Portal de Periódicos da CAPES

A Naturally Occurring Point Mutation Confers Broad Range Tolerance to Herbicides That Target Acetolactate Synthase

1995; Elsevier BV; Volume: 270; Issue: 29 Linguagem: Inglês

10.1074/jbc.270.29.17381

1083-351X

Paul Bernasconi, Alison R. Woodworth, Barbara Rosen, Mani Subramanian, Daniel L. Siehl,

Plant tissue culture and regeneration

Acetolactate synthase (ALS) inhibitors are among the most commonly used herbicides. They fall into four distinct families of compounds: sulfonylureas, imidazolinones, triazolopyrimidine sulfonanilides, and pyrimidinyl oxybenzoates. We have investigated the molecular basis of imidazolinone tolerance of two field isolates of cocklebur (Xanthium sp.) from Mississippi and Missouri. In both cases, tolerance was conferred by a form of ALS that was less sensitive to inhibitors than the wild type. The insensitivity pattern of the Mississippi isolate was similar to that of a commercial mutant of corn generated in the laboratory: ICI 8532 IT. Sequencing revealed that the same residue (Ala57→ Thr) was mutated in both Mississippi cocklebur and ICI 8532 IT corn. ALS from the Missouri isolate was highly insensitive to all the ALS herbicide families, similar in this respect to another commercial corn mutant: Pioneer 3180 IR corn. Sequencing of ALS from both plants revealed a common mutation that changed Trp552 to Leu. The sensitive cocklebur ALS cDNA, fused with a glutathione S-transferase, was functionally expressed in Escherichia coli. The recombinant protein had enzymatic properties similar to those of the plant enzyme. All the possible point mutations affecting Trp552 were investigated by site-directed mutagenesis. Only the Trp → Leu mutation yielded an active enzyme. This mutation conferred a dramatically reduced sensitivity toward representatives of all four chemical families, demonstrating its role in herbicide tolerance. This study indicates that mutations conferring herbicide tolerance, obtained in an artificial environment, also occur in nature, where the selection pressure is much lower. Thus, this study validates the use of laboratory models to predict mutations that may develop in natural populations. Acetolactate synthase (ALS) inhibitors are among the most commonly used herbicides. They fall into four distinct families of compounds: sulfonylureas, imidazolinones, triazolopyrimidine sulfonanilides, and pyrimidinyl oxybenzoates. We have investigated the molecular basis of imidazolinone tolerance of two field isolates of cocklebur (Xanthium sp.) from Mississippi and Missouri. In both cases, tolerance was conferred by a form of ALS that was less sensitive to inhibitors than the wild type. The insensitivity pattern of the Mississippi isolate was similar to that of a commercial mutant of corn generated in the laboratory: ICI 8532 IT. Sequencing revealed that the same residue (Ala57→ Thr) was mutated in both Mississippi cocklebur and ICI 8532 IT corn. ALS from the Missouri isolate was highly insensitive to all the ALS herbicide families, similar in this respect to another commercial corn mutant: Pioneer 3180 IR corn. Sequencing of ALS from both plants revealed a common mutation that changed Trp552 to Leu. The sensitive cocklebur ALS cDNA, fused with a glutathione S-transferase, was functionally expressed in Escherichia coli. The recombinant protein had enzymatic properties similar to those of the plant enzyme. All the possible point mutations affecting Trp552 were investigated by site-directed mutagenesis. Only the Trp → Leu mutation yielded an active enzyme. This mutation conferred a dramatically reduced sensitivity toward representatives of all four chemical families, demonstrating its role in herbicide tolerance. This study indicates that mutations conferring herbicide tolerance, obtained in an artificial environment, also occur in nature, where the selection pressure is much lower. Thus, this study validates the use of laboratory models to predict mutations that may develop in natural populations. Acetolactate synthase (ALS1; 1The abbreviations used are: ALSacetolactate synthaseSUsulfonylureaIMimidazolinoneTPtriazolopyrimidine sulfonanilideMS-XANSTcocklebur, Mississippi ecotypeMO-XANSTcocklebur, Missouri ecotypeS-XANSTwild-type cocklebur (Xanthium sp.)IRimidazolinone-resistantITimidazolinone-tolerantPOBpyrimidinyl oxybenzoatePCRpolymerase chain reactionEPPSN-2-hydroxyethylpiperazine-N′-3-propanesulfonic acid. 1The abbreviations used are: ALSacetolactate synthaseSUsulfonylureaIMimidazolinoneTPtriazolopyrimidine sulfonanilideMS-XANSTcocklebur, Mississippi ecotypeMO-XANSTcocklebur, Missouri ecotypeS-XANSTwild-type cocklebur (Xanthium sp.)IRimidazolinone-resistantITimidazolinone-tolerantPOBpyrimidinyl oxybenzoatePCRpolymerase chain reactionEPPSN-2-hydroxyethylpiperazine-N′-3-propanesulfonic acid. EC 4.1.3.18; acetohydroxyacid synthase) catalyzes the condensation of two molecules of pyruvate or one molecule of pyruvate and one of 2-ketobutyrate to form 2-acetolactate or 2-aceto-2-hydroxybutyrate, respectively(1Bryan J.K. Conn E.E. Stumpf P.K. The Biochemistry of Plants. Academic Press, Inc., New York1990: 161-165Google Scholar). This is the first enzyme in the biosynthetic pathway leading to the production of valine, leucine, and isoleucine in plants and microorganisms. Sequence comparisons have revealed substantial homologies between the mature forms of ALS of bacteria (large subunit), yeast, and higher plants (for a review, see (2Mazur B.J. Chui C.-F. Smith J.K. Plant Physiol. 1987; 85: 1110-1117Crossref PubMed Google Scholar)). The eukaryotic ALS proform contains a transit peptide at the N terminus that directs the enzyme to the chloroplast in higher plants(3Miflin B.J. Plant Physiol. 1974; 54: 550-555Crossref PubMed Google Scholar, 4Smith J.K. Schloss J.V. Mazur B.J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4179-4183Crossref PubMed Scopus (38) Google Scholar). acetolactate synthase sulfonylurea imidazolinone triazolopyrimidine sulfonanilide cocklebur, Mississippi ecotype cocklebur, Missouri ecotype wild-type cocklebur (Xanthium sp.) imidazolinone-resistant imidazolinone-tolerant pyrimidinyl oxybenzoate polymerase chain reaction N-2-hydroxyethylpiperazine-N′-3-propanesulfonic acid. acetolactate synthase sulfonylurea imidazolinone triazolopyrimidine sulfonanilide cocklebur, Mississippi ecotype cocklebur, Missouri ecotype wild-type cocklebur (Xanthium sp.) imidazolinone-resistant imidazolinone-tolerant pyrimidinyl oxybenzoate polymerase chain reaction N-2-hydroxyethylpiperazine-N′-3-propanesulfonic acid. There are many structurally diverse families of potent inhibitors of ALS (for a review, see (5Babczinski P. Zelinski T. Pestic. Sci. 1991; 31: 305-323Crossref Scopus (39) Google Scholar)). A number of compounds representing three distinct chemical families, i.e. sulfonylureas (SU) (6Sauers R.F. Levitt G. ACS Symp. Ser. 1984; 255: 21-28Crossref Google Scholar), imidazolinones (IM)(7Los M. ACS Symp. Ser. 1984; 255: 29-44Crossref Google Scholar), and triazolopyrimidine sulfonanilides (TP)(8Kleschick W.A. Costales M.J. Dunbar J.E. Meikle R.W. Monte W.T. Pearson N.R. Snider S.W. Vinogradoff A.P. Pestic. Sci. 1992; 29: 341-355Crossref Scopus (92) Google Scholar), are produced commercially as herbicides, and there are many others in development such as pyrimidinyl oxybenzoates(9Subramanian M.V. Hung H.Y. Dias J.M. Miner V.W. Butler J.H. Jachetta J.J. Plant Physiol. 1990; 94: 239-244Crossref PubMed Scopus (78) Google Scholar). The popularity of ALS-inhibiting herbicides can be attributed to (i) their efficacy at low use rates against a broad spectrum of weeds, (ii) multi-crop selectivity, (iii) lack of mammalian toxicity, and (iv) favorable environmental profile(10Saari L.L. Coterman J.C. Thill D.C. Powles S. Holtum J. Herbicide Resistance in Plants: Biology and Biochemistry. Lewis Publishers, Inc., Boca Raton, FL1994: 83-139Google Scholar). However, constant and extensive use of ALS-inhibiting herbicides has resulted in selection of tolerant weeds worldwide(10Saari L.L. Coterman J.C. Thill D.C. Powles S. Holtum J. Herbicide Resistance in Plants: Biology and Biochemistry. Lewis Publishers, Inc., Boca Raton, FL1994: 83-139Google Scholar). Development of tolerance to SU, since its first appearance in 1987, has been particularly dramatic(11Mallory-Smith C.A. Thill D.C. Dial M.J. Weed Technol. 1990; 4: 163-168Crossref Google Scholar). In addition, isolation of tolerant lines in tissue culture for different families of ALS-inhibiting herbicides has been reported by a number of laboratories (9Subramanian M.V. Hung H.Y. Dias J.M. Miner V.W. Butler J.H. Jachetta J.J. Plant Physiol. 1990; 94: 239-244Crossref PubMed Scopus (78) Google Scholar, 12Saxena P.K. King J. Plant Physiol. 1988; 86: 863-867Crossref PubMed Google Scholar). Since the structurally diverse ALS inhibitors are competitive with one another with respect to binding to the enzyme(13Subramanian M.V. Gallant V.L. Dias J.M. Mireles L.M. Plant Physiol. 1991; 96: 310-313Crossref PubMed Scopus (47) Google Scholar, 14Schloss J.V. Ciskanik L.M. Van Dyk D. Nature. 1988; 331: 360-362Crossref Scopus (150) Google Scholar), tolerance toward a particular herbicide has resulted in varying degrees of cross-tolerance to the other chemicals(9Subramanian M.V. Hung H.Y. Dias J.M. Miner V.W. Butler J.H. Jachetta J.J. Plant Physiol. 1990; 94: 239-244Crossref PubMed Scopus (78) Google Scholar, 12Saxena P.K. King J. Plant Physiol. 1988; 86: 863-867Crossref PubMed Google Scholar, 15Siehl D.L. Bengston A.S. Brockman J.P. Butler J.H. Kraatz G.W. Lamoreaux R.J. Subramanian M.V. Crop Sci. 1995; (in press)PubMed Google Scholar). The alteration of ALS by one or more point mutations is the only reported mechanism of tolerance(10Saari L.L. Coterman J.C. Thill D.C. Powles S. Holtum J. Herbicide Resistance in Plants: Biology and Biochemistry. Lewis Publishers, Inc., Boca Raton, FL1994: 83-139Google Scholar). The lesion causing tolerance to SU has been localized to a single point mutation affecting proline 197 in ALS in Arabidopsis thaliana(16Haughn G.W. Smith J. Mazur B. Somerville C. Mol. & Gen. Genet. 1988; 211: 266-271Crossref Scopus (229) Google Scholar) and position 196 in tobacco(17Lee K.Y. Townsend J. Tepperman J. Black M. Chui C.-F. Mazur B. Dunsmuir P. Bedbrook J. EMBO J. 1988; 7: 1241-1248Crossref PubMed Google Scholar). The same residue has also been implicated in SU tolerance in the fields(18Guttieri M.J. Eberlein C.V. Mallory-Smith C.A. Thill D.C. Hoffman D.L. Weed Sci. 1992; 40: 670-677Crossref Google Scholar). Only one IM-specific tolerance has been confirmed in the field so far(19Kendig J.A. De Felice M.S. Weed Science Society of America. 1994; (Abstr. 34)Google Scholar, 20Schmitzer P.R. Eilers R.J. Czeke C. Plant Physiol. 1993; 103: 281-283Crossref PubMed Scopus (47) Google Scholar), but the mutation involved has not been identified. Two IM-specific mutations have been obtained in the laboratory: first, a Ser653→ Asp change in the ALS gene of A. thaliana(21Sathasivan K. Haughn G.W. Murai N. Plant Physiol. 1991; 97: 1044-1050Crossref PubMed Scopus (85) Google Scholar) and second, an Ala56→ Thr mutation in corn(22Greaves J.A. Rufener G.K. Chang M.T. Koehler P.H. Proceedings of the 48th Annual Corn and Sorghum Industry Research Conference. 1993; : 104-118Google Scholar). The latter mutant was developed into a commercial product: ICI 8532 IT corn. Finally, in yeast, 10 distinct loci in the ALS gene have been shown to confer SU tolerance(23Mazur B.J. Carl Falco S. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1989; 40: 441-470Crossref Google Scholar), but the specificity of tolerance for each locus with respect to other families of ALS inhibitors has not been defined. We have cloned and sequenced the mutated ALS gene from two field isolates of cocklebur, a common broadleaf weed that has developed tolerance to IM(19Kendig J.A. De Felice M.S. Weed Science Society of America. 1994; (Abstr. 34)Google Scholar, 20Schmitzer P.R. Eilers R.J. Czeke C. Plant Physiol. 1993; 103: 281-283Crossref PubMed Scopus (47) Google Scholar). The first isolate (MS-XANST), from a field in Mississippi, showed specific tolerance to IM. The second isolate, (MO-XANST) from Missouri, showed high level and broad based tolerance to all classes of ALS inhibitors. The mutation conferring broad based tolerance was further studied by site-directed mutagenesis, implicating it in the dramatically high level and broad based tolerance to all ALS-inhibiting herbicides. Seeds of wild-type cocklebur (S-XANST) were from Azlin Seeds Service (Leland, MS). Seeds of the Mississippi isolate (MS-XANST) were provided by the Sandoz Agro, Inc. field station in Mississippi. Seeds of the Missouri isolate (MO-XANST) were collected from a field near Caruthersville, MO in the fall of 1993 and were kindly provided by Professor Andy Kendig (University of Missouri). These seeds were grown in a greenhouse, and mature leaves were harvested. See (15Siehl D.L. Bengston A.S. Brockman J.P. Butler J.H. Kraatz G.W. Lamoreaux R.J. Subramanian M.V. Crop Sci. 1995; (in press)PubMed Google Scholar) for details on Pioneer 3180 IR corn and ICI 8532 IT corn. The following chemicals were used as representatives of each ALS inhibitor family: chlorsulfuron (SU), imazethapyr (IM), flumetsulam (TP), and pyrimidinyl oxybenzoate (POB). SU, IM, and TP were obtained from Chem Service, Inc. (West Chester, PA). POB (9Subramanian M.V. Hung H.Y. Dias J.M. Miner V.W. Butler J.H. Jachetta J.J. Plant Physiol. 1990; 94: 239-244Crossref PubMed Scopus (78) Google Scholar) was synthesized by Sandoz Agro, Inc. chemists. Partially purified ALS active fractions were prepared from young green leaves as described by Schmitzer et al.(20Schmitzer P.R. Eilers R.J. Czeke C. Plant Physiol. 1993; 103: 281-283Crossref PubMed Scopus (47) Google Scholar). The ALS assay was performed as described by Siehl et al.(15Siehl D.L. Bengston A.S. Brockman J.P. Butler J.H. Kraatz G.W. Lamoreaux R.J. Subramanian M.V. Crop Sci. 1995; (in press)PubMed Google Scholar). Protocols from Ausubel et al.(24Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1993Google Scholar) were used. About 20 g of frozen leaves were ground to a fine powder in a coffee grinder cooled with dry ice. Total RNA was prepared using the guanidium isothiocyanate method(24Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1993Google Scholar). mRNA was prepared by oligo(dT) chromatography (Life Technologies, Inc.) from 1.5 mg of total RNA. mRNA was used for both cDNA synthesis and Northern blot analysis(24Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1993Google Scholar). Genomic DNA was prepared from 20 g of leaves using established protocols involving CsCl gradient centrifugation(24Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1993Google Scholar). S-XANST cDNA was used for the preparation of a [lamdba]gt10 library according to the vector manufacturer's instructions (Promega, Madison, WI). Two degenerate PCR primers (Keystone Labs Inc., Menlo Park, CA) were designed in regions of the ALS gene conserved through evolution between plants, bacteria, and yeast. Their sequences were ATG(CT)T(ACTG)GG(ACTG)ATGCA(CT)GG and ACAT(CT)TG(AG)TG(CT)TG(ACTG)CC(ACTG)AC. The corresponding 398-base pair fragment from wild-type ALS was amplified (Ampli-Taq™ kit, Perkin-Elmer) from 10 ng of S-XANST cDNA and cloned into pBluescript SK(+) (Stratagene, La Jolla, CA). The library was screened by plaque hybridization with a probe obtained by random labeling (Promega) of the cloned PCR fragment. Both strands of the largest positive insert were sequenced with a combination of subcloning and custom primers (Keystone Labs Inc.). PCR primers were derived from the S-XANST ALS sequence. PCR amplification was performed on 10 ng of MS-XANST or MO-XANST cDNA. The amplified fragments were cloned into pCR-Script SK(+) (Stratagene), and at least two independent clones were sequenced for each region. Pioneer 3180 IR corn kernels (Pioneer Hi-Bred) were germinated in soil and grown for ∼1 month in a greenhouse. Mature leaves were harvested and used for the preparation of cDNA as described above. PCR primers were designed based on the published sequence of wild-type ALS(25Fang L.Y. Gross P.R. Chen C.H. Lillis M. Plant Mol. Biol. 1992; 18: 1185-1187Crossref PubMed Scopus (31) Google Scholar). The amplified fragments were cloned and sequenced as described above. The fusion protein vector pGEX-2T (Pharmacia Biotech Inc.) was used. PCR amplification was used to introduce BamHI sites at the beginning (primer sequence: CACACATGGATCCATGGCGGCCATCCC) and the end (primer sequence: CATTGAGGATCCATATTTCATTCTGCC) of the complete open reading frame coding for the enzyme. The obtained fragment was cloned in both orientations in the expression vector, and the construct was used to transform Escherichia coli MC1061 cells. Expression was typically performed in 50-ml cultures. The cells were grown at 37°C with shaking at 300 rpm. Protein expression was induced when the culture reached an A600 of 0.5 by the addition of 1 mM isopropyl-1-thio-β-D-galactopyranoside. The culture was allowed to grow until late exponential phase and harvested. The fusion protein was prepared by chromatography on GSH-Sepharose (Pharmacia Biotech Inc.)(26Bernasconi P. Walters E.W. Woodworth A.R. Siehl D.L. Stone T.E. Subramanian M.V. Plant Physiol. 1994; 106: 353-358Crossref PubMed Scopus (17) Google Scholar). The extraction buffer was composed of 50 mM EPPS, pH 7.5, 10 mM MgCl2, 5 mM dithiothreitol, 10% ethylene glycol, 10 μM FAD, 1 mM pyruvate, 1 μg/ml leupeptin, 2 μg/ml aprotinin, and 1 μg/ml pepstatin. Site-directed mutagenesis of the expressed S-XANST ALS was performed directly on the plasmid derived from pGEX-2T containing the ALS cDNA. A unique site elimination mutagenesis kit (Pharmacia Biotech Inc.) was used with the PstI/SacII primers for selection and custom mutagenesis primers (Keystone Labs Inc.). The Trp codon (TGG) was mutated to TCG (Ser), AGG (Arg), TGT (Cys), GGG (Gly), and TTG (Leu). The plasmids containing the mutated cDNA were expressed under the same conditions as described above, except that the bacteria were grown at 30°C at 125 rpm and were induced with 0.5 mM isopropyl-1-thio-β-D-galactopyranoside. The extraction and elution buffers were the same as described above, but with 10 mM pyruvate. The assay was performed as described in (15Siehl D.L. Bengston A.S. Brockman J.P. Butler J.H. Kraatz G.W. Lamoreaux R.J. Subramanian M.V. Crop Sci. 1995; (in press)PubMed Google Scholar), except that 0.25-1 μg of purified fusion protein was used, and the incubation time was reduced to 30 min. Protein was determined using the Bio-Rad Bradford reagent. Partially purified fractions of each cocklebur biotype were used for the determination of enzymatic activity. The Km for pyruvate for each biotype was found to be in the range of 3.2-6.6 mM. The reaction was linear in the presence of 50 mM pyruvate for at least 90 min. The plant enzyme was inactivated upon prolonged incubation at room temperature and upon freezing. Inhibition of the plant enzymes by representatives of the four chemical families was studied. The IC50 values for the inhibition by SU, IM, TP, and POB were determined, and the results are summarized in the Table 1. The results clearly indicate that a modified enzyme was responsible for IM tolerance in MS-XANST and for the broad based tolerance in MO-XANST.TABLE I Open table in a new tab Before establishing the mutations present in MS-XANST and MO-XANST, it was necessary to obtain the sequence of ALS from the wild-type cocklebur (S-XANST). Using the two degenerate primers, a 398-base pair fragment was amplified from S-XANST cDNA. Northern blot analysis of leaf mRNA, probed with the amplified fragment, revealed the presence of a major transcript of 3.5 kilobases (>90% of the signal) with minor mRNA bands at 5 and 6 kilobases. Screening of 100,000 phages from the cDNA library yielded four positive clones. The longest cDNA insert was 2146 base pairs and encoded a 648-residue protein. The resulting protein sequence, together with other sequences relevant to this work, is shown in the Fig. 1. The N-terminal 77-residue chloroplast transit peptide shared no homology with any other peptide with similar function. The 571-residue mature protein was 89, 78, and 46% homologous to the corresponding ALS of tobacco, corn, and yeast, respectively. PCR analysis of the genomic DNA revealed that the ALS gene(s) was devoid of introns, i.e. the amplified fragments from genomic DNA did not differ in size from the fragments obtained from the cDNA. The sequence of the mature form of MS-XANST ALS was established in three overlapping fragments of the ALS cDNA. The fragments encompassed nucleotides 298-748, 530-1860, and 1419-2056. Nine point mutations were detected, with two of them translating into an amino acid change: Ala133→ Thr and Phe258→ Leu (Fig. 1). The sequence of ALS from MO-XANST was obtained by similar means, except that the first overlapping fragment was from nucleotides 102 to 1123, thus giving the complete proform of ALS. Eight nucleotide changes were detected, five of which caused a mutation in the sequence of the protein. The amino acid changes were Lys63→ Glu, Phe258→ Leu, Gln269→ His, Asn522→ Ser, and Trp552→ Leu (Fig. 1). The sequence of mature ALS from 3180 IR corn was obtained by PCR amplification of two overlapping fragments: nucleotides 904-1552 and 1138-2578 of the published sequence ZMAHAS108(25Fang L.Y. Gross P.R. Chen C.H. Lillis M. Plant Mol. Biol. 1992; 18: 1185-1187Crossref PubMed Scopus (31) Google Scholar). Two mutations in the protein sequence were detected: Trp542 was mutated to Leu, and Glu588 was changed to Val (Fig. 1). S-XANST was expressed in E. coli as a protein fused to glutathione S-transferase. Upon expression, a 97-kDa product was detected by SDS-polyacrylamide gel electrophoresis in GSH-Sepharose-purified fractions. Two other proteins of 65 and 32 kDa were also present in these fractions. Further separation by gel filtration showed that ALS activity copurified with the 97-kDa protein. None of these products were detected in purified extracts from bacteria expressing a construct in which the ALS cDNA was inserted backwards. In a similar fashion, no correct product was detected upon expression of a construct composed of the glutathione S-transferase and the mature form of ALS (Ala78-Tyr648). In the latter case, inclusion bodies were clearly observable in the bacteria, whereas they could not be detected in bacteria expressing the fused ALS proform. Only the construct comprising the ALS proform was used for the rest of the work. A typical experiment yielded ∼3 mg of purified fusion protein/liter of culture with a specific activity of 250 μmol/h/mg. The Km for pyruvate was 6 mM. The stability of the recombinant enzyme was much greater than that of plant ALS since it was not inactivated by prolonged incubation at room temperature or repeated freezing and thawing. Its sensitivity toward inhibitors was similar to that of the S-XANST enzyme (Table 2).TABLE II Open table in a new tab We investigated the effect of a point mutation of the Trp codon by site-directed mutagenesis. Out of the nine possibilities, two of them gave a stop codon (TGA and TAG) and were not pursued since a truncated enzyme would likely be inactive. The other point mutations encode for cysteine, glycine, leucine, arginine, and serine. The Cys mutation gave an unstable protein, and no enzyme of the correct molecular mass could be detected by SDS-polyacrylamide gel electrophoresis. The other four mutations gave a fusion protein with the correct molecular mass, but only the leucine mutation yielded an active ALS. Active enzyme was obtained only when a lower level of induction (0.5 mM isopropyl-1-thio-β-D-galactopyranoside instead of 1 mM) and a lower aeration and temperature (200 rpm at 30°C instead of 300 rpm at 37°C) were used. A yield of 0.4 mg/liter was obtained with a specific activity of 50 μmol/h/mg. This protein had a Km of 2 mM for pyruvate. The enzyme with the Trp → Leu mutation was assayed for sensitivity toward the different chemical classes and was comparable to the MO-XANST enzyme (Table 2). Since only partially purified fractions from S-XANST, MS-XANST, and MO-XANST were used, we did not determine the composition of ALS isozymes in our preparation. But, based on literature reports (2Mazur B.J. Chui C.-F. Smith J.K. Plant Physiol. 1987; 85: 1110-1117Crossref PubMed Google Scholar) and as further confirmed our by Northern blot analysis, we assumed that the observed activity was mostly due to one major isozyme. As is the case for most broadleaf plants, S-XANST ALS was susceptible to representatives of all families of ALS inhibitors used in this study. The MS-XANST enzyme was particularly less sensitive to imazethapyr, with a modest desensitization to the others (Table 1). The pattern of tolerance to ALS inhibitors in MS-XANST was comparable to that observed with the hybrid corn ICI 8532 IT (Table 1)(15Siehl D.L. Bengston A.S. Brockman J.P. Butler J.H. Kraatz G.W. Lamoreaux R.J. Subramanian M.V. Crop Sci. 1995; (in press)PubMed Google Scholar). In contrast, MO-XANST was highly tolerant to all ALS inhibitors tested, like the commercial hybrid Pioneer 3180 IR corn (Table 1). None of the mutant lines showed any significant change with respect to sensitivity to leucine (data not shown). Northern blot analysis showed a major transcript for ALS and that ALS activity is mostly due to one isozyme. The demonstration, by PCR, that the cocklebur ALS gene is intronless further validates the same observation made by other researchers working with corn(25Fang L.Y. Gross P.R. Chen C.H. Lillis M. Plant Mol. Biol. 1992; 18: 1185-1187Crossref PubMed Scopus (31) Google Scholar). Although the S-XANST ALS primary sequence did not differ substantially from other plant ALS sequences, there was a noteworthy variation: the serine implicated in imidazolinone tolerance in Arabidopsis (Ser656) (21Sathasivan K. Haughn G.W. Murai N. Plant Physiol. 1991; 97: 1044-1050Crossref PubMed Scopus (85) Google Scholar) was replaced by Ala in cocklebur (Ala631). Two mutations affecting the primary structure of ALS were found. The mutation Ala133→ Thr is identical to the mutation described for ICI 8532 IT(22Greaves J.A. Rufener G.K. Chang M.T. Koehler P.H. Proceedings of the 48th Annual Corn and Sorghum Industry Research Conference. 1993; : 104-118Google Scholar). This finding makes the correlation between sensitivity toward inhibitors and gene mutation of the natural isolate (MS-XANST) and the laboratory isolate (ICI 8532 IT) quite striking. These two mutations were obtained using different selective pressures, and one could have believed that the mutation obtained using a high selection pressure and chemical mutagenesis in the laboratory could only occur at an extremely low frequency in the field. The Phe258→ Leu mutation was probably a natural variation with no consequences for inhibitor tolerance since a Leu residue in that position is present in ALS from several other plants. Of the five mutations found in MO-XANST, Lys63→ Glu and Phe258→ Leu can be quickly dismissed for consideration for a role in tolerance. The first one occurs in the chloroplast transit peptide that is cleaved from the mature protein. The second one is the same variation found in MS-XANST. At this point, there was no indication of the involvement of the other three mutations in tolerance. Two of them, Gln269→ His and Asn522→ Ser, affect residues that are not conserved in yeast and may not play any role in tolerance. The most interesting mutation was the Trp552→ Leu mutation. Such a change has been shown to increase SU tolerance in tobacco already harboring the Pro mutation characteristic of SU tolerance(17Lee K.Y. Townsend J. Tepperman J. Black M. Chui C.-F. Mazur B. Dunsmuir P. Bedbrook J. EMBO J. 1988; 7: 1241-1248Crossref PubMed Google Scholar). The Trp552 mutation has never been described alone in plants, and the proline residue (Pro175) is unchanged in MS-XANST and MO-XANST. Work done in yeast indicated that the mutation of this Trp residue confers an increased tolerance to SU(23Mazur B.J. Carl Falco S. Annu. Rev. Plant Physiol. Plant Mol. Biol. 1989; 40: 441-470Crossref Google Scholar). The pattern of cross-tolerance in MO-XANST was similar to that in the commercial hybrid Pioneer 3180 IR corn(22Greaves J.A. Rufener G.K. Chang M.T. Koehler P.H. Proceedings of the 48th Annual Corn and Sorghum Industry Research Conference. 1993; : 104-118Google Scholar). There is no report in the literature about the nature of the mutation in 3180 IR corn; hence, a comparison of the mutations in MO-XANST and 3180 IR corn ALS was undertaken to pinpoint the mutation responsible for the broad based tolerance to ALS inhibitors. Of the two mutations detected in 3180 IR corn, Glu588 was probably not involved in tolerance since this residue is not conserved among the different ALS enzymes. The Trp542→ Leu mutation corresponded to the Trp mutation in MO-XANST (Trp552), making it a very likely candidate for the mutation responsible for the high degree of tolerance. Two questions needed to be answered: first, whether the Trp mutation alone was sufficient to confer tolerance, and second, whether the Trp residue could be mutated to amino acids other than Leu and still confer tolerance. Indeed, in the case of SU tolerance, all six possible single point mutations in the first or second base of the Pro codon have been shown to occur and confer SU tolerance(18Guttieri M.J. Eberlein C.V. Mallory-Smith C.A. Thill D.C. Hoffman D.L. Weed Sci. 1992; 40: 670-677Crossref Google Scholar). Two reports describe the functional expression of plant ALS in bacteria. Smith et al.(4Smith J.K. Schloss J.V. Mazur B.J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4179-4183Crossref PubMed Scopus (38) Google Scholar) and Singh et al.(27Singh B. Szamoni I. Hand L.M. Misra R. Plant Physiol. 1992; 99: 812-816Crossref PubMed Scopus (26) Google Scholar) reported the functional expression of a plant ALS in a bacteria deficient in its own ALS. Our expression system differed in several ways. First, since ALS is fused to glutathione S-transferase, it could be purified in one simple chromatography step on GSH-Sepharose, and second, the need for an ALS-deficient bacteria was avoided. Also, the construct provided an easy template on which to perform site-directed mutagenesis. Active protein was recovered only when the complete proform of S-XANST ALS was fused to the glutathione S-transferase. This finding is well in accordance with that of Smith et al.(4Smith J.K. Schloss J.V. Mazur B.J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4179-4183Crossref PubMed Scopus (38) Google Scholar). ALS activity was associated with the 97-kDa protein, contradicting the results of Singh et al.(27Singh B. Szamoni I. Hand L.M. Misra R. Plant Physiol. 1992; 99: 812-816Crossref PubMed Scopus (26) Google Scholar). In their expression system, cleavage of the chloroplast transit peptide was needed to obtain an active enzyme. The specific activity of the recombinant protein compared favorably with the best specific activity obtained for plant ALS, i.e. 190 μmol/h/mg for ALS purified from barley(28Durner J. Gailus V. Böger P. Plant Physiol. 1991; 95: 1144-1149Crossref PubMed Scopus (77) Google Scholar). The specific activities of the other recombinant plant proteins were 4 and 2.6 μmol/h/mg (4Smith J.K. Schloss J.V. Mazur B.J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4179-4183Crossref PubMed Scopus (38) Google Scholar) and 5 μmol/h/mg(27Singh B. Szamoni I. Hand L.M. Misra R. Plant Physiol. 1992; 99: 812-816Crossref PubMed Scopus (26) Google Scholar); but the degree of purification has not been reported, and it is assumed that these values were for only partially purified enzymes. The Km for pyruvate for the expressed fusion protein was in accordance with the Km generally reported for plant ALS (28Durner J. Gailus V. Böger P. Plant Physiol. 1991; 95: 1144-1149Crossref PubMed Scopus (77) Google Scholar) and the other recombinant ALS enzymes(4Smith J.K. Schloss J.V. Mazur B.J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4179-4183Crossref PubMed Scopus (38) Google Scholar, 27Singh B. Szamoni I. Hand L.M. Misra R. Plant Physiol. 1992; 99: 812-816Crossref PubMed Scopus (26) Google Scholar). A striking feature is the stability of the expressed ALS compared with the enzyme from various plant sources. It is conceivable that the presence of the chloroplast transit peptide may be a major contributing factor since, without this peptide, proper expression could not be achieved. Inhibitor sensitivity was identical to that for the plant enzyme with a major difference. The feedback inhibition by valine and leucine was lost in the recombinant enzyme, a finding consistent with the results of Singh et al.(27Singh B. Szamoni I. Hand L.M. Misra R. Plant Physiol. 1992; 99: 812-816Crossref PubMed Scopus (26) Google Scholar). Only the point mutations affecting Trp552 were investigated since the most dramatic tolerance toward ALS inhibitors was observed in a mutation affecting this residue. In our bacterial expression system, only the Trp → Leu mutation yielded an active protein. This mutation may negatively impact the stability of the protein since milder expression conditions were needed to obtain it in an active form. The increase in the IC50 values for the different ALS inhibitors for this recombinant protein correlated well with the values for the MO-XANST and Pioneer 3180 IR corn enzymes. Our study demonstrates that a single point mutation in the ALS gene, Trp552→ Leu, can confer to a weed a broad based and high level of tolerance to all the chemical families of inhibitors. Occurrence of this mutation will impact negatively on the widely used commercial products that are ALS inhibitors. Moreover, we also demonstrate that, given the time, mutations obtained using extreme selective pressures in the laboratory have occurred in nature and are now being selected from wild-type populations during herbicide application. We are indebted to Professor Andy Kendig for providing the seeds for MO-XANST. We thank Dr. Robert Lamoreaux and Randy Ratliff for providing the MS-XANST seeds. We acknowledge the excellent greenhouse work of Tom DeHoog.