Functional Properties of a Monoclonal Antibody Inhibiting the Hepatitis C Virus RNA-dependent RNA Polymerase
2002; Elsevier BV; Volume: 277; Issue: 1 Linguagem: Inglês
10.1074/jbc.m108748200
ISSN1083-351X
AutoresDarius Moradpour, Elke Bieck, Thomas Hügle, Winfried S. Wels, Jim Zhen Wu, Zhi Hong, Hubert E. Blum, Ralf Bartenschlager,
Tópico(s)Animal Disease Management and Epidemiology
ResumoThe hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp), represented by nonstructural protein 5B (NS5B), has recently emerged as a promising target for antiviral intervention. Here, we describe the isolation, functional characterization, and molecular cloning of a monoclonal antibody (mAb) inhibiting the HCV RdRp. This mAb, designated 5B-12B7, binds with high affinity to a conformational epitope in the palm subdomain of the HCV RdRp and recognizes native NS5B expressed in the context of the entire HCV polyprotein or subgenomic replicons. Complete inhibition of RdRp activity in vitro was observed at equimolar concentrations of NS5B and mAb 5B-12B7, whereas RdRp activities of classical swine fever virus NS5B and poliovirus 3D polymerase were not affected. mAb 5B-12B7 selectively inhibited NTP binding to HCV NS5B, whereas binding of template RNA was unaffected, thus explaining the mechanism of action at the molecular level. The mAb 5B-12B7 heavy and light chain variable domains were cloned by reverse transcription-PCR, and a single chain Fv fragment was assembled for expression in Escherichia coli and in eukaryotic cells. The mAb 5B-12B7 single chain Fv fragment bound to NS5B both in vitro and in transfected human cell lines and therefore may be potentially useful for intracellular immunization against HCV. More important, detailed knowledge of the mAb 5B-12B7 contact sites on the enzyme may facilitate the development of small molecule RdRp inhibitors as novel antiviral agents. The hepatitis C virus (HCV) RNA-dependent RNA polymerase (RdRp), represented by nonstructural protein 5B (NS5B), has recently emerged as a promising target for antiviral intervention. Here, we describe the isolation, functional characterization, and molecular cloning of a monoclonal antibody (mAb) inhibiting the HCV RdRp. This mAb, designated 5B-12B7, binds with high affinity to a conformational epitope in the palm subdomain of the HCV RdRp and recognizes native NS5B expressed in the context of the entire HCV polyprotein or subgenomic replicons. Complete inhibition of RdRp activity in vitro was observed at equimolar concentrations of NS5B and mAb 5B-12B7, whereas RdRp activities of classical swine fever virus NS5B and poliovirus 3D polymerase were not affected. mAb 5B-12B7 selectively inhibited NTP binding to HCV NS5B, whereas binding of template RNA was unaffected, thus explaining the mechanism of action at the molecular level. The mAb 5B-12B7 heavy and light chain variable domains were cloned by reverse transcription-PCR, and a single chain Fv fragment was assembled for expression in Escherichia coli and in eukaryotic cells. The mAb 5B-12B7 single chain Fv fragment bound to NS5B both in vitro and in transfected human cell lines and therefore may be potentially useful for intracellular immunization against HCV. More important, detailed knowledge of the mAb 5B-12B7 contact sites on the enzyme may facilitate the development of small molecule RdRp inhibitors as novel antiviral agents. hepatitis C virus amino acid(s) RNA-dependent RNA polymerase nonstructural protein 5B monoclonal antibody classical swine fever virus enzyme-linked immunosorbent assay single chain variable domain fragment heavy chain variable domain light (κ) chain variable domain The hepatitis C virus (HCV)1 is a major cause of chronic hepatitis, liver cirrhosis, and hepatocellular carcinoma worldwide (1World Health Organization J. Viral Hepat. 1999; 6: 35-47Crossref PubMed Scopus (757) Google Scholar). A protective vaccine does not exist to date, and therapeutic options are limited (2Lauer G.M. Walker B.D. N. Engl. J. Med. 2001; 345: 41-52Crossref PubMed Scopus (2510) Google Scholar, 3Moradpour D. Cerny A. Heim M.H. Blum H.E. Swiss Med. Wkly. 2001; 131: 291-298PubMed Google Scholar). HCV contains a single-strand RNA genome of positive polarity and ∼9600 nucleotides in length that encodes a polyprotein precursor of ∼3000 amino acids (aa) (see Refs.4Bartenschlager R. Lohmann V. J. Gen. Virol. 2000; 81: 1631-1648Crossref PubMed Scopus (585) Google Scholar and 5Reed K.E. Rice C.M. Curr. Top. Microbiol. Immunol. 2000; 242: 55-84Crossref PubMed Scopus (478) Google Scholar for recent reviews). The polyprotein precursor is co- and post-translationally processed by cellular and viral proteases to yield the mature structural and nonstructural proteins. HCV RNA replication proceeds via synthesis of a complementary (−)-strand RNA using the genome as a template and the subsequent synthesis of genomic RNA from this (−)-strand template. The key enzyme responsible for both of these steps is the virally encoded RNA-dependent RNA polymerase (RdRp), represented by nonstructural protein 5B (NS5B). The HCV RdRp has been shown to be essential for viral replicationin vitro (6Lohmann V. Körner F. Koch J.-O. Herian U. Theilmann L. Bartenschlager R. Science. 1999; 285: 110-113Crossref PubMed Scopus (2505) Google Scholar) and in vivo (7Kolykhalov A.A. Agapov E.V. Blight K.J. Mihalik K. Feinstone S.M. Rice C.M. Science. 1997; 277: 570-574Crossref PubMed Scopus (627) Google Scholar, 8Kolykhalov A.A. Mihalik K. Feinstone S.M. Rice C.M. J. Virol. 2000; 74: 2046-2051Crossref PubMed Scopus (565) Google Scholar), and it has been extensively characterized both at the biochemical (9Behrens S.-E. Tomei L. De Francesco R. EMBO J. 1996; 15: 12-22Crossref PubMed Scopus (648) Google Scholar, 10Lohmann V. Körner F. Herian U. Bartenschlager R. J. Virol. 1997; 71: 8416-8428Crossref PubMed Google Scholar, 11Yamashita T. Kaneko S. Shirota Y. Qin W. Nomura T. Kobayashi K. Murakami S. J. Biol. Chem. 1998; 273: 15479-15486Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar, 12Ferrari E. Wright-Minogue J. Fang J.W. Baroudy B.M. Lau J.Y. Hong Z. J. Virol. 1999; 73: 1649-1654Crossref PubMed Google Scholar) and structural (13Ago H. Adachi T. Yoshida A. Yamamoto M. Habuka N. Yatsunami K. Miyano M. Structure Fold. Des. 1999; 7: 1417-1426Abstract Full Text Full Text PDF Scopus (392) Google Scholar, 14Bressanelli S. Tomei L. Roussel A. Incitti I. Vitale R.L. De Mathieu M. Francesco R. Rey F.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 13034-13039Crossref PubMed Scopus (547) Google Scholar, 15Lesburg C.A. Cable M.B. Ferrari E. Hong Z. Mannarino A.F. Weber P.C. Nat. Struct. Biol. 1999; 6: 937-943Crossref PubMed Scopus (703) Google Scholar, 16Lesburg C.A. Radfar R. Weber P.C. Curr. Opin. Invest. Drugs. 2000; 1: 289-296PubMed Google Scholar) levels. HCV NS5B contains motifs shared by all RdRps and possesses the classical fingers, palm, and thumb subdomains. As a unique feature of the HCV RdRp, extensive interactions between the fingers and thumb subdomains result in a completely encircled active site. The HCV RdRp has emerged as a promising target for antiviral drug development. In this context, it has recently been validated as an antiviral target in the related pestiviruses (17Baginski S.G. Pevear D.C. Seipel M. Sun S.C.C. Benetatos C.A. Chunduru S.K. Rice C.M. Collett M.S. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 7981-7986Crossref PubMed Scopus (99) Google Scholar). In this study, we describe the isolation, functional characterization, and molecular cloning of a mAb that specifically and efficiently inhibits the HCV RdRp. The mechanism of enzyme inhibition was elucidated at the molecular level. Hence, this mAb may serve as a unique molecular probe for future mechanistic studies toward the elucidation of the HCV RdRp reaction pathway and may provide a new framework for the development of small molecule RdRp inhibitors as novel antiviral agents. Recombinant HCV and classical swine fever virus (CSFV; kindly provided by Jon-Duri Tratschin, Institute of Virology and Immunoprophylaxis, Mittelhäusern, Switzerland) NS5B were produced in a recombinant baculovirus system and purified by affinity chromatography as described (10Lohmann V. Körner F. Herian U. Bartenschlager R. J. Virol. 1997; 71: 8416-8428Crossref PubMed Google Scholar, 18Lohmann V. Overton H. Bartenschlager R. J. Biol. Chem. 1999; 274: 10807-10815Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar). Purified poliovirus 3D polymerase was a gift of Eckard Wimmer and Aniko Paul (State University of New York, Stony Brook, NY). Eight-week-old female BALB/c mice were immunized with recombinant HCV NS5B in its functionally active, native conformation. Spleen cells from immunized mice were fused with the X63-Ag8.653 myeloma cell line (American Type Culture Collection, Manassas, VA). Hybridomas were selected, and supernatants were screened by ELISA essentially as described (19Harlow E. Lane D. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1988Google Scholar). Hybridomas immunoreactive with recombinant and cellularly expressed NS5B protein were cloned twice by limiting dilution. mAb isotypes were determined with reagents from Amersham Biosciences, Inc. Ascites fluid was produced from hybridomas 5B-3B1.5.3 and 5B-12B7.54.1 (Eurogentec, Seraing, Belgium). mAbs were purified from ascites fluid by protein G affinity chromatography. Forin vitro RdRp inhibition assays, mAbs were dialyzed for 16 h at 4 °C against buffer containing 100 mm NaCl and 10 mm Tris-HCl (pH 7.2). Biotinylation was performed using the FluoReporter Biotin-XX labeling kit (Molecular Probes, Inc., Eugene, OR). Reactivity of biotinylated mAbs was revealed with horseradish peroxidase-conjugated streptavidin (Molecular Probes, Inc.). Plasmids pGEM-11-BX-NS5Bcon, pCMVNS5Bcon, and pCMVNS5BconΔC21, containing NS5B sequences derived from a functional HCV H strain consensus cDNA (7Kolykhalov A.A. Agapov E.V. Blight K.J. Mihalik K. Feinstone S.M. Rice C.M. Science. 1997; 277: 570-574Crossref PubMed Scopus (627) Google Scholar), were described previously (20Schmidt-Mende J. Bieck E. Hügle T. Penin F. Rice C.M. Blum H.E. Moradpour D. J. Biol. Chem. 2001; 276: 44052-44063Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar). Plasmids pCMVNS5Bcon392, pCMVNS5Bcon299, and pCMVNS5Bcon139, allowing expression of NS5B aa 1–392, 1–299, and 1–139, respectively (see Fig. 3A), were constructed by ligation of the BamHI-NruI,BamHI-SmaI, and BamHI-MscI fragments of pCMVNS5Bcon into the BamHI-EcoRV sites of pcDNA3.1 (Invitrogen, San Diego, CA). Plasmid pCMVNS5Bcon203, allowing expression of NS5B aa 1–203, was constructed by ligation of the EcoRI-EcoRI fragment of pGEM-BX-NS5Bcon into the EcoRI site of pcDNA3.1. To construct pCMVNS5Bcon299–392, a fragment representing aa 299–392 was amplified by PCR from pBRTM/HCV1-3011con (7Kolykhalov A.A. Agapov E.V. Blight K.J. Mihalik K. Feinstone S.M. Rice C.M. Science. 1997; 277: 570-574Crossref PubMed Scopus (627) Google Scholar) using primers NS5B299fwd and NS5B392rev (TableI), followed by ligation of the EcoRI-XbaI-digested amplification product into the EcoRI-XbaI sites of pcDNA3.1. Similarly, plasmids pCMVNS5Bcon11–591, pCMVNS5Bcon46–591, pCMVNS5Bcon139–591, pCMVNS5Bcon299–591, and pCMVNS5Bcon139–392 were constructed by PCR amplification of the respective NS5B fragments from pBRTM/HCV1-3011con using primers NS5B11fwd and NS5BrevTAA, NS5B46fwd and NS5BrevTAA, NS5B139fwd and NS5BrevTAA, NS5B299fwd and NS5Brev, and NS5B139fwd and NS5B392rev (Table I), respectively, followed by ligation of the appropriately digested amplification products into theBamHI-XbaI or EcoRI-XbaI sites of pcDNA3.1. Constructs generated in the pcDNA3.1 backbone allow both eukaryotic expression from a cytomegalovirus promoter and in vitro transcription from a T7 RNA polymerase promoter.Table IPCR primersPrimerRestriction siteSequenceNS5B11fwdBamHI5′-GCAGGATCCACCATGGTCACCCCGTGCGCTGCGGAAGAAC-3′NS5B46fwdBamHI5′-GCAGGATCCACCATGTGCCAAAGGCAGAAGAAAGTCAC-3′NS5B139fwdBamHI5′-GCAGGATCCACCATGGCCAAGAACGAGGTTTTCTGCG-3′NS5B299fwdEcoRI5′-GCACGAATTCACCATGGCCCGGGCAGCCTGTCGAGCCGCAGGGCT-3′NS5B392revXbaI5′-GCTGTCTAGATTAGAGGGGGGTTGTAGGGTCACGGGTAAGGTAGT-3′NS5BrevXbaI5′-GCTGTCTAGATCATCGGTTGGGGAGGAGGTAGATGCCTACC-3′NS5BrevTAAXbaI5′-GCTGTCTAGATTATCGGTTGGGGAGGAGGTAGATGCCTAC-3′VH-BACKHindIII/PstI5′-ATTATAAGCTTCAGGTSMARCTGCAGSAGTCWGG-3′VH-FORBstEII5′-TGAGGAGACGGTGACCGTGGTCCCTTGGCCCCAG-3′VK-BACKPvuII5′-GACATTCAGCTGACCCAGWCTSC-3′VK-FORBgIII/XbaI/XhoI5′-TTAGATCTCTAGAAKCTCGAGYTTKGTSo-3′12B7VH6fwdEcoRI5′-GAGAATTCACCATGGCCCAGGTGCAGCTGCAGGAGTCTGGGGCTGAGTTG-3′9E10fwdEcoRI5′-GAGAATTCACCATGGCCCAGGTACAACTGCAGGAGTCAGGGGGAGACTTAG-3′12B7VK2FLAGrevXbaI5′-GCTCTAGACCTTGTCATCGTCGTCCTTGTAGTCAAGCTCGAGTTTTGTGCCCCC TCCGAACGTGTACGGAAACTC-3′9E10FLAGrevXbaI5′-GCTCTAGACCTTGTCATCGTCGTCCTTGTAGTCAAGCTCGAGCTTGGTGCCTCC ACCGAACGTCCACGGAACCTCo-3′Restriction enzyme recognition sites are underlined. Start and stop codons are in boldface. M = A or C, R = A or G, W = A or T, Y = C or T, S = G or C and K = G or T. Open table in a new tab Restriction enzyme recognition sites are underlined. Start and stop codons are in boldface. M = A or C, R = A or G, W = A or T, Y = C or T, S = G or C and K = G or T. U-2 OS human osteosarcoma cells (ATCC HTB-96), the U-2 OS-derived tetracycline-regulated cell line UHCVcon-57.3 (which allows inducible expression of the entire open reading frame derived from a functional HCV H strain consensus cDNA) (20Schmidt-Mende J. Bieck E. Hügle T. Penin F. Rice C.M. Blum H.E. Moradpour D. J. Biol. Chem. 2001; 276: 44052-44063Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar), HuH-7 human hepatocellular carcinoma cells (21Nakabayashi H. Taketa K. Miyano K. Yamane T. Sato J. Cancer Res. 1982; 42: 3858-3863PubMed Google Scholar), and the HuH-7-derived cell line 9-13 (harboring a subgenomic HCV replicon) (6Lohmann V. Körner F. Koch J.-O. Herian U. Theilmann L. Bartenschlager R. Science. 1999; 285: 110-113Crossref PubMed Scopus (2505) Google Scholar) have been described. Indirect immunofluorescence microscopy and Western blotting were performed as previously described (22Moradpour D. Kary P. Rice C.M. Blum H.E. Hepatology. 1998; 28: 192-201Crossref PubMed Scopus (144) Google Scholar). The TNT T7 coupled reticulocyte lysate system (Promega, Madison, WI) was used essentially following the manufacturer's recommendations. Reactions were routinely performed for 90 min at 30 °C in the presence of 0.8 mCi/ml [35S]methionine (Amersham Biosciences, Inc., Buckinghamshire, United Kingdom). Cells were lysed in buffer containing 150 mm NaCl, 50 mm Tris-HCl (pH 8.0), 1% Nonidet P-40, and protease inhibitors (Complete® protease inhibitor mixture, Roche Molecular Biochemicals, Mannheim, Germany). Lysates were precleared for 4 h at 4 °C with protein G-Sepharose (Amersham Biosciences, Inc.), followed by immunoprecipitation with 2 μl of 5B-12B7 ascites fluid or 5 μg of anti-FLAG mAb M2 (Sigma)/500 μl for 16 h at 4 °C. Immunocomplexes were collected by the addition of protein G-Sepharose for 2 h at 4 °C. Finally, beads were washed with the lysis buffer, resuspended in 2× sample loading buffer, boiled for 5 min, and analyzed by SDS-PAGE. In some experiments, cells were homogenized in a Dounce homogenizer in hypotonic buffer containing 10 mmTris-HCl (pH 7.5) and 2 mm MgCl2, and immunoprecipitation was performed from post-nuclear supernatants as described above. The mAb 5B-3B1 epitope was mapped by random DNase I fragment expression library screening using the NovaTope system (Novagen, Madison, WI). Polymerase assays contained 500 ng of HCV-specific in vitro transcript corresponding to a functional replicon RNA (6Lohmann V. Körner F. Koch J.-O. Herian U. Theilmann L. Bartenschlager R. Science. 1999; 285: 110-113Crossref PubMed Scopus (2505) Google Scholar); 200 ng of HCV NS5B, 400 ng of CSFV NS5B, or 20 ng of poliovirus 3D polymerase; various concentrations of mAbs as specified under “Results”; 1 μCi of [α-32P]CTP adjusted to a 10 μm final concentration; a 500 μm concentration of each of the remaining NTPs; 10 units of RNasin (Promega); and assay buffer (5 mm dithiothreitol, 20 mm Tris-HCl (pH 7.5), 12.5 mmMgCl2, 10 mm KCl, and 1 mm EDTA) in a total volume of 25 μl. After a 5-min incubation of the enzyme with the mAb at 4 °C, the RdRp reaction was initiated by the addition of NTPs and RNA, followed by a 1-h incubation at 27 °C. The reaction was terminated by the addition of 1 ml of 10% trichloroacetic acid and 0.5% tetrasodium pyrophosphate and 100 μg of salmon sperm DNA. After a 30-min incubation at 4 °C, samples were filtered through glass microfiber GF/C filters (Whatman, Kent, United Kingdom). Filters were washed five times with 1% trichloroacetic acid and 0.1% tetrasodium pyrophosphate, and bound radioactivity was measured after the addition of Rotiszint 2200 (Roth, Karlsruhe, Germany) in a liquid scintillation counter (Beckman Instruments). Background values obtained with an inactive RdRp mutant were subtracted. HCV NS5B protein lacking the carboxyl-terminal 21 aa (NS5BΔC21) was expressed in Escherichia coli and purified to homogeneity as described previously (12Ferrari E. Wright-Minogue J. Fang J.W. Baroudy B.M. Lau J.Y. Hong Z. J. Virol. 1999; 73: 1649-1654Crossref PubMed Google Scholar). This recombinant protein has nine tryptophan residues and thus has strong protein fluorescence at 330 nm when it is excited at 283 nm. This property was utilized to determine the equilibrium dissociation constant (Kd) of NS5B for a nucleotide (GTP, CTP, ATP, or UTP) or an 8-mer RNA template (GR-1, 5′-AGAGAGCC-3′) by following the quenching of intrinsic protein fluorescence. Measurements were performed at 23 °C on a PTI fluorescence spectrophotometer (Photon Technology International, Lawrenceville, NJ). The excitation wavelength was set at 283 nm, and the emission wavelength was set at 330 nm. The binding buffer included 20 mm Tris-HCl (pH 7.5), 10 mm KCl, 50 mm NaCl, 20 mmMgCl2, and 5 mm dithiothreitol. The experiments involved successive titration of the protein (53 nm) with a ligand or substrate (0.2–200 μm). The measured fluorescence intensity (I) at a given ligand concentration ([L]) was fitted into Equation 1 to calculate the dissociation constant (Kd), I=Io−Itotal·[L]free/(Kd+[L]free)Equation 1 where Io is the fluorescence of free protein and Itotal is the fluorescence loss due to the full occupation of all the binding sites by a ligand or substrate. Nonlinear least-squares fit of the data was performed using Kaleidagraph (Synergy Software, Reading, PA). In the experiments, a control sample containing fluorescence intensity similar to that of tryptophan was titrated in the same way as the protein sample. The fluorescence loss due to the addition of free ligand was determined. The percentage of fluorescence loss was used to compensate for the measured protein fluorescence intensity in determining the realI value. To study the effect of mAb 5B-12B7 on the NS5B/substrate (RNA/NTP) interaction, the mAb (54 nm; the NS5B-binding site concentration is 108 nm) was mixed with NS5B (53 nm) before the addition of a substrate. TheKd of NS5B for the substrate in the presence of mAb 5B-12B7 was calculated as described above. Total cellular RNA was extracted from early passage 5B-12B7.54.1 hybridoma cells using RNAzol (Biotecx Laboratories, Houston, TX). First-strand cDNA synthesis with an oligo(dT) primer was performed using the first-strand cDNA synthesis kit (Amersham Biosciences, Inc.). The heavy chain variable domain (VH) was amplified by PCR using the degenerate primers VH-BACK and VH-FOR (Table I) with three initial cycles of 2 min of denaturation at 95 °C, 2 min of annealing at 42 °C, and 1 of min extension at 74 °C, followed by 28 cycles of 2 min of denaturation at 95 °C, 2 min of annealing at 56 °C, and 1 min of extension at 74 °C. The light (κ) chain variable domain (VK) was amplified under the same conditions using the primer pair VK-BACK and VK-FOR (Table I). The VH amplification product was digested with HindIII andBstEII and ligated into theHindIII-BstEII sites of pWW152 (23Wels W. Harwerth I.M. Zwickl M. Hardman N. Groner B. Hynes N.E. Bio/Technology. 1992; 10: 1128-1132Crossref PubMed Scopus (129) Google Scholar, 24Wels W. Beerli R. Hellmann P. Schmidt M. Marte B.M. Kornilova E.S. Hekele A. Mendelsohn J. Groner B. Hynes N.E. Int. J. Cancer. 1995; 60: 137-144Crossref PubMed Scopus (99) Google Scholar) to yield plasmid pWW12B7VH. The VK amplification product was digested withPvuII and XbaI and ligated into thePvuII-XbaI sites of pWW152 to yield plasmid pWW12B7VK. The pWW152 vector contains HindIII andBstEII sites for the subcloning of murine VH cDNA fragments, followed by a synthetic sequence encoding the 15-aa linker (GGGGS)3, and PvuII and XbaI sites for the subcloning of murine VK cDNA fragments. Eight clones each of the VH and VK domains were sequenced. Subsequently, theHindIII-BstEII fragment of pWW12B7VH-6 was ligated into the HindIII-BstEII sites of pWW12B7VK-2 to yield the scFv construct pWW12B7. For bacterial expression, the 5B-12B7 scFv sequence was isolated from pWW12B7 as a HindIII-XbaI fragment and fused in frame to the E. coli phoA alkaline phosphatase gene in plasmid pSW602, which is derived from the expression vector pFLAG-1 (IBI Biochemicals, New Haven, CT). The resulting pSW602-12B7 construct encodes a fusion protein consisting of the E. coliOmpA signal peptide, a FLAG tag, a hexahistidine tag, the 5B-12B7 scFv sequence, and E. coli PhoA under the control of an isopropyl-β-d-thiogalactopyranoside-inducibletac promoter (23Wels W. Harwerth I.M. Zwickl M. Hardman N. Groner B. Hynes N.E. Bio/Technology. 1992; 10: 1128-1132Crossref PubMed Scopus (129) Google Scholar). Plasmid pSW602-12B7 was transformed into the phoA-negative E. coli strain CC118 (25Manoil C. Beckwith J. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 8129-8133Crossref PubMed Scopus (659) Google Scholar). Bacteria were grown in LB medium to A600 = 0.7 at 37 °C before induction with 0.5 mmisopropyl-β-d-thiogalactopyranoside for 90 min. Subsequently, bacteria were harvested by centrifugation, and periplasmic extracts were prepared following the manufacturer's recommendations (IBI Biochemicals). For expression of scFv in mammalian cells, the cytomegalovirus promoter-driven expression construct pCMV12B7FLAG with a carboxyl-terminal FLAG tag was generated by PCR amplification of 5B-12B7 scFv from pWW12B7 using primers 12B7VH6fwd and 12B7VK2FLAGrev (Table I), followed by digestion of the amplification product with EcoRI and XbaI and ligation into theEcoRI-XbaI sites of pcDNA3.1. As a non-relevant control, the c-Myc-specific 9E10 scFv construct was amplified from pWW152-9E10 2W. Wels, unpublished data.using primers 9E10fwd and 9E10FLAGrev (Table I), followed by digestion of the amplification product with EcoRI and XbaI and ligation into the EcoRI-XbaI sites of pcDNA3.1 to yield plasmid pCMV9E10FLAG. In addition, the HCV nonstructural protein 4A-specific E6 scFv construct (a gift of Cinzia Traboni, Istituto di Ricerche di Biologia Molecolare P. Angeletti, Pomezia, Italy) was ligated into the XbaI site of pcDNA3.1/Zeo (Invitrogen) in the correct or reverse orientation, yielding constructs pCMVZeoSCFVE6FLAG and pCMVZeoSCFVE6FLAGrev, respectively. Recombinant HCV NS5B protein was used in its functionally active, native conformation as an antigen to raise murine mAbs. Screening of ∼500 hybridomas resulting from two separate fusions allowed the isolation and cloning of six NS5B-specific mAbs, designated 5B-2A5, 5B-2A7, 5B-3B1, 5B-3F3, 5B-4C1, and 5B-12B7. Characteristics of these mAbs are summarized in TableII. mAbs 5B-3B1 and 5B-12B7 were further investigated. mAb 5B-3B1 reacted strongly in ELISA and immunoblotting (Fig. 1B), suggesting that it recognizes a linear epitope. By contrast, mAb 5B-12B7 functioned well in immunofluorescence (Fig. 1A) and immunoprecipitation (Fig. 1B) assays, but not in immunoblot assays, indicating a conformation-sensitive nature of the recognized epitope.Table IICharacteristics of HCV NS5B mAbsmAbIsotypeEpitopeIIF2-aIIF, indirect immunofluorescence; WB, Western blot; ND, not done; lin, linear; conf, conformational.WB5B-2A5IgG1κND++5B-2A7IgG1κND+−5B-3B1IgG2bκaa 372–382 lin−++5B-3F3IgG1κND++5B-4C1IgG1κND−+5B-12B7IgG2aκaa 139–392 conf++−2-a IIF, indirect immunofluorescence; WB, Western blot; ND, not done; lin, linear; conf, conformational. Open table in a new tab A representative immunofluorescence analysis of full-length NS5B and of a carboxyl-terminally truncated protein representing NS5B aa 1–392 (NS5B392) is shown in Fig. 1A. As described previously (20Schmidt-Mende J. Bieck E. Hügle T. Penin F. Rice C.M. Blum H.E. Moradpour D. J. Biol. Chem. 2001; 276: 44052-44063Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar), the full-length protein was found in a staining pattern characteristic for the endoplasmic reticulum. By contrast, the NS5B392 construct, which lacks the NS5B membrane insertion sequence, showed diffuse cytoplasmic and nuclear staining. Immunoprecipitation and Western blot experiments using mAbs 5B-12B7 and 5B-3B1 are shown in Fig. 1B. To perform such experiments with two mAbs of murine origin, mAb 5B-3B1 was biotinylated, and its reactivity was revealed with horseradish peroxidase-conjugated streptavidin. mAb 5B-12B7 efficiently immunoprecipitated NS5B from tetracycline-regulated cell lines inducibly expressing NS5B in the context of the entire HCV polyprotein. Moreover, NS5B expressed individually either as a full-length molecule or as a carboxyl-terminal truncation was immunoprecipitated efficiently. Most important, this mAb recognized and efficiently bound to NS5B in the functional context of the HCV replication complex present in 9-13 cells harboring selectable subgenomic replicons, even when such cells were lysed without the use of detergents. This suggests the interesting possibility of using mAb 5B-12B7 to isolate and study NS5B under native conditions in the context of a functionally active replication complex. Competitive inhibition experiments were performed to explore whether the mAbs recognized distinct or closely related NS5B epitopes. As shown in Fig. 1C, binding of biotinylated mAbs 5B-3B1 and 5B-12B7 to recombinant NS5B was not affected by excess non-biotinylated mAbs 5B-12B7 and 5B-3B1, respectively. These results clearly demonstrate that these mAbs recognize distinct epitopes on HCV RdRp. In addition, none of the additional four NS5B-specific mAbs listed in Table II were found to compete with binding of mAb 5B-3B1 or 5B-12B7 to NS5B (data not shown). Strong reactivity in immunoblot assays suggested that mAb 5B-3B1 recognizes a linear epitope. A random DNase I fragment expression library screening strategy was therefore performed to map this epitope. Three overlapping cDNA clones reactive with mAb 5B-3B1, designated 6-1-1, 8-1-1, and 15-3-2, resulted from this approach. Alignment of the amino acid sequences encoded by these cDNA clones allowed us to map the minimal epitope to NS5B aa 372–382 (Fig. 2A). This epitope is located at the palm-thumb subdomain boundary, as can be visualized on the three-dimensional structure of NS5B (Fig.2B). The observation that mAb 5B-12B7 did not react in immunoblot assays suggested that it recognizes a conformation-sensitive epitope on NS5B. Such epitopes are difficult to map, particularly in the case of proteins with a complex three-dimensional structure such as HCV RdRp. Using a comprehensive set of amino- and carboxyl-terminal NS5B deletion constructs (Fig. 3A), we examined the reactivity of this mAb by immunoprecipitation analyses. As shown in Fig. 3B, all constructs yielded stable proteins byin vitro transcription-translation. All truncated proteins were efficiently immunoprecipitated by a mouse polyclonal antiserum raised against recombinant NS5B (data not shown). mAb 5B-12B7 efficiently immunoprecipitated the full-length NS5B protein, carboxyl-terminal deletions to aa 392 (NS5BΔC21 and NS5B392, but not NS5B299), and amino-terminal deletions to aa 139 (NS5B11–591, NS5B46–591, and NS5B139–591, but not NS5B299–591) (Fig.3C). These results allowed us to map the mAb 5B-12B7 epitope to HCV aa 139–392. Accordingly, this mAb efficiently immunoprecipitated a NS5B fragment corresponding to aa 139–392, which constitute the entire palm subdomain and a small portion of the fingers subdomain. mAb 5B-12B7 efficiently immunoprecipitated recombinant NS5B proteins with amino acid substitutions at residues important for enzymatic activity, viz. D220G, D225G, G283R, T286V, T287K, N291K, G317A, D318H, D319E, and R345K (10Lohmann V. Körner F. Herian U. Bartenschlager R. J. Virol. 1997; 71: 8416-8428Crossref PubMed Google Scholar), indicating that these amino acid residues are not critical for mAb binding (data not shown). Given the highly specific interaction of mAb 5B-12B7 with NS5B under native conditions, we reasoned that this mAb might inhibit the RdRp activity. To explore this possibility, constant amounts of highly purified HCV NS5B were used for an in vitro RdRp assay in the presence of various concentrations of mAb 5B-12B7 that was purified from ascites fluid by protein G affinity chromatography. Incorporation of radioactivity into newly synthesized RNA was measured after trichloroacetic acid precipitation onto glass fiber filters by liquid scintillation counting, and background values as determined by analogous assays with a purified inactive HCV RdRp (∼1200 cpm) were subtracted. Control reactions without mAbs routinely yielded 80,000–90,000 cpm. As shown in Fig. 4, RNA synthesis was efficiently blocked by very low concentrations of mAb 5B-12B7. Assuming that the majority of the antibodies isolated from ascites fluid correspond to mAb 5B-12B7, we calculated a virtually complete inhibition of HCV RdRp at a 1:1 molar ratio of mAb to enzyme. This effect was specific because no inhibition was found with mAb 5B-3B1 (directed against the linear NS5B epitope) and mAb 1B6 (directed against the HCV nonstructural protein 3 seri
Referência(s)