Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Molecular and Functional Characterization of a Soluble Form of Oncostatin M/Interleukin-31 Shared Receptor

2006; Elsevier BV; Volume: 281; Issue: 48 Linguagem: Inglês

10.1074/jbc.m607005200

ISSN

1083-351X

Autores

Caroline Diveu, Emilie Vénéreau, Josy Froger, Elisa Ravon, Linda Grimaud, François Rousseau, Sylvie Chevalier, Hugues Gascan,

Tópico(s)

Immune Cell Function and Interaction

Resumo

Activation of the signaling transduction pathways mediated by oncostatin M (OSM) requires the binding of the cytokine to either type I OSM receptor (leukemia inhibitory factor receptor/gp130) or to type II OSM receptor (OSMR/gp130). In the present work we have developed an enzyme-linked immunosorbent assay detecting a soluble form of OSMR (sOSMR) secreted by glioblastoma, hepatoma, and melanoma tumor cell lines. sOSMR was also present in sera of healthy individuals, with increased levels in multiple myeloma. Molecular cloning of a corresponding cDNA was carried out, and it encoded for a 70-kDa protein consisting of a half cytokine binding domain containing the canonical WSXWS motif, an immunoglobulin-like domain, and the first half of a second cytokine binding domain with cysteines in fixed positions. Analysis of the soluble receptor distribution revealed a preferential expression in lung, liver, pancreas, and placenta. sOSMR was able to bind OSM and interleukin-31 when associated to soluble gp130 or soluble interleukin-31R, respectively, and to neutralize both cytokine properties. We have also shown that OSM could positively regulate the synthesis of its own soluble receptor in tumor cells. Activation of the signaling transduction pathways mediated by oncostatin M (OSM) requires the binding of the cytokine to either type I OSM receptor (leukemia inhibitory factor receptor/gp130) or to type II OSM receptor (OSMR/gp130). In the present work we have developed an enzyme-linked immunosorbent assay detecting a soluble form of OSMR (sOSMR) secreted by glioblastoma, hepatoma, and melanoma tumor cell lines. sOSMR was also present in sera of healthy individuals, with increased levels in multiple myeloma. Molecular cloning of a corresponding cDNA was carried out, and it encoded for a 70-kDa protein consisting of a half cytokine binding domain containing the canonical WSXWS motif, an immunoglobulin-like domain, and the first half of a second cytokine binding domain with cysteines in fixed positions. Analysis of the soluble receptor distribution revealed a preferential expression in lung, liver, pancreas, and placenta. sOSMR was able to bind OSM and interleukin-31 when associated to soluble gp130 or soluble interleukin-31R, respectively, and to neutralize both cytokine properties. We have also shown that OSM could positively regulate the synthesis of its own soluble receptor in tumor cells. Oncostatin M (OSM) 3The abbreviations used are: OSM, oncostatin M; OSMR, OSM receptor; sgp130, soluble gp130; ELISA, enzyme-linked immunosorbent assay; mAb, monoclonal antibody; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GPL, gp130-like receptor; IL, interleukin; sIL, soluble IL; LIF, leukemia inhibitory factor; LIFR, LIF receptor; CNTF, ciliary neurotrophic factor; CBD, cytokine binding domain; STAT, signal transducer and activator of transcription. 3The abbreviations used are: OSM, oncostatin M; OSMR, OSM receptor; sgp130, soluble gp130; ELISA, enzyme-linked immunosorbent assay; mAb, monoclonal antibody; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GPL, gp130-like receptor; IL, interleukin; sIL, soluble IL; LIF, leukemia inhibitory factor; LIFR, LIF receptor; CNTF, ciliary neurotrophic factor; CBD, cytokine binding domain; STAT, signal transducer and activator of transcription. was originally isolated from culture supernatant of U937 histiocytic leukemia cells based on its ability to inhibit the proliferation of the A375 melanoma cell line (1Zarling J.M. Shoyab M. Marquardt H. Hanson M.B. Lioubin M.N. Todaro G.J. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 9739-9743Crossref PubMed Scopus (362) Google Scholar, 2Rose T.M. Bruce A.G. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 8641-8645Crossref PubMed Scopus (339) Google Scholar). OSM is produced by activated monocyte, T lymphocyte, and dendritic cell types and is also described as a potent inducer of inflammation (3Brown T.J. Lioubin M.N. Marquardt H. J. Immunol. 1987; 139: 2977-2983PubMed Google Scholar, 8Wallace P.M. MacMaster J.F. Rouleau K.A. Brown T.J. Loy J.K. Donaldson K.L. Wahl A.F. J. Immunol. 1999; 162: 5547-5555PubMed Google Scholar). OSM belongs to the interleukin-6 cytokine family also encompassing IL-11, IL-27, leukemia inhibitory factor (LIF), ciliary neurotrophic factor (CNTF), cardiotrophin-1, cardiotrophin-like cytokine, and neuropoietin (9Heinrich P.C. Behrmann I. Haan S. Hermanns H.M. Muller-Newen G. Schaper F. Biochem. J. 2003; 374: 1-20Crossref PubMed Scopus (2442) Google Scholar, 12Derouet D. Rousseau F. Alfonsi F. Froger J. Hermann J. Barbier F. Perret D. Diveu C. Guillet C. Preisser L. Dumont A. Barbado M. Morel A. deLapeyriere O. Gascan H. Chevalier S. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 4827-4832Crossref PubMed Scopus (137) Google Scholar). The cytokines of the IL-6 family use two- or three-membrane subunit receptors to form high affinity receptor complexes able to mediate downstream signaling events (13Boulay J.L. O'Shea J.J. Paul W.E. Immunity. 2003; 19: 159-163Abstract Full Text Full Text PDF PubMed Scopus (215) Google Scholar, 14Ozaki K. Leonard W.J. J. Biol. Chem. 2002; 277: 29355-29358Abstract Full Text Full Text PDF PubMed Scopus (234) Google Scholar). These receptors belong to the type I cytokine receptors, characterized by the presence of at least one cytokine binding domain (CBD) with conserved cysteine positions and a WSXWS motif (15Bazan J.F. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 6934-6938Crossref PubMed Scopus (1864) Google Scholar). All the receptor complexes belonging to the IL-6 cytokine family share the common gp130 signaling receptor subunit in the formation of their multimeric receptors (16Hibi M. Murakami M. Saito M. Hirano T. Taga T. Kishimoto T. Cell. 1990; 63: 1149-1157Abstract Full Text PDF PubMed Scopus (1086) Google Scholar). Depending on the ligand, gp130 can either homodimerize in the presence of IL-6 or IL-11 (17Murakami M. Hibi M. Nakagawa N. Nakagawa T. Yasukawa K. Yamanishi K. Kishimoto Taga T. Science. 1993; 260: 1808-1810Crossref PubMed Scopus (638) Google Scholar, 18Nandurkar H.H. Hilton D.J. Nathan P. Willson T. Nicola N. Begley C.G. Oncogene. 1996; 12: 585-593PubMed Google Scholar) or heterodimerize with related type I cytokine receptors such as LIFR, IL-27R, or OSMR when recruited by other members of the IL-6 family of cytokines (19Gearing D.P. Comeau M.R. Friend D.J. Gimpel S.D. Thut C.J. McGourty J. Brasher K.K. King J.A. Gillis S. Mosley B. Ziegler S.F. Cosman D. Science. 1992; 255: 1434-1437Crossref PubMed Scopus (789) Google Scholar, 21Pflanz S. Hibbert L. Mattson J. Rosales R. Vaisberg E. Bazan J.F. Phillips J.H. McClanahan T.K. de Waal Malefyt R. Kastelein R.A. J. Immunol. 2004; 172: 2225-2231Crossref PubMed Scopus (560) Google Scholar). In humans, OSM signal transduction occurs via two distinct receptor complexes. The type I OSM receptor consists of the low affinity chain, LIFR, associated to gp130 (19Gearing D.P. Comeau M.R. Friend D.J. Gimpel S.D. Thut C.J. McGourty J. Brasher K.K. King J.A. Gillis S. Mosley B. Ziegler S.F. Cosman D. Science. 1992; 255: 1434-1437Crossref PubMed Scopus (789) Google Scholar). This type I receptor can indifferently bind LIF or OSM. Through this mechanism, OSM elicits biological activities overlapping with those induced by LIF, such as hepatocyte activation, bone renewal, or the in vitro maintenance of embryonic stem cell phenotype (22Gomez-Lechon M.J. Life Sci. 1999; 65: 2019-2030Crossref PubMed Scopus (80) Google Scholar). The type II OSM receptor, specifically recognizing OSM, associates gp130 and the OSMR subunit (23Mosley B. De Imus C. Friend D. Boiani N. Thoma B. Park L.S. Cosman D. J. Biol. Chem. 1996; 271: 32635-32643Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholar). OSMR is a 150-kDa protein composed in its external portion of a half CBD followed by an immunoglobulin-like domain, a second complete CBD, and then a region consisting of three FnIII domain repeats. The cytoplasmic domain of the receptor contains motifs required for the recruitment of Jak1, Jak2, and Tyk2 as well as of STAT1, STAT3, and STAT5 signaling pathways (24Kuropatwinski K.K. De Imus C. Gearing D. Baumann H. Mosley B. J. Biol. Chem. 1997; 272: 15135-15144Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 25Hermanns H.M. Radtke S. Schmitz-Van de Haan C. Leur H. Tavernier J. Heinrich P.C. Behrmann I. J. Immunol. 1999; 163: 6651-6658PubMed Google Scholar). The interaction of OSM with its specific type II receptor mediates the unique functions of OSM that cannot be mimicked by LIF or other IL-6 family members. Signaling by the type II OSM receptor inhibits the proliferation of a number of tumor cells, including glioblastoma, melanoma, mammary, and prostatic cell lines (1Zarling J.M. Shoyab M. Marquardt H. Hanson M.B. Lioubin M.N. Todaro G.J. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 9739-9743Crossref PubMed Scopus (362) Google Scholar, 2Rose T.M. Bruce A.G. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 8641-8645Crossref PubMed Scopus (339) Google Scholar, 26Lu C. Rak J.W. Kobayashi H. Kerbel R.S. Cancer Res. 1993; 53: 2708-2711PubMed Google Scholar, 28Friedrich M. Hoss N. Stogbauer F. Senner V. Paulus W. Ringelstein E.B. Halfter H. J. Neurochem. 2001; 76: 1589-1592Crossref PubMed Scopus (20) Google Scholar). In addition, OSM potently induces the proliferation of Kaposi sarcoma, fibroblastic, and smooth muscle cells (29Nair B.C. DeVico A.L. Nakamura S. Copeland T.D. Chen Y. Patel A. O'Neil T. Oroszlan S. Gallo R.C. Sarngadharan M.G. Science. 1992; 255: 1430-1432Crossref PubMed Scopus (209) Google Scholar, 31Grove R.I. Eberhardt C. Abid S. Mazzucco C. Liu J. Kiener P. Todaro G. Shoyab M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 823-827Crossref PubMed Scopus (81) Google Scholar). It was recently reported that OSMR could also be recruited by IL-31, a novel cytokine with a skin tropism (32Dillon S.R. Sprecher C. Hammond A. Bilsborough J. Rosenfeld-Franklin M. Presnell S.R. Haugen H.S. Maurer M. Harder B. Johnston J. Bort S. Mudri S. Kuijper J.L. Bukowski T. Shea P. Dong D.L. Dasovich M. Grant F.J. Lockwood L. Levin S.D. LeCiel C. Waggie K. Day H. Topouzis S. Kramer J. Kuestner R. Chen Z. Foster D. Parrish-Novak J. Gross J.A. Nat. Immunol. 2004; 5: 752-760Crossref PubMed Scopus (721) Google Scholar, 34Diveu C. Lak-Hal A.H. Froger J. Ravon E. Grimaud L. Barbier F. Hermann J. Gascan H. Chevalier S. Eur. Cytokine. Netw. 2004; 15: 291-302PubMed Google Scholar). Soluble cytokine receptors are involved in the regulation of a number of physiological and pathological situations. They can behave either as agonists or antagonists of cytokine signaling depending on the particular family of cytokines. Soluble cytokine receptors can be generated by different mechanisms, including proteolytic cleavages of the receptor extracellular parts, alternative splicing of RNA transcripts, or cleavage of a glycosylphosphatidylinositol anchor (35Levine S.J. J. Immunol. 2004; 173: 5343-5348Crossref PubMed Scopus (133) Google Scholar). The soluble counterparts of α-membrane chains, such as soluble IL-6 or CNTF receptors, are able to potentiate the functional responses to their respective ligands (36Honda M. Yamamoto S. Cheng M. Yasukawa K. Suzuki H. Saito T. Osugi Y. Tokunaga T. Kishimoto T. J. Immunol. 1992; 148: 2175-2180PubMed Google Scholar, 37Davis S. Aldrich T.H. Ip N.Y. Stahl N. Scherer S. Farruggella T. DiStefano P.S. Curtis R. Panayotatos N. Gascan H. Chevalier S. Yancopoulos G.D. Science. 1993; 259: 1736-1739Crossref PubMed Scopus (327) Google Scholar). In contrast, β-chain-derived soluble receptors, such as soluble gp130, neutralize the response to IL-6, IL-11, or CNTF (38Narazaki M. Yasukawa K. Saito T. Ohsugi Y. Fukui H. Koishihara Y. Yancopoulos G.D. Taga T. Kishimoto T. Blood. 1993; 82: 1120-1126Crossref PubMed Google Scholar). In the present work we have molecularly and functionally characterized a soluble form of the OSM/IL-31 shared receptor. Cells and Reagents—All the cell lines used in this study were cultured in RPMI 1640 medium supplemented with 10% fetal calf serum. BA/F3 gp130/OSMR and BA/F3 gp130/LIFR factor-dependent cell lines were grown in the same culture medium supplemented with OSM and LIF, respectively, as previously described (39Kallen K.J. Grotzinger J. Lelievre E. Vollmer P. Aasland D. Renne C. Myer zum Mullberg J. Buschenfelde K.H. Gascan H. Rose-John S. J. Biol. Chem. 1999; 274: 11859-11867Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Human OSM, interferon γ, transforming growth factor β, IL-1α, IL-2, IL-10, IL-11, CT-1, soluble CNTF receptor, soluble gp130 (sgp130), soluble LIF receptor, soluble IL-6 receptor (sIL-6R), soluble IL-4 receptor (sIL-4R) were purchased from R&D Systems. Drosophila Toll-Fc, human CLF-Fc, GPL/IL-31R-Fc, and IL-31 were made in the laboratory as previously described (11Elson G.C. Lelievre E. Guillet C. Chevalier S. Plun-Favreau H. Froger J. Suard I. de Coignac A.B. Delneste Y. Bonnefoy J.Y. Gauchat J.F. Gascan H. Nat. Neurosci. 2000; 3: 867-872Crossref PubMed Scopus (218) Google Scholar, 34Diveu C. Lak-Hal A.H. Froger J. Ravon E. Grimaud L. Barbier F. Hermann J. Gascan H. Chevalier S. Eur. Cytokine. Netw. 2004; 15: 291-302PubMed Google Scholar, 40Weber A.N. Tauszig-Delamasure S. Hoffmann J.A. Lelievre E. Gascan H. Ray K.P. Morse M.A. Imler J.L. Gay N.J. Nat. Immunol. 2003; 4: 794-800Crossref PubMed Scopus (326) Google Scholar). Antibody raised against phospho-STAT3 was bought from Upstate Biotechnology (Lake Placid, NY). Anti-STAT3 antibody was from Santa Cruz Biotechnology (Santa Cruz, CA). The anti-V5 antibody coupled to peroxidase was purchased from Invitrogen. Goat anti-mouse and anti-rabbit peroxidase-labeled immunoglobulins were from Clinisciences (Montrouge, France). Monoclonal antibodies against gp130 (AN-G73, AN-G40) were produced in the laboratory. Anti-OSMR antibodies (described in Fig. 1) were obtained following the conventional protocols after immunization of the mice with a soluble form of OSMR and by fusing the splenocytes with the SP2/o myeloma. Serum Samples—Sera from healthy humans were obtained from informed volunteers, and the sera of multiple myeloma-suffering patients were obtained from people who gave their informed consent in agreement with French legislation. ELISA Detection—For the detection of the soluble forms of OSMR and gp130, the AN-A2 (anti-OSMR) or AN-G73 (anti-gp130) mAbs were coated at a concentration of 10 μg/ml in 50 mm carbonate buffer, pH 9.6. After washes and a Tris 0.1 m sucrose 20% saturation step, the samples were incubated overnight at 4 °C. The detection was performed using 1 μg/ml AN-V2 (anti-OSMR) or AN-G40 (anti-gp130) biotinylated mAbs in phosphate-buffered saline, bovine serum albumin, 0.1% Tween 0.01% followed by a streptavidin peroxidase step. Visualization was performed using 2,2′-azino-bis(3)-bnz-thialozine-6 sulfonic acid as substrate and the reading performed at 405. Cloning of sOSMR Spliced Form—Total RNAs from WRL68 hepatoma cell line were extracted by the TRIzol method according to the manufacturer's instructions (Invitrogen). cDNA was amplified with the Advantage polymerase (Clontech, Palo Alto, CA) using 10 nm OSMR sense primer CGGCCTGCCTACCTGAAAAC and an oligo(dT) primer (Invitrogen). PCR products were cloned in the pGEMT vector (Promega), and the sequencing was performed using an automatic DNA sequencer (Beckman Coulter). To express the recombinant sOSMR, the 3′-end of the cDNA was replaced by a V5-His tag and subcloned in the pcDNA3.1D/TOPO-V5-His mammalian expression vector (Invitrogen). Protein Expression and Purification—The human embryonic kidney 293 cell line was stably transfected with sOSMR-V5-His pcDNA3.1D/TOPO plasmid using the Exgen transfection reagent (Euromedex, Souffelweyersheim, France). Cell supernatants were submitted to an anion exchange column (Amersham Biosciences) before an affinity purification step using Ni2+-Sepharose column chromatography (Amersham Biosciences). Purified fractions were desalted by size exclusion before being submitted to SDS-PAGE silver staining and Western blotting analyses. The OSMR-Fc was a fusion protein made of the extracellular part of the membrane receptor coupled to the Fc portion of human IgG1 (34Diveu C. Lak-Hal A.H. Froger J. Ravon E. Grimaud L. Barbier F. Hermann J. Gascan H. Chevalier S. Eur. Cytokine. Netw. 2004; 15: 291-302PubMed Google Scholar). In Figs. 8B and 9E a fusion protein consisting of the first 428 residues of sOSMR fused to a 40-residue linker and to the Ig domain of gp130 (amino acids 767–817) was used. The Fc and fusion proteins were expressed in COS and human embryonic kidney 293 cell lines, respectively. The culture supernatants were collected and loaded either on a protein A-Sepharose or on a Ni2+-Sepharose column and the recombinant proteins eluted. Purity and protein determination analyses were carried out by SDS-PAGE and by silver staining.FIGURE 9sOSMR associated to sgp130 neutralizes OSM-induced proliferation of OSMR type I- or type II-expressing BA/F3 cell lines. Proliferative response of BA/F3 cells transfected with type II (gp130/OSMR) (A) or with type I (gp130/LIFR) (B) receptors to OSM. Cells were cultured in triplicate with 3-fold dilutions of indicated cytokines. C and D, type II and type I receptor-transfected BA/F3 cells were cultured in the presence of 0.6 ng/ml OSM, 1.5 μg/ml sgp130, and 1.5 μg/ml sOSMR as indicated. E, 100 ng/ml OSMR-L-gp130 fused protein and 0.1 ng/ml OSM (in black) or 0.1 ng/ml LIF (in gray) were added to type I and type II receptor-expressing BA/F3 cells. After 48 h of culture, a [3H] thymidine pulse was carried out and the incorporated radioactivity determined.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Reverse Transcription PCR Analyses—cDNAs were synthesized from 2 μg of total RNA by random hexamer primers using Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI). Reverse transcription products were subsequently amplified by 35 cycles of PCR using the primers for sOSMR (sense TCTGGGGAAAAGAAACTTTGTAC, antisense TAAGCAGGGTTCTTACTTGC), by 25 cycles of PCR using the primers for OSMR (sense TCTGGGGAAAAGAAACTTTGTAC, antisense GTACTCGCGCCATGTACTCT), and by 20 cycles of PCR using the primers for GAPDH (sense ACCACAGTCCATGCCATCAC, antisense TCCACCACCCTGTTGCTGTA). Amplified products were analyzed by 2% agarose gel electrophoresis. Real-time Quantitative PCR—Quantitative real-time PCR was carried out using the LightCycler-FastStart DNA MasterPLUS SYBR Green I kit (Roche Diagnostics). The cDNA tissue samples were obtained from Clontech. The reaction components were 1× FastStart DNA MasterPLUS SYBR Green I and 5 nm of the forward and reverse primers for sOSMR (forward CCTTTTTAACCTGACTCATCG, reverse AGCAGGGTTCTTACTTGCAT), for OSMR (forward AGATTGAACTCCATGGTGAA, reverse GCTTCAAGTGTGGTGAAGTT), and for GAPDH (forward GAAGGTGAAGGTCGGAGTC, reverse GAAGATGGTGATGGGATTTC). Data analysis was performed as indicated by Roche using the "Fit Point Method" in the Light Cycler software 3.3 (Roche Diagnostics). Quantification was made using GAPDH as a housekeeping gene. Immunoprecipitation and Western Blotting Experiments— Cytokines and soluble receptors were preincubated at a final concentration of 5 nm each for 2 h at 37°C before being added to the cells for 10 min. Cells were lysed in SDS sample buffer, sonicated, submitted to SDS-PAGE, and transferred onto an Immobilon membrane. The membranes were subsequently incubated overnight with the primary antibody before being incubated with the appropriate peroxidase-labeled secondary antibody for 1 h. The reaction was visualized by ECL detection according to the manufacturer's instructions (Amersham Biosciences). Membranes were stripped in 0.1 m glycine, pH 2.8, for 2 h before reblotting. For the co-precipitation experiments, the cytokines were incubated at a concentration of 5 nm in the presence of the same concentration of soluble receptors. After an overnight contact, the proteins were precipitated using Ni2+ beads and analyzed by Western blotting as described above. Endoglycosidase Treatment—The sOSMR receptor was diluted in 1% Brij 96 lysis buffer and treated with 25 units/ml of N-glycosidase-F (Roche) for 12 h at 37 °C before Western blotting analysis. Proliferation Assays—Ba/F3 cell lines transfected with the appropriate cDNA receptors were seeded in 96-well plates at a concentration of 5 × 103 cells/well in RPMI 5% fetal calf serum (39Kallen K.J. Grotzinger J. Lelievre E. Vollmer P. Aasland D. Renne C. Myer zum Mullberg J. Buschenfelde K.H. Gascan H. Rose-John S. J. Biol. Chem. 1999; 274: 11859-11867Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Serial dilutions of tested cytokines or soluble receptors were performed in triplicate. After a 48-h incubation period, 0.5 μCi of [3H]thymidine was added to each well for the last 4 h of the culture and the incorporated radioactivity determined by scintillation counting (Packard Topcount luminometer, Meriden, CT). Flow Cytometry Analysis—Cells were incubated for 30 min at 4 °C with the AN-N2 anti-OSMR antibody or an isotype control antibody (IgG1) (10 μg/ml) before an incubation step with a phycoerythrin-conjugated anti-mouse antibody. Fluorescence was subsequently analyzed on a FACScalibur flow cytometer from BD Biosciences. Detection of a Soluble Form of OSMR by ELISA—Eighteen monoclonal antibodies recognizing the soluble OSMR part of an Fc fusion protein were generated and characterized. Each of them was tested in pairs to develop a sandwich ELISA (Fig. 1A). We selected the AN-A2 anti-OSMR mAb as a coating antibody and the AN-V2 anti-OSMR mAb as a tracer antibody. The ELISA allowed the detection of 2.5 ng/ml recombinant soluble OSMR (Fig. 1B) and did not react with any other related soluble receptors (LIFR, gp130, CNTFR, CLF, IL-6R) or irrelevant receptors (soluble Drosophila Toll, soluble human IL-4R) (Fig. 1C). Moreover, addition of OSM to the samples did not interfere with the detection of soluble OSMR in the developed ELISA. We next looked for a native form of sOSMR by screening culture supernatant from different cell lines. All the tested glioblastoma, hepatoma, and melanoma cell lines secreted high amounts of a soluble form of OSMR with concentrations ranging from 5 to 50 ng/106 cells (Fig. 2). In contrast, we could not observe the secretion of sOSMR in neuroblastoma-, choriocarcinoma-, and lymphocyte-derived cell lines. In addition, high levels of sgp130 were detected in the cell lines secreting sOSMR. We also looked for sOSMR in sera from healthy individuals and from patients suffering from multiple myeloma, a pathology known to induce increased levels of circulating soluble cytokine receptors (41Lauta V.M. Cancer. 2003; 97: 2440-2452Crossref PubMed Scopus (205) Google Scholar). An average value of 77 ng/ml circulating sOSMR was measured in normal situations that reached a concentration of 288 ng/ml in multiple myeloma patients (Fig. 3). These results revealed the existence of a circulating form of OSMR that can be positively modulated in pathologic situations. Molecular Cloning and Expression of a Soluble OSMR Splice Variant—The cloning of a soluble form of OSMR was carried out by reverse transcription PCR starting from the WRL68 hepatoma cell line. A 1185-bp cDNA was isolated and encoded a truncated soluble form of OSMR of 394 amino acids diverging from the membrane form of OSMR by 16 amino acids encoded at the end of exon 8 (Fig. 4, A–C). The soluble receptor sequence included an N-terminal potential hydrophobic signal peptide (exons 1 and 2), a half CBD containing a WSXWS motif (exons 3 and 4) followed by an Ig-like domain (exon 5), and then a half CBD presenting four conserved cysteine residues in fixed position (exons 6 to 7). Soluble OSMR Tissue Distribution—Tissue distribution was analyzed by real-time quantitative RT-PCR using poly(A)+ RNA from different human tissues. Two pairs of primers were used, one specifically detecting the soluble form of receptor and the second one only amplifying the membrane form of OSMR. The specificity of amplified products was controlled on a large panel of cell lines and tissues, and in each case a single band corresponding to the expected molecular weight was observed on gels (data not shown). The soluble form of OSMR was expressed in pancreas, lung, liver, and placenta and weakly in skeletal muscle (Fig. 5). With the exception of heart, preferentially expressing the membrane receptor, the distribution of both forms of OSM receptors was similar in the tested tissues. Soluble OSMR Expression and Binding of OSM to sgp130-sOSMR Complex—The sOSMR was expressed as a tagged protein (V5-histidine tags) and purified by affinity from culture supernatants of stably transfected cells (Fig. 6A). SDS-PAGE gels and Western blotting analyses of the purified fraction evidenced a 75-kDa polypeptide, corresponding, after subtracting the tag molecular mass, to a mature protein of 70 kDa. Deglycosylation experiments were carried out using the N-glycosidase-F. A shift of 25 kDa was observed in agreement with the predicted occupation of 10 N-glycosylation sites (Fig. 6B). We next studied interaction between the OSM, sOSMR, and sgp130 (Fig. 7). The soluble receptors were added to OSM or LIF, and the tagged sOSMR was precipitated using Ni2+ beads. The samples were assayed by Western blotting using an anti-OSM antibody to detect its association to sOSMR. The experiments show that OSM specifically recognized sOSMR, with a slight increase of the binding in the presence of sgp130. Soluble OSMR Neutralizes STAT3 Signaling—We tested the possibility for sOSMR to behave as an antagonist for its ligands. Experiments were carried out using the GO-G-UVM and T98G glioblastoma and A375 melanoma cell lines previously reported to be responsive to OSM (Fig. 8A) (1Zarling J.M. Shoyab M. Marquardt H. Hanson M.B. Lioubin M.N. Todaro G.J. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 9739-9743Crossref PubMed Scopus (362) Google Scholar, 28Friedrich M. Hoss N. Stogbauer F. Senner V. Paulus W. Ringelstein E.B. Halfter H. J. Neurochem. 2001; 76: 1589-1592Crossref PubMed Scopus (20) Google Scholar). Treatment of the cells with OSM plus sgp130 showed a very slight or no decrease in STAT3 phosphorylation compared with the signal observed in the presence of OSM alone, in agreement with the published studies (42Sporeno E. Paonessa G. Salvati A.L. Graziani R. Delmastro P. Ciliberto G. Toniatti C. J. Biol. Chem. 1994; 269: 10991-10995Abstract Full Text PDF PubMed Google Scholar). Importantly, the combined addition of both soluble receptors induced a marked decrease of STAT3 phosphorylation in the studied cell lines. This was not observed in the presence of LIF or IL-6, used as controls (Fig. 8B). Recent studies have demonstrated the OSMR involvement, together with Gp130-like receptor (GPL), also known as IL-31R, in the formation of a functional IL-31 receptor complex (32Dillon S.R. Sprecher C. Hammond A. Bilsborough J. Rosenfeld-Franklin M. Presnell S.R. Haugen H.S. Maurer M. Harder B. Johnston J. Bort S. Mudri S. Kuijper J.L. Bukowski T. Shea P. Dong D.L. Dasovich M. Grant F.J. Lockwood L. Levin S.D. LeCiel C. Waggie K. Day H. Topouzis S. Kramer J. Kuestner R. Chen Z. Foster D. Parrish-Novak J. Gross J.A. Nat. Immunol. 2004; 5: 752-760Crossref PubMed Scopus (721) Google Scholar, 34Diveu C. Lak-Hal A.H. Froger J. Ravon E. Grimaud L. Barbier F. Hermann J. Gascan H. Chevalier S. Eur. Cytokine. Netw. 2004; 15: 291-302PubMed Google Scholar). We tested the possibility for sOSMR to also neutralize an IL-31 response in the T98G glioblastoma cell line (Fig. 8C). Similarly to that observed for OSM, a decrease in STAT3 recruitment by IL-31 was observed when simultaneously adding sOSMR and soluble GPL/IL-31R to the cells. Altogether, these results indicate that a combination of truncated OSMR and gp130, or GPL/IL-31R, could trap and neutralize OSM and IL-31 responses, respectively. Soluble OSMR Combined with Soluble gp130 Neutralizes Both Type I and Type II OSM Receptors—In the next experiment, murine IL-3-dependent BA/F3 cells engineered to specifically express type I (gp130/LIFR) or type II (GP130/OSMR) OSM receptors on their surface were used (39Kallen K.J. Grotzinger J. Lelievre E. Vollmer P. Aasland D. Renne C. Myer zum Mullberg J. Buschenfelde K.H. Gascan H. Rose-John S. J. Biol. Chem. 1999; 274: 11859-11867Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar). Both cell lines proliferated in a similar manner with the addition of OSM to the cultures (Fig. 9, A and B). A 50% inhibition of the signal was measured when sOSMR and sgp130 were added together to the type I or type II OSM receptor-expressing BAF/3 cell cultures (Fig. 9, C and D). In contrast, no induced inhibition could be detected when type I receptor-expressing cells were grown in the presence of LIF (Fig. 9E). These experiments show that the interaction between OSM and sOSMR/sgp130 was sufficient to lower the functional signals mediated by either type I or type II OSM receptors. OSM Up-regulates Its Own Soluble Receptor—We studied the possibility of tumor cells modulating their sOSMR expression in response to OSM. Experiments were carried out using the A375 melanoma cell line and three glioblastoma cell lines. The expression levels of soluble and membrane forms of OSMR were first determined by reverse transcription PCR (Fig. 10A). A clear induction of the RNA coding for the soluble form of receptor was observed when treating A375, GO-G-UVM, and U87MG cells with OSM. Importantly, no variation in the expression level of the membrane form of the receptor could be evidenced in any

Referência(s)