of wild type AcMNPV. All viral stocks were prepared and titers determined according to the standard protocol described by O'Reilly et al. (17O'Reilly D.R. Miller L.K. Luckow V.A. Baculovirus Expression Vectors: A Laboratory Manual. Oxford University Press, New York1994Google Scholar). All infections and coinfections of virus AcMNPV were performed using a multiplicity of infection of 1. Plasmids tested for expression of protein tTA or luciferase were transfected into 4 × 104 Sf21 cells seeded in wells of a 96-well plate. Each plasmid at 0.1 μg was transfected using 0.5 μg of Lipofectin (Invitrogen) per well in 50 μl of serum-free TNM-FH according to the protocol provided by the manufacturer. After transfection for 8–14 h at 27 °C, the transfection medium was removed and replaced with 100 μl of TNM-FH medium containing 8% heat-inactivated fetal bovine serum. After incubation at 27 °C for 24 h, wild type AcMNPV at a multiplicity of infection of 1 was added into Sf21 cells to assist the proper expression of the transfected promoters. Luciferase activity was assayed 3 days after infection. Cells of each well were lysed for 10 min in 100 μl of culture cell lysis reagent containing 100 mm potassium phosphate (pH 7.8), 1 mm EDTA, 10% glycerol, 1% Triton X-100, and 7 mm β-mercaptoethanol. After centrifugation at 14,000 rpm for 10 min, the lysate supernatant (5–50 μl) was incubated in 180 μl of luciferase assay reagent containing 25 mm Tricine (pH 7.8), 15 mm potassium phosphate (pH 7.8), 15 mm MgSO4, 4 mm EGTA, 1 mm ATP, and 0.1 mm dithiothreitol. 50 μl of 0.2 mm luciferin (Promega) solution was autoinjected, and relative light units were measured by a luminometer (Berthold, Lumat LB 9501). The concentration of total protein in cell lysate was determined using a Coomassie protein assay reagent kit (Pierce). Data (mean ± S.D.) were collected from triplicate assays of three independent transfections or viral infection experiments. Deletion constructs are shown in the various figures together with their activity assays. All PCR products were confirmed by DNA sequence analysis. The CMVm and TRE-CMVm promoters were originally constructed by Gossen and Bujard (2Gossen M. Bujard H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5547-5551Crossref PubMed Scopus (4268) Google Scholar). The CMVm promoter encompasses the sequence from +75 to −53 of the full CMV promoter, and the TRE-CMVm promoter contains seven copies of the 42-bp tetO sequence derived from Tn10 which are fused to the CMVm promoter (2Gossen M. Bujard H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5547-5551Crossref PubMed Scopus (4268) Google Scholar). The luciferase coding sequence from the pTRE-Luc plasmid (bp positions 507–2187, CLONTECH), driven by CMVm or TRE-CMVm promoters, was inserted into pAcUW21 (PharMingen, Fig. 1) to replace the p10promoter originally located in this plasmid. The resulting plasmids were named pAPcmL and pAPtcmL, respectively (Fig. 1). The same luciferase coding sequence from the pTRE-Luc plasmid was also cloned into pAcUW21 under the control of the p10 promoter of AcMNPV in the plasmid pAcUW21, and the resulting plasmid was named pAP10L (Fig. 1). The full CMV promoter derived from pTet-Off (from bp positions 68 to 673, CLONTECH) together with the luciferase coding region were inserted into pAcUW21 in place of thep10 promoter, and the resulting plasmid was named pAPcL (Fig. 1). The coding region of the tTA transactivator protein, from plasmid pTet-Off (CLONTECH) was cloned into pAcUW21 under control of the p10 promoter, and the resulting plasmid was named pAP10T (Fig. 1). The polyhedrin gene (polh) downstream sequences were deleted from plasmid pAPcmL (see Fig.3 A), and the resulting plasmid was named pAPcmLΔpd (see Fig. 3 B). Plasmid pAPcmLΔpd (see Fig. 3 B) was generated by first digesting pAPcmL (see Fig. 3 A) with AlwNI, blunt ending it with T4 DNA polymerase, and then cutting it withXhoI. The resulting fragment was subcloned intoXhoI-SmaI-digested plasmid pBluescript (pBSKSM+, Stratagene). Plasmid pAPcmLΔpdu (see Fig.3 B) contains only partial polyhedrin gene upstream sequences. This deletion construct was obtained by digesting pAPcmL (see Fig. 3 B) with BstXI, blunt ending it with T4 DNA polymerase, then further digesting it with XhoI, followed by subcloning this BstXI-XhoI-digested fragment into XhoI-SmaI-digested pBSKSM+ (see Fig. 3 B). Plasmids pAPcmLΔpu1 to pAPcmLΔpu7 were constructed for deletion analysis of the pu sequence (see Fig. 3 C). The pAPcmLΔpu1 was made by MluI digestion followed by self-ligation of pAPcmL. Plasmids pAPcmLΔpu2 and pAPcmLΔpu3 were generated by cutting pAPcmL with MluI and BglII and then ligating, respectively, with a 5′-MluI/3′-BglII PCR-amplified product containing pAPcmL nucleotides 1877–2562 and 2218–2562 (see Fig. 3 C). Plasmid pAPcmLΔpu4 was constructed by cutting pAPcmL withMluI and BglII, blunt ending with T4 DNA polymerase, and re-ligating with T4 DNA ligase. To generate pAPcmLΔpu5 and pAPcmLΔpu6, pAPcmL was digested with MluI and BglII, and respectively ligated with the 5′-MluI/3′-BglII PCR-amplified product containing pAPcmL nucleotides 546–883 and 546–1198 (see Fig. 3 C). Plasmid pAPcmLΔpu7 was constructed by digesting pAPcmL withBstXI and BglII, blunt ending with T4 DNA polymerase, and re-ligating with T4 DNA ligase. The ORF603 deletion construct pAPcmLΔ603 was generated by partial digestion of pAPcmL with MluI and complete digestion withBglII followed by blunt ending and re-ligation. Plasmid pAPcmLΔ4–5 was produced from pAPcmLΔpd first by MluI partial digestion and then BglII complete digestion followed by blunt ending and re-ligation. The derived plasmid (pBSKcmL), which lacks ORF603, was digested further with NotI (in multiple cloning sites at the 3′-end of ORF4) and partially cut withMluI. These restriction sites were further blunt ended with T4 DNA polymerase, re-ligated, and resulted in deletion of ORF4 and part of the 5′-end of ORF5. This resulted plasmid pAPcmLΔ4–5. 3′-MluI and 5′-blunt ends were introduced into two PCR-generated fragments from pAPcmL containing nucleotides 377–626 and 183–626 (Fig. 3 C). Subcloning these intoNotI/blunt ended and MluI-digested pBSKcmL produced the ORF4 deletion constructs of pAPcmLΔ41 and pAPcmLΔ42, respectively. To test the role played by ORF5 alone, a frameshift mutation was introduced into this ORF in plasmid pAPcmLΔpd. The dinucleotide GC was inserted at positions 20 and 21 from the translational initiation site of the ORF5 (original sequence: ATGTATCGCACGTCAAGAATT; after GC insertion: ATGTATCGCACGTCAAGAAGCTT) to create a frameshift mutation. The plasmid carrying this frameshift mutation was named pAPpu-5FcmL (see Fig. 3 C). All plasmids described in this paragraph are listed in Fig. 3. Fragment cmL was derived from pTRE-Luc (CLONTECH) containing only the CMVm promoter and a luciferase coding sequence (Fig. 3). To produce pApu(D)cmL (Fig. 4), pAPcmLΔ603 (see Fig. 3 C) was digested withAlwNI, blunt ended, and then cut with XhoI (forAlwNI and XhoI sites, see Fig. 3 A). The resulting fragment was subcloned intoXhoI-SmaI-digested pBSKSM+(Stratagene). pApu(U)cmL (Fig. 4) was generated by inserting a 5′-AatII/3′-XhoI pu fragment amplified by PCR containing the full-length ORF4, ORF5, and lef2 intoAatII-XhoI-digested pcmL (Fig. 1). The (D) and (U) indicate that the pu sequence is located downstream or upstream, respectively, from the CMVm promoter. All plasmids constructed as described in the following paragraph are listed in Fig. 8. Construction of plasmid pAPhcmL is described below. AnXhoI-digested hr1 PCR fragment (4Ayres M.D. Howard S.C. Kuzio J. Lopez-Ferber M. Possee R.D. Virology. 1994; 202: 586-605Crossref PubMed Scopus (854) Google Scholar, 18Lee J.C. Chao Y.C. J. Gen. Virol. 1998; 79: 2293-2300Crossref PubMed Scopus (6) Google Scholar) was cloned into pcmL to generate phcmL. Using PCR, a fragment containing hr1-CMVm promoter-luc was produced from phcmL and ligated into pAPtcmL, which had been digested by XhoI and EcoRV to remove thetet operators, CMVm promoter, and luc gene. This resulted in pAPhcmL. Plasmid phL was constructed from plasmid pTRE-Luc (CLONTECH) by removing aXhoI-BamHI fragment containing tetoperators and the CMVm promoter and replacing with an hsp70promoter from pKih35hN (18Lee J.C. Chao Y.C. J. Gen. Virol. 1998; 79: 2293-2300Crossref PubMed Scopus (6) Google Scholar). A PCR fragment that contains the 457-bp hr1 region (4Ayres M.D. Howard S.C. Kuzio J. Lopez-Ferber M. Possee R.D. Virology. 1994; 202: 586-605Crossref PubMed Scopus (854) Google Scholar, 18Lee J.C. Chao Y.C. J. Gen. Virol. 1998; 79: 2293-2300Crossref PubMed Scopus (6) Google Scholar) was generated from AcMNPV genomic DNA by PCR using primers carrying XhoI site at both ends. The fragment was ligated in front of the hsp70promoter in phL to generate phhL. Primers to 5′ ofhr1 and 3′ of SV40 poly(A) of the luc gene in phhL were used to generate a blunt ended PCR product containing hr1-hsp70-luc. The product was ligated into pCR-Blunt (Invitrogen) to generate an intermediate plasmid pCRhhL, from which the fragment containinghr1-hsp70-luc was obtained by digestion and then ligated into pAcUW21 (PharMingen) to generate pAPhhL. Using the megaprimer PCR technique (19Barik S. Methods Mol. Biol. 1997; 67: 173-182PubMed Google Scholar), a 45-bp minimal p35promoter (20Rodems S.M. Friesen P.D. J. Virol. 1993; 67: 5776-5785Crossref PubMed Google Scholar) fused to the luc gene was generated from AcMNPV genomic DNA and pTRE-Luc. The product was cloned into pCR-Blunt vector to yield p35ml. An XhoI-digested hr1 fragment was cloned into the XhoI site in front of the minimal p35 promoter to yield ph35ml. A fragment containing hr1, minimal p35 promoter, and theluc gene was obtained from ph35ml byApaI digestion, blunt ended, and cloned into pAcUW21 to generate pAPh35ml. All PCR-generated fragments mentioned above were verified by sequencing. Protein samples, at 0.1 μg each, were fractionated on a 12% SDS-PAGE and then transferred to a Hyperbond P membrane (Amersham Biosciences, Inc.). The membrane was blocked with Tris-buffered saline (TTBS: 100 mm Tris, pH 7.4, 100 mm NaCl, and 0.1% Tween 20) containing 5% non-fat dry milk (Bio-Rad Laboratories) at room temperature for 1 h with gentle shaking on an orbital shaker. The membrane was incubated with 1:5,000 diluted anti-luciferase antibody (Cortex Biochem) in TTBS overnight at room temperature. Unbounded antibodies were removed by two 15-min washes and two 5-min washes in fresh TTBS buffer at room temperature with shaking. Then the membrane was incubated with 1:2,500 diluted horseradish peroxidase-conjugated antibody for 1 h at room temperature. After removing the unbound secondary antibody by the same washes in TTBS buffer as described above, protein bands bound by the antibody were visualized by developing the membrane using an enhanced chemiluminescence kit (ECL; Amersham Biosciences, Inc.) following the protocol provided by the manufacturer. In the present study, the baculovirus transfer plasmid pAcUW21 (PharMingen) was the primary plasmid used for further constructions. This plasmid contains an intact polyhedrin gene and ap10 promoter; both the gene and the promoter are sandwiched between lateral DNA fragments adjacent to the polyhedrin gene of the baculovirus. In Fig. 1, the luciferase coding region, as driven by the CMV, p10, CMVm, and tetO-CMVm promoters, was cloned into plasmid pAcW21 to result in plasmids pAPcL, pAP10L, pAPcmL, and pAPtcmL, respectively. The resultant recombinant viruses were termed vAPcL, vAP10L, vAPcmL, and vAPtcmL, respectively. The promoterp10 was also used to drive tTA to yield plasmid pAP10T and virus vAP10T. Finally, plasmid pTRE-Luc (CLONTECH) was used as a necessary control. This is a plasmid that lacks any baculovirus sequence, and the tetO-CMVm promoter is used to drive the luciferase coding region. Previously, we showed that luciferase activity is extremely low when pTRE-Luc is transfected into insect cells, but it can be strongly stimulated by coinfection with vAP10T (1Wu T.Y. Lin D.G. Chen S.L. Chen C.Y. Chao Y.C. J. Biotechnol. 2000; 80: 75-83Crossref PubMed Scopus (26) Google Scholar). However, we found that when the tetO-CMVm promoter was inserted into plasmid pAcUW21, resulting in the plasmid pAPtcmL (Fig. 1), the luciferase activity could be increased without stimulation by tTA. More interestingly, luciferase activity was further highly stimulated upon coinfection with wild type AcMNPV (Fig. 2 A). Viral stimulation of luciferase expression remained for the plasmid pAPcmL (Fig. 2 A). The only difference between plasmids pAPtcmL and pAPcmL is the omission of a tetO sequence in plasmid pAPcmL (Fig. 1). These experiments showed that although thetetO element did not influence luciferase expression by the CMVm promoter (in pAPtcmL, Fig. 2 A), a short CMVm promoter sequence (in pAPcmL) could give rise to strong luciferase expression in the presence of baculovirus lateral fragments surrounding the polyhedrin promoter. Contrarily, a longer sequence containing a full CMV promoter (in pAPcL) blocked its high level expression. In addition to not being expressed by plasmid transfection (Fig. 2 A), the full CMV promoter was also only weakly expressed upon infection of recombinant baculovirus, regardless of the presence of the same baculovirus lateral fragments (Fig. 2 B). Thus, the viral activation appeared to be restricted to a short CMVm promoter sequence and required the presence the of polyhedrin gene lateral DNA fragments of the baculovirus (Figs. 1 and 2). To determine whether viral activation of the CMVm promoter only occurs in the plasmids or can also occur in the genome of the virus, we further tested luciferase expression by infection of recombinant viruses vAPcL, vAPtcmL, vAPcmL, and vAP10L. In order not to miss clones with particularly high levels of luciferase expression, multiple clones of separate recombinant viral constructs were isolated, and the activities of promoters in different clones were tested individually. All three tested individual vAPcL clones only expressed weak luciferase activities. However, all individual vAPtcmL, vAPcmL, and vAP10L clones gave rise to strong luciferase activities (Fig.2 B). The stimulation was obviously not related to the TRES machinery because the luciferase activity of vAPtcmL infection was neither further stimulated by the coinfection of vAP10T nor significantly suppressed upon the addition of tetracycline (Fig.2 C). To identify the viral DNA sequences responsible for the activation of the CMVm promoter, viral lateral fragments appearing in the transfer vector were deleted separately using convenient sites. According to genetic computer group (GCG) comparison, pAPcmL (Fig. 3 A) contains seven baculovirus genes and ORFs that flank the CMVm promoter. To investigate the roles of specific baculovirus genes or sequences in the activation of CMVm promoter activity in baculoviruses, two deletion plasmids were first constructed. The polyhedrin and the downstream genes were deleted, which resulted in pAPcmLΔpd. With further deletion of all or part of ORF4, ORF5, and lef2, a new construct, pAPcmLΔpdu, resulted. The full luciferase activity in cells transfected with pAPcmL followed by AcMNPV infection was used to normalize the luciferase activity (as 100%) of the deleted plasmid constructs. High luciferase activity remained in the transfection of plasmid pAPcmLΔpd, suggesting that the polyhedrin downstream sequence is not critical for the activation of the CMVm promoter (Fig.3 B). The construct pAPcmLΔpdu, which contains intact ORF603, failed to support high luciferase expression (Fig.3 B). Therefore, viral sequences upstream of the polyhedrin gene are responsible for activation of CMVm promoter and thus deserve further examination. Results of further deletions in the polyhedrin upstream sequence are shown in Fig. 3 C. All transient expression experiments were done with coinfection of wild type AcMNPV. Because the only difference between plasmids pAPcmLΔpd and pAPcmLΔpdu is the removal of ORF4, ORF5, and lef2 from the former plasmid, these ORFs were further analyzed separately. Plasmids pAPcmLΔpu1, pAPcmLΔpu2, pAPcmLΔpu3, and pAPcmLΔpu4 are constructs that contain ORF4 with a gradual removal of the ORF603 region. Transfection of these plasmids showed that the existence of ORF4 alone has no effect on the activation of the CMVm promoter. Plasmids pAPcmLΔpu5, pAPcmLΔpu6, pAPcmLΔpu7, and pAPcmLΔ603 are constructs containing a gradual extension of the viral DNA sequence from ORF4 to the lef2 region. Transfection of these constructs showed that plasmid pAPcmLΔ603, the only plasmid that contains all three ORFs (ORF4, ORF5, and lef2), gave rise to full activation of the CMVm promoter. Deletion of ORF4 (pAPcmLΔ4–5, pAPcmLΔ41, and pAPcmLΔ42), or both ORF4 and ORF5 (pAPcmLΔ4–5), from plasmid pAPcmLΔ603, again, completely suppressed the activity of the CMVm promoter. A previous set of experiments showed that the existence of ORF4, ORF5, and lef2 confer full promoter activity. We have also demonstrated that the deletion of individual ORFs, lef2 (pAPcmLΔpu5, pAPcmLΔpu6, pAPcmLΔpu7) or ORF4 (pAP- cmLΔ41), and pAPcmLΔ42 alone, abolished promoter activity. To test the role played by ORF5 alone, a frameshift mutation in this ORF was also constructed. It was found that the promoter activity was abolished without having functional ORF5 (pAPpu-5FcmL, Fig. 3 C). Thus, with viral coinfection, all th