Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Porphyrins Promote the Association of GENOMES UNCOUPLED 4 and a Mg-chelatase Subunit with Chloroplast Membranes

2009; Elsevier BV; Volume: 284; Issue: 37 Linguagem: Inglês

10.1074/jbc.m109.025205

ISSN

1083-351X

Autores

Neil D. Adhikari, Robert Orler, Joanne Chory, John E. Froehlich, Robert M. Larkin,

Tópico(s)

Porphyrin and Phthalocyanine Chemistry

Resumo

In plants, chlorophylls and other tetrapyrroles are synthesized from a branched pathway that is located within chloroplasts. GUN4 (GENOMES UNCOUPLED 4) stimulates chlorophyll biosynthesis by activating Mg-chelatase, the enzyme that commits porphyrins to the chlorophyll branch. GUN4 stimulates Mg-chelatase by a mechanism that involves binding the ChlH subunit of Mg-chelatase, as well as a substrate (protoporphyrin IX) and product (Mg-protoporphyrin IX) of Mg-chelatase. We chose to test whether GUN4 might also affect interactions between Mg-chelatase and chloroplast membranes, the site of chlorophyll biosynthesis. To test this idea, we induced chlorophyll precursor levels in purified pea chloroplasts by feeding these chloroplasts with 5-aminolevulinic acid, determined the relative levels of GUN4 and Mg-chelatase subunits in soluble and membrane-containing fractions derived from these chloroplasts, and quantitated Mg-chelatase activity in membranes isolated from these chloroplasts. We also monitored GUN4 levels in the soluble and membrane-containing fractions derived from chloroplasts fed with various porphyrins. Our results indicate that 5-aminolevulinic acid feeding stimulates Mg-chelatase activity in chloroplast membranes and that the porphyrin-bound forms of GUN4 and possibly ChlH associate most stably with chloroplast membranes. These findings are consistent with GUN4 stimulating chlorophyll biosynthesis not only by activating Mg-chelatase but also by promoting interactions between ChlH and chloroplast membranes. In plants, chlorophylls and other tetrapyrroles are synthesized from a branched pathway that is located within chloroplasts. GUN4 (GENOMES UNCOUPLED 4) stimulates chlorophyll biosynthesis by activating Mg-chelatase, the enzyme that commits porphyrins to the chlorophyll branch. GUN4 stimulates Mg-chelatase by a mechanism that involves binding the ChlH subunit of Mg-chelatase, as well as a substrate (protoporphyrin IX) and product (Mg-protoporphyrin IX) of Mg-chelatase. We chose to test whether GUN4 might also affect interactions between Mg-chelatase and chloroplast membranes, the site of chlorophyll biosynthesis. To test this idea, we induced chlorophyll precursor levels in purified pea chloroplasts by feeding these chloroplasts with 5-aminolevulinic acid, determined the relative levels of GUN4 and Mg-chelatase subunits in soluble and membrane-containing fractions derived from these chloroplasts, and quantitated Mg-chelatase activity in membranes isolated from these chloroplasts. We also monitored GUN4 levels in the soluble and membrane-containing fractions derived from chloroplasts fed with various porphyrins. Our results indicate that 5-aminolevulinic acid feeding stimulates Mg-chelatase activity in chloroplast membranes and that the porphyrin-bound forms of GUN4 and possibly ChlH associate most stably with chloroplast membranes. These findings are consistent with GUN4 stimulating chlorophyll biosynthesis not only by activating Mg-chelatase but also by promoting interactions between ChlH and chloroplast membranes. Chlorophylls are produced from a branched pathway located within plastids that also produces heme, siroheme, and phytochromobilin. In photosynthetic organisms, the universal tetrapyrrole precursor 5-aminolevulinic acid (ALA) 3The abbreviations used are:ALA5-aminolevulinic acidDPIXdeuteroporphyrin IXLHCPlight-harvesting chlorophyll a/b-binding proteinGSTglutathione S-transferase, GUN4, GENOMES UNCOUPLED 4Mg-DPIXMg-deuteroporphyrin IXMg-PPIXMg-protoporphyrin IXMg-PPIX MTMg-PPIX methyl transferaseORFopen reading framePOprotoporphyrinogen IX oxidasePPIXprotoporphyrin IXSSthe small subunit of ribulose-bisphosphate carboxylase/oxygenaseTic40Translocon at the inner envelope 40Ni-NTAnickel-nitrilotriacetic acidDTTdithiothreitolMOPS4-morpholinepropanesulfonic acidTricineN-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycineMg-PPIX MEMg-protoporphyrin IX monomethyl ester. is derived from glutamyl-tRNA and subsequently converted into protoporphyrinogen IX in the chloroplast stroma. Protoporphyrinogen IX is converted to protoporphyrin IX (PPIX) and then ultimately to chlorophylls on plastid membranes. Almost all the genes encoding chlorophyll biosynthetic enzymes have been identified. Transcriptional control provides coarse regulation of this pathway, and the regulation of enzyme activities provides fine regulation (1Stephenson P.G. Terry M.J. Photochem. Photobiol. Sci. 2008; 7: 1243-1252Crossref PubMed Scopus (55) Google Scholar, 2Tanaka R. Tanaka A. Annu. Rev. Plant Biol. 2007; 58: 321-346Crossref PubMed Scopus (554) Google Scholar). 5-aminolevulinic acid deuteroporphyrin IX light-harvesting chlorophyll a/b-binding protein glutathione S-transferase, GUN4, GENOMES UNCOUPLED 4 Mg-deuteroporphyrin IX Mg-protoporphyrin IX Mg-PPIX methyl transferase open reading frame protoporphyrinogen IX oxidase protoporphyrin IX the small subunit of ribulose-bisphosphate carboxylase/oxygenase Translocon at the inner envelope 40 nickel-nitrilotriacetic acid dithiothreitol 4-morpholinepropanesulfonic acid N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine Mg-protoporphyrin IX monomethyl ester. Arabidopsis GUN4 (hereafter referred to as GUN4) was identified from a screen for plastid-to-nucleus signaling mutants (3Susek R.E. Ausubel F.M. Chory J. Cell. 1993; 74: 787-799Abstract Full Text PDF PubMed Scopus (467) Google Scholar, 4Mochizuki N. Brusslan J.A. Larkin R. Nagatani A. Chory J. Proc. Natl. Acad. Sci. U.S.A. 2001; 98: 2053-2058Crossref PubMed Scopus (515) Google Scholar, 5Larkin R.M. Alonso J.M. Ecker J.R. Chory J. Science. 2003; 299: 902-906Crossref PubMed Scopus (392) Google Scholar). GUN4 is a major positive regulator of chlorophyll biosynthesis but is not absolutely required for the accumulation of chlorophyll in Arabidopsis (5Larkin R.M. Alonso J.M. Ecker J.R. Chory J. Science. 2003; 299: 902-906Crossref PubMed Scopus (392) Google Scholar). In Synechocystis, one of the GUN4 relatives, sll0558 (hereafter referred to as SynGUN4), was subsequently shown also to be required for the accumulation of chlorophyll (6Wilde A. Mikolajczyk S. Alawady A. Lokstein H. Grimm B. FEBS Lett. 2004; 571: 119-123Crossref PubMed Scopus (49) Google Scholar, 7Sobotka R. Dühring U. Komenda J. Peter E. Gardian Z. Tichy M. Grimm B. Wilde A. J. Biol. Chem. 2008; 283: 25794-25802Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). The 140-kDa subunit of Mg-chelatase copurifies with the 22-kDa GUN4 from solubilized Arabidopsis thylakoid membranes (5Larkin R.M. Alonso J.M. Ecker J.R. Chory J. Science. 2003; 299: 902-906Crossref PubMed Scopus (392) Google Scholar); similar results were subsequently reported using Synechocystis (7Sobotka R. Dühring U. Komenda J. Peter E. Gardian Z. Tichy M. Grimm B. Wilde A. J. Biol. Chem. 2008; 283: 25794-25802Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). Mg-chelatase catalyzes the insertion of Mg2+ into PPIX, yielding Mg-protoporphyrin IX (Mg-PPIX). This reaction diverts PPIX from heme biosynthesis and commits this porphyrin to chlorophyll biosynthesis. Mg-chelatase requires three subunits in vitro and in vivo. These three subunits are conserved from prokaryotes to plants and are commonly referred to as BchH or ChlH, BchD or ChlD, and BchI or ChlI. In Arabidopsis, these subunits are 140, 79, and 40 kDa, respectively. ChlH is the porphyrin-binding subunit and is likely the Mg2+-binding subunit of Mg-chelatase. ChlI and ChlD are related to AAA-type ATPases and form two associating hexameric rings that interact with ChlH and drive the ATP-dependent metalation of PPIX (8Masuda T. Photosynth. Res. 2008; 96: 121-143Crossref PubMed Scopus (128) Google Scholar, 9Elmlund H. Lundqvist J. Al-Karadaghi S. Hansson M. Hebert H. Lindahl M. J. Mol. Biol. 2008; 375: 934-947Crossref PubMed Scopus (35) Google Scholar). SynGUN4 stimulates Synechocystis Mg-chelatase (5Larkin R.M. Alonso J.M. Ecker J.R. Chory J. Science. 2003; 299: 902-906Crossref PubMed Scopus (392) Google Scholar, 10Verdecia M.A. Larkin R.M. Ferrer J.L. Riek R. Chory J. Noel J.P. PLoS Biol. 2005; 3: e151Crossref PubMed Scopus (68) Google Scholar, 11Davison P.A. Schubert H.L. Reid J.D. Iorg C.D. Heroux A. Hill C.P. Hunter C.N. Biochemistry. 2005; 44: 7603-7612Crossref PubMed Scopus (101) Google Scholar). Cyanobacterial relatives of GUN4 bind deuteroporphyrin IX (DPIX) and Mg-deuteroporphyrin IX (Mg-DPIX) (5Larkin R.M. Alonso J.M. Ecker J.R. Chory J. Science. 2003; 299: 902-906Crossref PubMed Scopus (392) Google Scholar, 10Verdecia M.A. Larkin R.M. Ferrer J.L. Riek R. Chory J. Noel J.P. PLoS Biol. 2005; 3: e151Crossref PubMed Scopus (68) Google Scholar, 11Davison P.A. Schubert H.L. Reid J.D. Iorg C.D. Heroux A. Hill C.P. Hunter C.N. Biochemistry. 2005; 44: 7603-7612Crossref PubMed Scopus (101) Google Scholar), which are more water-soluble derivatives of PPIX and Mg-PPIX. Crystal structures of SynGUN4 and Thermosynechococcus elongatus GUN4 indicate a novel fold that resembles a “cupped hand” that binds DPIX and Mg-DPIX (10Verdecia M.A. Larkin R.M. Ferrer J.L. Riek R. Chory J. Noel J.P. PLoS Biol. 2005; 3: e151Crossref PubMed Scopus (68) Google Scholar, 11Davison P.A. Schubert H.L. Reid J.D. Iorg C.D. Heroux A. Hill C.P. Hunter C.N. Biochemistry. 2005; 44: 7603-7612Crossref PubMed Scopus (101) Google Scholar). Preincubation experiments indicate that a SynGUN4-DPIX complex stimulates Mg-chelatase more potently than SynGUN4 (5Larkin R.M. Alonso J.M. Ecker J.R. Chory J. Science. 2003; 299: 902-906Crossref PubMed Scopus (392) Google Scholar). SynGUN4 was found to lower the KmDPIX of Synechocystis Mg-chelatase (10Verdecia M.A. Larkin R.M. Ferrer J.L. Riek R. Chory J. Noel J.P. PLoS Biol. 2005; 3: e151Crossref PubMed Scopus (68) Google Scholar) and to cause a striking increase in the apparent first-order rate constant for DPIX-Mg-chelatase interactions, an effect that is particularly striking at low Mg2+ concentrations (11Davison P.A. Schubert H.L. Reid J.D. Iorg C.D. Heroux A. Hill C.P. Hunter C.N. Biochemistry. 2005; 44: 7603-7612Crossref PubMed Scopus (101) Google Scholar). The Mg-DPIX binding activity of SynGUN4 was also found to be essential for stimulating Mg-chelatase (10Verdecia M.A. Larkin R.M. Ferrer J.L. Riek R. Chory J. Noel J.P. PLoS Biol. 2005; 3: e151Crossref PubMed Scopus (68) Google Scholar). GUN4 and Mg-chelatase subunits have been found in both soluble and membrane-containing fractions of purified chloroplasts (5Larkin R.M. Alonso J.M. Ecker J.R. Chory J. Science. 2003; 299: 902-906Crossref PubMed Scopus (392) Google Scholar, 12Nakayama M. Masuda T. Bando T. Yamagata H. Ohta H. Takamiya K. Plant Cell Physiol. 1998; 39: 275-284Crossref PubMed Scopus (67) Google Scholar, 13Gibson L.C. Marrison J.L. Leech R.M. Jensen P.E. Bassham D.C. Gibson M. Hunter C.N. Plant Physiol. 1996; 111: 61-71Crossref PubMed Scopus (91) Google Scholar, 14Guo R. Luo M. Weinstein J.D. Plant Physiol. 1998; 116: 605-615Crossref Scopus (53) Google Scholar, 15Luo M. Weinstein J.D. Walker C.J. Plant Mol. Biol. 1999; 41: 721-731Crossref PubMed Scopus (17) Google Scholar). In contrast, protoporphyrinogen IX oxidase (PO) and Mg-PPIX methyltransferase (Mg-PPIX MT), which function immediately upstream and downstream of Mg-chelatase in the chlorophyll biosynthetic pathway, are found only in the membrane-containing fractions and not in stromal fractions when purified chloroplasts are lysed and fractionated (16van Lis R. Atteia A. Nogaj L.A. Beale S.I. Plant Physiol. 2005; 139: 1946-1958Crossref PubMed Scopus (47) Google Scholar, 17Lermontova I. Kruse E. Mock H.P. Grimm B. Proc. Natl. Acad. Sci. U.S.A. 1997; 94: 8895-8900Crossref PubMed Scopus (147) Google Scholar, 18Che F.S. Watanabe N. Iwano M. Inokuchi H. Takayama S. Yoshida S. Isogai A. Plant Physiol. 2000; 124: 59-70Crossref PubMed Scopus (30) Google Scholar, 19Watanabe N. Che F.S. Iwano M. Takayama S. Yoshida S. Isogai A. J. Biol. Chem. 2001; 276: 20474-20481Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar, 20Block M.A. Tewari A.K. Albrieux C. Maréchal E. Joyard J. Eur. J. Biochem. 2002; 269: 240-248Crossref PubMed Scopus (69) Google Scholar). PPIX and Mg-PPIX accumulate in chloroplast membranes rather than soluble fractions, which provides more evidence that these chlorophyll precursors are synthesized on chloroplast membranes (21Mohapatra A. Tripathy B.C. Photosynth. Res. 2007; 94: 401-410Crossref PubMed Scopus (13) Google Scholar). If GUN4 promotes chlorophyll biosynthesis by not only stimulating Mg-chelatase activity but also promoting the formation of enzyme complexes that channel porphyrins into chlorophyll biosynthesis, GUN4 would be expected to more stably associate with chloroplast membranes by interacting with chloroplast membrane lipids or chlorophyll biosynthetic enzymes after binding porphyrins. In the following, we provide experimental evidence supporting this model. For in vitro transcription/translation experiments, the entire GUN4 open reading frame (ORF) was amplified from bacterial artificial chromosome clone T1G3 (Arabidopsis Biological Resource Center, Ohio State University, Columbus) using CGGGATCCTATCTTCCCCTGACGTGAC, AACTGCAGAAAGACATCAGAAGCTGTAATTTG, and PfuTurbo® DNA polymerase (Stratagene, La Jolla CA). The resulting PCR product was ligated into pCMX-PL1 (22Umesono K. Murakami K.K. Thompson C.C. Evans R.M. Cell. 1991; 65: 1255-1266Abstract Full Text PDF PubMed Scopus (1497) Google Scholar) between BamHI and PstI. In vitro transcription and translation of the control protein translocon at the inner envelope 40 (Tic40), the small subunit of ribulose-bisphosphate carboxylase/oxygenase (SS), and a light-harvesting chlorophyll a/b-binding protein (LHCP) were as described previously (23Tripp J. Inoue K. Keegstra K. Froehlich J.E. Plant J. 2007; 52: 824-838Crossref PubMed Scopus (56) Google Scholar, 24Olsen L.J. Keegstra K. J. Biol. Chem. 1992; 267: 433-439Abstract Full Text PDF PubMed Google Scholar). A glutathione S-transferase (GST)-tagged GUN4 deletion mutant that lacks the predicted 69-residue transit peptide (GST-GUN4 Δ1–69) was used for the expression and purification of GUN4 from Escherichia coli, as described previously (5Larkin R.M. Alonso J.M. Ecker J.R. Chory J. Science. 2003; 299: 902-906Crossref PubMed Scopus (392) Google Scholar). Site-directed mutagenesis was performed on each of these plasmids using the QuickChange® XL site-directed mutagenesis kit (Stratagene) and oligonucleotides that were designed according to the manufacturer's recommendations (supplemental Table 1). All mutations were confirmed by sequencing at the Research Technology Support Facility (Michigan State University, East Lansing, MI). Intact chloroplasts were isolated from 6- to 8-day-old pea seedlings and purified over a Percoll gradient as described previously (25Bruce B.D. Perry S. Froehlich J. Keegstra K. Gelvin S.B. Schilperoort R.B. Plant Molecular Biology Manual. Kluwer Academic Publishers, Norwell, MA1994: J1:1-15Google Scholar). Intact pea chloroplasts were reisolated and resuspended in import buffer (330 mm sorbitol, 50 mm HEPES-KOH, pH 8.0) at a chlorophyll concentration of 1 mg/ml. Protein import was performed as described previously (25Bruce B.D. Perry S. Froehlich J. Keegstra K. Gelvin S.B. Schilperoort R.B. Plant Molecular Biology Manual. Kluwer Academic Publishers, Norwell, MA1994: J1:1-15Google Scholar). All precursor proteins used in this study were either radiolabeled with [35S]methionine or [3H]leucine and translated with the TnT® Coupled Reticulocyte Lysate System (Promega, Madison WI) according to the manufacturer's recommendations. Large scale import assays contained 50 mm HEPES-KOH, pH 8.0, 330 mm sorbitol, 4 mm Mg-ATP, 100 μl of chloroplasts with a chlorophyll concentration of 1 mg/ml, and labeled precursor protein at a final volume of 300 μl. After a 30-min incubation at room temperature under white light provided by broad spectrum fluorescent tube lamps at 75 μmol m−2 s−1, the import assay was divided into two 150-μl aliquots. One aliquot was not further treated. For this aliquot, intact chloroplasts were directly recovered by centrifugation through a 40% Percoll cushion. The remaining aliquot was incubated with trypsin for 30 min on ice as described previously (26Jackson D.T. Froehlich J.E. Keegstra K. J. Biol. Chem. 1998; 273: 16583-16588Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). After stopping the protease treatment with trypsin inhibitor as described previously (26Jackson D.T. Froehlich J.E. Keegstra K. J. Biol. Chem. 1998; 273: 16583-16588Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar), we again recovered chloroplasts by centrifugation through a 40% Percoll cushion. Recovered intact chloroplasts were resuspended in 200 μl of lysis buffer (25 mm HEPES-KOH, pH 8.0, 4 mm MgCl2), incubated on ice for 20 min, and then fractionated into a soluble and membrane-containing pellet fraction by centrifugation at 16,000 × g for 5 min. The pellet fraction contains the outer envelope, inner envelope, and thylakoid membranes. All fractions were analyzed using SDS-PAGE and subjected to fluorography. Fluorograms were exposed to x-ray film (Eastman Kodak Co.) for 1–7 days. Import assays were quantitated by scanning developed films with the VersaDoc 4000 MP Imaging System and Quantity One software, as recommended by the manufacturer (Bio-Rad). Prior to import, intact chloroplasts were incubated in import buffer (330 mm sorbitol, 50 mm HEPES-KOH, pH 8.0) that contained or lacked 10 mm ALA (Sigma) for 15 min at 26 °C in the dark, unless indicated otherwise. PPIX, Mg-PPIX, uroporphyrin III, coproporphyrin III, hemin, and pheophorbide a were all purchased from Frontier Scientific (Logan, UT). These porphyrins were first dissolved in DMSO, and their concentrations were determined spectrophotometrically as described previously (27Eichwurzel I. Stiel H. Röder B. J. Photochem. Photobiol. B. 2000; 54: 194-200Crossref PubMed Scopus (70) Google Scholar, 28Rebeiz C.A. Smith A.G. Witty M. Heme, Chlorophyll, and Bilins. Humana Press Inc., Totowa, NJ2002: 111-155Google Scholar, 29Rimington C. Biochem. J. 1960; 75: 620-623Crossref PubMed Google Scholar, 30Brown S.B. Lantzke I.R. Biochem. J. 1969; 115: 279-285Crossref PubMed Scopus (76) Google Scholar). These stock solutions were diluted with import buffer, giving final porphyrin concentrations of 20 μm and final DMSO concentrations of 1–2%. Intact chloroplasts were incubated in these solutions exactly as described for ALA. Fractionation of chloroplasts was performed as described previously (31Keegstra K. Yousif A.E. Methods Enzymol. 1986; 118: 316-325Crossref Scopus (140) Google Scholar), with modifications. First, large scale import assays were performed with (+) or without (−) an ALA pretreatment as described above. After import, intact chloroplasts were recovered by centrifugation through a 40% Percoll cushion. The intact chloroplasts were then resuspended in 0.6 m sucrose containing 25 mm HEPES-KOH, pH 8.0, 2 mm MgCl2, 8 mm EDTA. The suspension was placed on ice for 20 min and then placed at −20 °C overnight. Subsequently, the suspension was thawed at room temperature, gently mixed, and then diluted with 2 volumes of dilution buffer (25 mm HEPES-KOH, pH 8.0, 2 mm MgCl2, 8 mm EDTA). This suspension was then centrifuged at 1,500 × g for 5 min. The resulting pellet predominantly contained the thylakoid fraction and was diluted 2-fold with 2× SDS-PAGE loading buffer (32Sambrook J. Russell D.W. Molecular Cloning: A Laboratory Manual. 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2001Google Scholar). The remaining supernatant was then centrifuged at 100,000 × g for 1 h. The resulting pellet fraction predominantly contained envelopes and was diluted 2-fold in 2× SDS-PAGE loading buffer. Cold acetone was added to the supernatant fraction to a final concentration of 80%, incubated on ice for 30 min, and then centrifuged at 15,000 × g for 5 min. The precipitated soluble protein fraction was resuspended in 2× SDS-PAGE loading buffer. All fractions were analyzed by SDS-PAGE. PPIX and Mg-PPIX levels in purified chloroplasts were quantitated following ALA feeding and mock protein import. 0.1-ml aliquots of chloroplasts were collected by centrifugation at 1,900 × g for 5 min at 4 °C through a 40% Percoll cushion. Recovered chloroplasts were lysed by resuspension in 700 μl of acetone, 0.1 m NH4OH (9:1, v/v). These lysates were clarified by centrifugation at 16,000 × g for 10 min at 4 °C. Chlorophyll was removed from the resulting supernatants by hexane extraction as described previously (28Rebeiz C.A. Smith A.G. Witty M. Heme, Chlorophyll, and Bilins. Humana Press Inc., Totowa, NJ2002: 111-155Google Scholar). We quantitated the amount of PPIX and Mg-PPIX in these hexane-extracted supernatants using fluorescence spectroscopy with a QuantaMasterTM spectrofluorometer (Photon Technology International, Inc., London Ontario) as described previously (28Rebeiz C.A. Smith A.G. Witty M. Heme, Chlorophyll, and Bilins. Humana Press Inc., Totowa, NJ2002: 111-155Google Scholar). PPIX and Mg-PPIX, purchased from Frontier Scientific, were used to construct standard curves. GUN4 Δ1–69 and versions of GUN4 Δ1–69 that contain amino acid substitutions were expressed and purified from E. coli as described previously (5Larkin R.M. Alonso J.M. Ecker J.R. Chory J. Science. 2003; 299: 902-906Crossref PubMed Scopus (392) Google Scholar). Binding constants were measured by quantitating the quenching of tryptophan fluorescence in GUN4 Δ1–69 by bound porphyrins essentially as described for the cyanobacterial relatives of GUN4 (5Larkin R.M. Alonso J.M. Ecker J.R. Chory J. Science. 2003; 299: 902-906Crossref PubMed Scopus (392) Google Scholar, 10Verdecia M.A. Larkin R.M. Ferrer J.L. Riek R. Chory J. Noel J.P. PLoS Biol. 2005; 3: e151Crossref PubMed Scopus (68) Google Scholar, 11Davison P.A. Schubert H.L. Reid J.D. Iorg C.D. Heroux A. Hill C.P. Hunter C.N. Biochemistry. 2005; 44: 7603-7612Crossref PubMed Scopus (101) Google Scholar). Binding reactions were in 20 mm MOPS-KOH, pH 7.9, 1 mm DTT, 300 mm glycerol and contained 200 nm GUN4 Δ1–69 or GUN4 Δ1–69 with the indicated single amino acid changes and variable concentrations of DPIX and Mg-DPIX (Frontier Scientific). We determined binding constants for PPIX, Mg-PPIX, and Mg-PPIX ME, uroporphyrin III, coproporphyrin III, hemin, and pheophorbide a using the same conditions except that binding reactions also contained 1% DMSO. Stock solutions of DPIX and Mg-DPIX were prepared as described previously (33Karger G.A. Reid J.D. Hunter C.N. Biochemistry. 2001; 40: 9291-9299Crossref PubMed Scopus (75) Google Scholar). Stock solutions of all other porphyrins were prepared as described under “ALA and Porphyrin Feeding.” We calculated binding constants using DYNAFIT (34Kuzmic P. Anal. Biochem. 1996; 237: 260-273Crossref PubMed Scopus (1357) Google Scholar) as described previously (33Karger G.A. Reid J.D. Hunter C.N. Biochemistry. 2001; 40: 9291-9299Crossref PubMed Scopus (75) Google Scholar). The data fit best with a model that predicts a single binding site. Chloroplasts were purified from pea and subjected to hypotonic lysis as described above, except that lysis buffer also contained 1 mm DTT and 2 mm Pefabloc (Sigma). Supernatants were flash-frozen in liquid nitrogen and stored at −80 °C. We assayed pellet fractions for Mg-chelatase activity immediately by resuspending them in a Mg-chelatase assay buffer (50 mm Tricine-KOH, pH 7.8, 1 mm EDTA, 9 mm MgCl2, 4 mm MgATP, 1 mm DTT, 0.25% bovine serum albumin, 5% glycerol, 60 mm phosphocreatine, 4 units/ml creatine phosphokinase) and incubating the resuspended pellets for 30 min at 30 °C as recommended previously (14Guo R. Luo M. Weinstein J.D. Plant Physiol. 1998; 116: 605-615Crossref Scopus (53) Google Scholar, 35Walker C.J. Weinstein J.D. Proc. Natl. Acad. Sci. U.S.A. 1991; 88: 5789-5793Crossref PubMed Scopus (77) Google Scholar). PPIX dissolved in DMSO was added to particular reactions as indicated in the text. The final concentrations of PPIX and DMSO were 1.5 μm and 2%, respectively, as recommended previously (36Walker C.J. Weinstein J.D. Plant Physiol. 1991; 95: 1189-1196Crossref PubMed Scopus (68) Google Scholar). Aliquots of 8 μl were removed at 5-min intervals during a 30-min incubation, diluted into 200 μl of acetone, 0.1 m NH4OH (9:1, v/v), and vortexed to terminate the reaction. The terminated reactions were centrifuged for 10 min at 16,000 × g at 4 °C. Mg-PPIX in the resulting supernatants was quantitated as described under “Quantitative Analysis of Porphyrin Binding.” We subtracted the amount of Mg-PPIX in the membranes before the reactions were initiated from the amount of Mg-PPIX at the end of each time point. Three replicates were analyzed for each time point. Mg-PPIX accumulated linearly for the entire 30-min assay. To assay supernatants for Mg-chelatase activity, supernatants were rapidly thawed, clarified at 16,000 × g at 4 °C for 10 min, and then concentrated nearly 5-fold using an Amicon ultracentrifugal filter device with a nominal molecular weight limit of 10,000 (Millipore, Billerica, MA). The concentrated supernatants were diluted into a concentrated Mg-chelatase assay buffer yielding the same assay conditions described for pellets. Reactions were initiated by adding 1.5 μm PPIX. Poly(A)+ mRNA was isolated from Arabidopsis thaliana (Columbia-0 ecotype) using the Absolutely mRNA kit (Stratagene). We prepared first-strand cDNA using Superscript II (Invitrogen). A cDNA encoding a 62-kDa fragment of ChlH that lacks the first 823 amino acid residues (ChlH Δ1–823) was amplified from this first-strand cDNA as described for GUN4 Δ1–69, except that CCGGAATTCGCTGTGGCCACACTGGTCAAC and TCGCGTCGACTTATCGATCGATCCCTTCGATCTTGTC were used. To express ChlH Δ1–823 as a His-tagged protein in E. coli, this PCR product was ligated into pHIS8-3 (37Jez J.M. Ferrer J.L. Bowman M.E. Dixon R.A. Noel J.P. Biochemistry. 2000; 39: 890-902Crossref PubMed Scopus (284) Google Scholar) between EcoRI and SalI. The resulting plasmid was sequenced at the Research Technology Support Facility (Michigan State University) to confirm that no mutations were introduced during PCR. The His-tagged ChlH Δ1–823 protein was expressed from the resulting plasmid in the E. coli strain BL21-CodonPlus® (DE3)-RIL (Stratagene) at 18 °C in Terrific Broth (32Sambrook J. Russell D.W. Molecular Cloning: A Laboratory Manual. 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2001Google Scholar). We induced expression by adding 1 mm isopropyl β-d-1-thiogalactopyranoside (Sigma) when the A600 was 0.8. All subsequent steps were performed at 4 °C, unless indicated otherwise. Cells were harvested by centrifugation at 6,000 × g for 10 min and resuspended in 20 ml of buffer A (50 mm Tris acetate, pH 7.9, 500 mm potassium acetate, 20 mm imidazole, 20 mm β-mercaptoethanol, 20% glycerol, 1% Triton X-100) per g of bacterial pellet. Cells were lysed by sonication. The resulting lysate was clarified by centrifugation at 10,000 × g for 20 min. The supernatant was batch-bound to Ni-NTA-agarose (Qiagen, Valencia, CA) equilibrated in buffer A. Bound proteins were batch-washed twice with buffer A and twice with buffer A lacking Triton X-100. Ni-NTA-agarose was poured into an Econo-Pac column (Bio-Rad), and proteins were step-eluted using buffer B (20 mm Tris acetate, pH 7.9, 500 mm potassium acetate, 250 mm imidazole, 20 mm β-mercaptoethanol, 20% glycerol). Eluted proteins were dialyzed against buffer C (20 mm Tris acetate, pH 7.9, 150 mm potassium acetate, 2.5 mm CaCl2, 20 mm β-mercaptoethanol, 20% glycerol), digested with thrombin (Sigma) at room temperature, and applied to the aforementioned Ni-NTA-agarose column equilibrated in buffer A. Proteins in the flow-through fraction were dialyzed against buffer D (20 mm Tris acetate, pH 7.9, 100 mm potassium acetate, 1 mm EDTA, 1 mm DTT, 20% glycerol), applied to a HiPrepTM 16/10 Q FF column (GE Healthcare) that was equilibrated in buffer D at a flow rate of 1.0 ml/min, and eluted with a 200-ml linear gradient to buffer E (20 mm Tris acetate, pH 7.9, 1000 mm potassium acetate, 1 mm EDTA, 1 mm DTT, 20% glycerol) also at a flow rate of 1.0 ml/min. Fractions of 2.5 ml containing ChlH Δ1–823 were pooled, concentrated using an Amicon Ultra-15 centrifugal filter unit with a nominal molecular weight limit of 30,000 (Millipore), dialyzed against storage buffer (50 mm Tricine-KOH, pH 7.9, 1 mm DTT, 50% glycerol), flash-frozen with liquid N2, and stored in small aliquots at −80 °C. For polyclonal antibody development, purified ChlH Δ1–823 was dialyzed extensively against phosphate-buffered saline, pH 7.4 (32Sambrook J. Russell D.W. Molecular Cloning: A Laboratory Manual. 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2001Google Scholar), and used to develop anti-ChlH Δ1–823 polyclonal antisera in New Zealand White rabbits at Strategic Diagnostics, Inc. (Newark DE). IgGs were purified from these antisera using Affi-Gel protein A (Bio-Rad) as recommended by Harlow and Lane (38Harlow E. Lane D. Using Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1999: 70-80Google Scholar). Anti-ChlH Δ1–823 antibodies were affinity-purified from total IgGs on ChlH Δ1–823 columns that were constructed by linking purified ChlH Δ1–823 to Affi-Gel 15 (Bio-Rad) at ∼15 mg/ml. Antibodies were eluted from the ChlH Δ1–823 columns in buffer F (100 mm glycine-HCl, pH 2.5, 50% ethylene glycol) and immediately mixed with 1:10 volume of 1 m Tris-HCl, pH 8.0, as recommended by Harlow and Lane (38Harlow E. Lane D. Using Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1999: 70-8

Referência(s)