Oxidative Activity of the Type 2 Isozyme of 17β-Hydroxysteroid Dehydrogenase (17β-HSD) Predominates in Human Sebaceous Glands
1998; Elsevier BV; Volume: 111; Issue: 3 Linguagem: Inglês
10.1046/j.1523-1747.1998.00322.x
ISSN1523-1747
AutoresDiane Thiboutot, P.J. Martin, Lazaros Volikos, K. Gilliland,
Tópico(s)Acne and Rosacea Treatments and Effects
ResumoSebum production is regulated by the opposing effects of androgens and estrogens. The intracrine activity of steroid metabolizing enzymes is important in regulating sebum production because these enzymes can convert weak steroids from the serum into potent androgens and estrogens within the sebaceous gland (SG). 17β-hydroxysteroid dehydrogenase (17β-HSD) interconverts weak and potent sex steroids via redox reactions. In this regard, it may function as a gatekeeping enzyme regulating the hormonal milieu of the SG. Six isozymes of 17β-HSD have been identified that differ in their substrate preference and their preference to produce weak or potent sex steroids via oxidation or reduction, respectively. The goals of this study are: (i) to identify which isozyme (s) of 17β-HSD is active in SG; (ii) to determine if its activity differs in facial skin compared with nonacne-prone skin that may account for the regional differences in sebum production; (iii) to compare the activity of 17β-HSD in intact glands and in SG homogenates; and (iv) to determine if 13-cis retinoic acid inhibits 17β-HSD activity. Human SG were assayed for 17β-HSD activity using estrogens, androgens, and progestins as substrates. Oxidative activity of the type 2 isozyme predominated in all samples tested. Although transcripts for the types 1, 2, 3, and 4 isozymes were detected using reverse transcriptase-polymerase chain reaction, only mRNA for the predominant type 2 isozyme and the type 4 isozyme were detected in northern analysis. Greater reductive activity of 17β-HSD was noted in SG from facial areas compared with nonacne-prone areas, suggesting an increased net production of potent androgens in facial areas. Oxidation was more predominant over reduction in intact SG compared with homogenized SG, thus supporting the hypothesis that 17β-HSD protects against the effects of potent androgens in vivo. Activity of the type 2 17β-HSD was not inhibited by 13-cis retinoic acid. In conclusion, SG possess the cellular machinery needed to transcribe the genes for the type 1–4 isozymes of 17β-HSD. At the protein level, however, oxidative activity of the type 2 isozyme predominates, suggesting that 17β-HSD isozyme activity may be translationally regulated. Sebum production is regulated by the opposing effects of androgens and estrogens. The intracrine activity of steroid metabolizing enzymes is important in regulating sebum production because these enzymes can convert weak steroids from the serum into potent androgens and estrogens within the sebaceous gland (SG). 17β-hydroxysteroid dehydrogenase (17β-HSD) interconverts weak and potent sex steroids via redox reactions. In this regard, it may function as a gatekeeping enzyme regulating the hormonal milieu of the SG. Six isozymes of 17β-HSD have been identified that differ in their substrate preference and their preference to produce weak or potent sex steroids via oxidation or reduction, respectively. The goals of this study are: (i) to identify which isozyme (s) of 17β-HSD is active in SG; (ii) to determine if its activity differs in facial skin compared with nonacne-prone skin that may account for the regional differences in sebum production; (iii) to compare the activity of 17β-HSD in intact glands and in SG homogenates; and (iv) to determine if 13-cis retinoic acid inhibits 17β-HSD activity. Human SG were assayed for 17β-HSD activity using estrogens, androgens, and progestins as substrates. Oxidative activity of the type 2 isozyme predominated in all samples tested. Although transcripts for the types 1, 2, 3, and 4 isozymes were detected using reverse transcriptase-polymerase chain reaction, only mRNA for the predominant type 2 isozyme and the type 4 isozyme were detected in northern analysis. Greater reductive activity of 17β-HSD was noted in SG from facial areas compared with nonacne-prone areas, suggesting an increased net production of potent androgens in facial areas. Oxidation was more predominant over reduction in intact SG compared with homogenized SG, thus supporting the hypothesis that 17β-HSD protects against the effects of potent androgens in vivo. Activity of the type 2 17β-HSD was not inhibited by 13-cis retinoic acid. In conclusion, SG possess the cellular machinery needed to transcribe the genes for the type 1–4 isozymes of 17β-HSD. At the protein level, however, oxidative activity of the type 2 isozyme predominates, suggesting that 17β-HSD isozyme activity may be translationally regulated. oxidationreduction ratio 17β-hydroxysteroid dehydrogenase sebaceous gland 13-cis retinoic acid Sebum production is a key factor in the development of acne. Potent androgens (C-19 steroids) such as testosterone and dihydrotestosterone stimulate sebum production whereas clinical doses of estrogen (C-18 steroids) may inhibit its production (Pochi and Strauss, 1976Pochi P. Strauss J. Sebaceous gland inhibition from combined glucocorticoid-estrogen treatment.Arch Dermatol. 1976; 112: 1108Crossref PubMed Scopus (27) Google Scholar). The local (or intracrine) metabolism of sex steroids plays a critical role in establishing the balance between androgens and estrogens in the sebaceous gland (SG). At the time of adrenarche, the systemic circulation provides an abundant reservoir of biologically weak steroids including dehydroepiandrosterone sulfate, androstenedione, and estrone. These precursors can be converted into potent C-19 and C-18 steroids within the SG through the action of steroid metabolizing enzymes present in SG (Hay and Hodgins, 1974Hay J.B. Hodgins M.B. Metabolism of androgens by human skin in acne.Br J Dermatol. 1974; 91: 123-133Crossref PubMed Scopus (61) Google Scholar;Itami and Takayasu, 1981Itami S. Takayasu S. Activity of 17β-hydroxysteroid dehydrogenase in various tissues of human skin.Br J Dermatol. 1981; 105: 693-699Crossref PubMed Scopus (13) Google Scholar;Simpson et al., 1983Simpson N.B. Cunliffe W.J. Hodgins M.B. The relationship between the in vitro activity of 3β-hydroxysteroid dehydrogenase Δ4−5 isomerase in human sebaceous glands and their secretory activity in vivo.J Invest Dermatol. 1983; 81: 139-144Abstract Full Text PDF PubMed Scopus (43) Google Scholar;Sawaya et al., 1988Sawaya M.E. Honig J.L.S. Garland L.D. Hsia S.L. Δ5–3β-Hydroxysteroid dehydrogenase activity in sebaceous glands of scalp in male-pattern baldness.J Invest Dermatol. 1988; 91: 101-105Abstract Full Text PDF PubMed Google Scholar). Because 17β-hydroxysteroid dehydrogenase (17β-HSD) catalyzes both the formation of testosterone and estradiol (via reduction) and the backconversion of these hormones to less active precursors (via oxidation), its activity may regulate the local availability of potent sex steroids in the SG and other endocrine target tissues. In addition to classical biochemical regulation of steroid metabolizing enzymes (such as pH, availability of substrate and pyridine nucleotide cofactors, etc.), regulation also exists through the tissue specific expression of various isozymes of steroid metabolizing enzymes and even by the action of tissue specific promoters (Simpson et al., 1997Simpson E. Michael M. Agarwal V. Hinshelwood M. Bulun S. Zhao Y. Cytochromes P450, 11: expression of the CYP19 (aromatase) gene: an unusual case of alternative promoter usage.Faseb J. 1997; 11: 29-36Crossref PubMed Scopus (177) Google Scholar) Six isozymes of 17β-HSD have been identified that differ in their preference for substrate (androgens, estrogens, or progestins), pH optima, cofactor specificity, and tissue localization (Luu-The et al., 1989Luu-The V. Labrie C. Zhao H. et al.Characterization of cDNAs for human estradiol 17β-dehydrogenase and assignment of the gene to chromosome 17: Evidence of two mRNA species with distinct 5′-termini in human placenta.Mol Endocrinol. 1989; 3: 1301-1309Crossref PubMed Scopus (269) Google Scholar;Adamski et al., 1995Adamski J. Normand T. Leenders F. et al.Molecular cloning of a novel widely expressed human 80 kDa 17β-hydroxysteroid dehydrogenase IV.Biochem J. 1995; 311: 437-443Crossref PubMed Scopus (210) Google Scholar;Andersson and Moghrabi, 1997Andersson S. Moghrabi N. Physiology and molecular genetics of 17β-hydroxysteroid dehydrogenases.Steroids. 1997; 62: 143-147Crossref PubMed Scopus (128) Google Scholar;Biswas and Russell, 1997Biswas M.G. Russell D.W. Expression cloning and characterization of oxidative 17β- and 3α-hydroxysteroid dehydrogenases from rat and human prostate.J Bio Chem. 1997; 272: 15959-15966Crossref PubMed Scopus (208) Google Scholar). Each isozyme is the product of a unique gene. There is less than 28% sequence homology among the six isozymes. The type 1 isozyme of 17β-HSD preferentially reduces estrone to estradiol using NADPH as a cofactor. It is the predominant isozyme responsible for estrogen production in the ovary and breast. The type 2 isozyme preferentially oxidizes potent C-19 and C-18 steroids to weaker androgens and estrogens at alkaline pH using NAD as a cofactor. It has been localized to the breast, placenta, ovary, prostate, pancreas, and other tissues. The type 3 isozyme, localized in testis, preferentially reduces androstenedione to testosterone using NADH or NADPH as a cofactor. The type 4 isozyme oxidizes estradiol to estrone but does not oxidize testosterone, and is a peroxisomal enzyme found in a wide variety of tissues. The type 5 isozyme of 17β-HSD has been sequenced in mice (Deyashiki et al., 1995Deyashiki Y. Ohshima K. Nakanishi M. Sato K. Matsuura K. Hara A. Molecular cloning and characterization of mouse estradiol 17β-dehydrogenase (A-specific), a member of the aldoketoreductase family.J Biol Chem. 1995; 270: 10461-10467Crossref PubMed Scopus (107) Google Scholar), and is an aldoketoreductase that preferentially reduces androgens and estrogens using NADPH as a cofactor (Labrie et al., 1997Labrie F. Luu-The V. Lin S.-X. Labrie C. Simard J. Breton R. Belanger A. The key role of 17β-hydroxysteroid dehydrogenases in sex steroid biology.Steroids. 1997; 62: 148-158Crossref PubMed Scopus (408) Google Scholar). A cDNA encoding a type 6 isozyme was isolated from rat ventral prostate (Biswas and Russell, 1997Biswas M.G. Russell D.W. Expression cloning and characterization of oxidative 17β- and 3α-hydroxysteroid dehydrogenases from rat and human prostate.J Bio Chem. 1997; 272: 15959-15966Crossref PubMed Scopus (208) Google Scholar), and shares 65% sequence identity with the retinol dehydrogenase 1 enzyme. It preferentially oxidizes 3α-androstanediol to androsterone using NAD+ as a cofactor and oxidizes testosterone and estradiol. In assaying 5α-reductase activity in human SG, increased backconversion of testosterone to androstenedione was noted with increasing pH, indicating activity of 17β-HSD (Thiboutot et al., 1995Thiboutot D. Harris G. Iles V. Cimis G. Gilliland K. Hagari S. Activity of the type 1, 5α-reductase exhibits regional differences in isolated sebaceous glands and whole skin.J Invest Dermatol. 1995; 105: 209-214Crossref PubMed Scopus (202) Google Scholar). At the same time, tissue specific expression of 17β-HSD isozymes was being described. The goals of this study were to identify which isozyme (s) of 17β-HSD is active in human SG using biochemical parameters, northern analysis, and the reverse transcriptase-polymerase chain reaction (RT-PCR), and to determine if there are differences in its activity in acne-prone regions compared with nonacne-prone regions. In addition, the ratio of oxidative to reductive activity (OX/RED ratio) of 17β-HSD has been reported to be greater in intact cells compared with homogenized cells (Luu-The et al., 1995Luu-The V. Ahang Y. Poirer Labrie F. Characteristics of human types 1, 2 and 3 17beta;–hydroxysteroid dehydrogenase activities: oxidation/reduction and inhibition.J Steroid Biochem Mol Biol. 1995; 55: 581-587Crossref PubMed Scopus (212) Google Scholar;Castagnetta et al., 1996Castagnetta L.A. Granata O.M. Taibi G. et al.17β-hydroxysteroid oxidoreductase activity in intact cells significantly differs from classical enzymology analysis.J Endocrinol. 1996; 150: S73-S78Google Scholar;Carruba et al., 1997Carruba G. Adamski J. Calabro M. et al.Molecular expression of 17β-hydroxysteroid dehydrogenase types in relation to their activity in intact human prostate cancer cells.Molec Cell Endocrinol. 1997; 131: 51-57Crossref Scopus (16) Google Scholar). The OX/RED ratio obtained in intact glands may be more representative of the in vivo situation. For this reason, the biochemical profile of 17β-HSD was compared in intact and homogenized SG. Furthermore, it has been hypothesized that 13-cis retinoic acid (13-cis RA), the most potent inhibitor of sebum production, acts in part by inhibiting steroid metabolizing enzymes (Boudou et al., 1995Boudou P. Soliman H. Chivot M. Villette J. Vexiau P. Belanger A. Fiet J. Effect of oral isotretinoin treatment on skin androgen receptor levels in male acneic patients.J Clin Endocrinol Metab. 1995; 80: 1158-1161Crossref PubMed Google Scholar). Activity of the rat type 6 isozyme of 17β-HSD is inhibited by 13-cis RA in transfected human kidney cells (Biswas and Russell, 1997Biswas M.G. Russell D.W. Expression cloning and characterization of oxidative 17β- and 3α-hydroxysteroid dehydrogenases from rat and human prostate.J Bio Chem. 1997; 272: 15959-15966Crossref PubMed Scopus (208) Google Scholar). These data provided a rationale for examining the effects of 13-cis RA on 17β-HSD activity in SG. Alteration of the activity of the isozymes of steroid metabolizing enzymes such as 17β-HSD may represent novel strategies in the treatment of hormonally regulated skin diseases such as acne, hirsutism, or male pattern hair loss. Samples of normal skin were obtained from routine surgeries performed in the Division of Dermatology at The Pennsylvania State University's Hershey Medical Center under a protocol approved by the Institutional Review Board. Subjects ages ranged from 35 to 85 y of age, with a mean age of 68 y. Samples were transported and SG were dissected as previously described (Thiboutot et al., 1995Thiboutot D. Harris G. Iles V. Cimis G. Gilliland K. Hagari S. Activity of the type 1, 5α-reductase exhibits regional differences in isolated sebaceous glands and whole skin.J Invest Dermatol. 1995; 105: 209-214Crossref PubMed Scopus (202) Google Scholar). Incubation studies with radiolabeled steroid substrate were performed on homogenized SG and intact SG isolated from facial and nonfacial areas in order to determine the specific activity of 17β-HSD. Homogenates of SG were prepared and protein content determined as previously described (Thiboutot et al., 1995Thiboutot D. Harris G. Iles V. Cimis G. Gilliland K. Hagari S. Activity of the type 1, 5α-reductase exhibits regional differences in isolated sebaceous glands and whole skin.J Invest Dermatol. 1995; 105: 209-214Crossref PubMed Scopus (202) Google Scholar). The incubation cocktail consisted of 106 dpm of radiolabeled steroid substrate ([1,2–3H]testosterone, [1,2,6,7–3H]androstenedione, [6,7–3H]estradiol, [6,7–3H]estrone, [1,2–3H]progesterone, or [1,2–3H]20α-hydroxyprogesterone; Dupont NEN, Wilmington, DE or Amersham, Arlington Heights, IL) in the presence of 1–10 μM nonradioactive substrate, 500 μM NADPH, NADP, NADH, or NAD (Sigma, St. Louis, MO), 1 mM dithiothreitol (Sigma), 40–80 μg of homogenate protein in a final volume of 0.2 ml of succinic acid/imidazole/diethanolamine buffer with pH adjusted depending on the study being performed. All steroids were purified using thin layer chromatography prior to use. Unless stated otherwise, reactions were performed at pH 7. In all experiments, each sample was assayed in duplicate and a negative control, consisting of all components of the incubation cocktail except for the SG sample, was assayed under identical conditions. Each reaction was carried out at 37°C for 60 min. The reactions in homogenates were terminated by the addition of 1 ml of cyclohexane/ethyl acetate (70:30, vol/vol) containing nonradioactive carrier steroids. In studies of intact glands, the reactions were terminated by removing the glands from the wells. Samples were extracted twice with chloroform/ethyl acetate (70:30) and the pooled extracts evaporated under nitrogen. The extracts were dissolved in ethyl acetate (androgens and progestins) or ethanol (estrogens) prior to chromatographic separation. Steroids were separated by thin layer chromatography and enzyme activities were calculated (Thiboutot et al., 1995Thiboutot D. Harris G. Iles V. Cimis G. Gilliland K. Hagari S. Activity of the type 1, 5α-reductase exhibits regional differences in isolated sebaceous glands and whole skin.J Invest Dermatol. 1995; 105: 209-214Crossref PubMed Scopus (202) Google Scholar). The solvent system used for separating testosterone from androstenedione and progesterone from 20α-hydroxyprogesterone was chloroform/methanol (99:1, vol/vol), whereas estrone and estradiol were separated using chloroform/acetone (9:1, vol/vol). Preliminary experiments to determine the optimal incubation time and linearity of 17β-HSD activity with SG enzyme protein concentration were performed. SG homogenates from female breast skin were incubated at pH 7 for 10, 60, and 120 min to determine the optimal incubation time for this assay. Androgens were used as substrates. These data were used to determine the time course of the oxidative and reductive activity of 17β-HSD. Incubation studies with varying quantities of SG homogenate protein (42–340 μg) were performed in order to demonstrate that the formation of product (androstenedione) was linear with the amount of enzyme used. In order to determine which isozyme(s) of 17β-HSD predominates in SG, a series of experiments was performed to demonstrate the enzyme's pH optima, cofactor dependence, preference for substrate, and predominant reaction type (oxidation or reduction). SG homogenates from breast tissue were incubated at pH 5–12 in order to demonstrate the pH profile of the oxidative and reductive activity of 17β-HSD using both C-19 and C-18 steroids as substrates. The dependence of 17β-HSD activity on the presence of cofactor [500 μM NAD, NADP, NADH, or NADPH (Sigma)] was demonstrated in incubation studies using C-19 as substrates in homogenized SG from the breast, nose, forehead, and abdomen. Studies to determine the substrate preference of 17β-HSD were performed in SG homogenates and in intact SG from a variety of anatomic areas. Approximately 70 to 80 SG were freshly isolated from skin from each of seven subjects. For each subject, SG were placed in groups of six into wells of a 24 well cell culture plate for a total of 12 groups of glands for each subject. Duplicate groups of glands were assayed for 17β-HSD activity with one of the following six substrates: testosterone, androstenedione, estradiol, estrone, progesterone, or 20α-hydroxyprogesterone (Sigma). Each group of glands was incubated with 106 dpm of radiolabeled substrate (as above) and 1 μM of nonradioactive substrate in the buffer system described above. No exogenous cofactors were added. Each group of intact SG was homogenized after the incubation and the protein content determined. In all experiments of intact glands, both the oxidative and the reductive activity of 17β-HSD was determined and the OX/RED ratio was calculated. Comparison was made between the ratio obtained in intact SG and in SG homogenates using a paired t test (α = 0.05). To determine if 13-cis RA inhibits activity of 17β-HSD in human SG, enzyme assay solutions from breast SG were supplemented with dilutions of 13-cis RA (Sigma) in ethanol to achieve final concentrations ranging from 0 to 100 μM. Retinoids were handled under dimmed yellow light. The final concentration of ethanol in each assay was less than 0.5%, a concentration shown not to affect enzyme activity. Testosterone (10 μM) was used as a substrate and the incubation was carried out for 60 min as above. Biochemical data suggested that the type 2 isozyme predominated in SG. Northern analysis was performed in order to confirm these data and to determine if messenger RNA from any of the other isozymes could be detected in human SG. Two hundred and fifty SG isolated from eight subjects were pooled, snap frozen in liquid nitrogen, and stored at –80°C. RNA from these glands and from homogenates of control tissues (breast parenchyma, prostate, and placenta) was isolated (Chomczynski Sacchi, 1987Chomczynski Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem. 1987; 162: 156-159Google Scholar). Twenty micrograms of total RNA from each sample were electrophoresed on a 1% agarose gel and transferred to a nylon membrane. A riboprobe complementary to the type 1 17β-HSD was generated from the full-length cDNA provided by Dr. Van Luu-The (Laval University, Quebec City). Inserts corresponding to the full-length transcripts for the types 2 and 3 17β-HSD were cut from the pCMV6 plasmids provided by Dr. Stefan Andersson (South-western Texas University, Dallas, TX). These were labeled with 23P dCTP by random priming (Feinberg and Vogelstein, 1983Feinberg A. Vogelstein B. A technique for radiolabeling DNA restrictionendonuclease fragments to high specific activity.Anal Biochem. 1983; 132: 6-13Crossref PubMed Scopus (16405) Google Scholar;Feinberg and Vogelstein, 1984Feinberg A. Vogelstein B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity.Addendum Anal Biochem. 1984; 137: 266-267Crossref PubMed Scopus (5091) Google Scholar). A probe for the type 4 isozyme of 17β-HSD was generated by random priming from the cDNA provided by Dr. Jerzy Adamski (GSF National Research Center, Neuherberg, Germany). The nylon membrane was hybridized with probe for 24 h at 42°C, washed under low and high stringency conditions, and exposed to X-ray film (Sambrook et al., 1989Sambrook J. Fritsch E. Maniatis T. Molecular Cloning: a Laboratory Manual. Harbor Press, Cold Spring Harbor, Cold Spring1989Google Scholar). After each use, the membrane was stripped of radioactive probe and this procedure was verified by exposure to X-ray film before hybridizing to the next probe. The membrane was hybridized with a radiolabeled probe for 18S RNA to assure equal loading of RNA samples. The following primers were chosen for each of the four isozymes of 17β-HSD from published sequences (Luu-The et al., 1989Luu-The V. Labrie C. Zhao H. et al.Characterization of cDNAs for human estradiol 17β-dehydrogenase and assignment of the gene to chromosome 17: Evidence of two mRNA species with distinct 5′-termini in human placenta.Mol Endocrinol. 1989; 3: 1301-1309Crossref PubMed Scopus (269) Google Scholar;Wu et al., 1993Wu L. Einstein M. Geissler W. Chan H.K. Elliston K.O. Andersson S. Expression cloning and characterization of human 17β-hydroxysteroid dehydrogenase type 2, a microsomal enzyme possessing 20α-hydroxysteroid dehydrogenase activity.J Biol Chem. 1993; 268: 12964-12969Abstract Full Text PDF PubMed Google Scholar;Geissler et al., 1994Geissler W.M. Davis D.L. Wu L. et al.Male pseudehermaphroditism caused by mutations of testicular 17β-hydroxysteroid dehydrogenase 3.Nature Genet. 1994; 7: 34-39Crossref PubMed Scopus (496) Google Scholar;Adamski et al., 1995Adamski J. Normand T. Leenders F. et al.Molecular cloning of a novel widely expressed human 80 kDa 17β-hydroxysteroid dehydrogenase IV.Biochem J. 1995; 311: 437-443Crossref PubMed Scopus (210) Google Scholar): type 1 (Genbank #X13440)FP: 5′CTACCAATACCTCGCCCACA; type 1 RP:5′GGTGAAGTAGCGCAGGGTCG; type 2 (Genbank #L1708) FP: 5′AAGGCTGGCATCTTATGGCT; type 2 RP 5′TTCCCACTTGTCACTGGTGCCTGCGAT-ATT; type 3 (Genbank #U05659) FP: 5′ATCCATTGTAACATCACCTC, type 3 RP 5′GGATGATGACTTCTTTTGCT; type 4 (Genbank #X87176) FP: 5′ATCAGCTTCAGGAATATATG; and type 4 RP 5′CAAGATCTTCAGGCATAACT. The lengths of the DNA segments to be amplified were 121 base pairs, 151 base pairs, 211 base pairs, and 181 base pairs, respectively, for each of the types 1–4 isozymes. Total RNA was isolated from two samples of SG, each pooled from facial areas of 15 subjects (Chomczynski Sacchi, 1987Chomczynski Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem. 1987; 162: 156-159Google Scholar). First strand cDNA synthesis was performed using a First-Strand cDNA Synthesis kit (Pharmacia, Piscataway, NJ). Briefly, four 1 μm aliquots of each RNA sample were each diluted in 8 μl of sterile distilled water, heated to 65°C for 10 min, and cooled on ice. Moloney-mouse-leukemia virus reverse transcriptase 20 u (Pharmacia), 50 pmol of reverse primer, 15 mM dithiothreitol, bovine serum albumin, and dNTP. Samples were incubated at 37°C for 1 h. The polymerase chain reaction was initiated. The reaction product (15 μl) was then heated to 95°C for 5 min and placed on ice. Taq polymerase 2.5 units (Promega, Madison, WI) and 50 pmol each of forward and reverse primers were added in a final volume of 50 μl of sterile water. The PCR conditions were set up as follows: 95°C for 5 min, 95°C for 1 min, 58°C for 1 min, 72°C for 1 min. Thirty cycles between steps 2 and 4 were performed. Final extension was performed at 72°C for 10 min. The annealing temperature used for the type 1 primer was 58°C. PCR products were separated by electrophoresis on a 2% agarose gel. Bands were cut from the gel, and DNA was extracted and ligated into a pCR-2.1 vector (Invitrogen, Carson City, CA) containing an ampicillin resistance gene and lacZα fragment to allow for blue-white screening. Plasmids were transformed into competent cells and colonies were selected based on ampicillin resistance and β-galactosidase activity. Plasmid DNA was prepared from an overnight culture and sequenced for verification using the M-13 reverse primer using an automated DNA sequencer with fluorescent tag (ABI Prism 377, Perkin Elmer, Foster City, CA). Linearity of enzyme activity with time and protein concentration was demonstrated between 10 and 120 min and 40 and 300 μg protein, respectively (data not shown). The pH profile of the oxidative and reductive activity of 17β-HSD in homogenized SG from the female breast was determined using both C-19 and C-18 steroids as substrates (Figure 1). With each substrate oxidative activity was sensitive to pH, with optimal activity noted at pH 10. Optimal reductive activity was noted at pH 5.0. For C-19 steroids, reductive activity changed little with pH. The cofactor preference for the oxidative and reductive reactions of 17β-HSD in SG homogenates using androgens as substrates is demonstrated in Table I. Oxidative activity of 17β-HSD is greatest with the cofactor NAD in all samples tested. Reductive activity did not show a preference for either NADH or NADPH.Table ISebaceous glands oxidize androgens using NAD as a cofactoraHomogenates of SG from various areas were assayed for the oxidative and reductive activity of 17β-HSD using 10 μM substrate and 500 μM cofactor.Specific activity (pmol per min per mg protein)bData represent mean (range) of two determinations.T → androstenedionecT, testosterone; DHT, dihydrotestosterone. (oxidation)androstenedione → T + DHTcT, testosterone; DHT, dihydrotestosterone. (reduction)TissueNADNADPNADHNADPHBreast16.3 (13.4, 19.3)1.1 (1.2, 1.0)7.4 (6.6, 8.2)7.7 (9.1, 6.3)Nose45.8 (45.7, 45.8)7.7 (7.5, 7.9)33.3 (32.6, 33.8)32.8 (34.9, 30.5)Forehead14.5 (15.3, 13.7)0.87 (0.7, 0.9)6.7 (4.0, 7.2)4.7 (4.7, 4.7)Abdomen55.7 (52.6, 58.8)14.4 (14.7, 15.9)21.1 (19.8, 22.3)18.1 (13.9, 19.1)a Homogenates of SG from various areas were assayed for the oxidative and reductive activity of 17β-HSD using 10 μM substrate and 500 μM cofactor.b Data represent mean (range) of two determinations.c T, testosterone; DHT, dihydrotestosterone. Open table in a new tab The preference of 17β-HSD for substrate was demonstrated in homogenized SG from facial areas. Seven homogenates were prepared by pooling ≈200–300 SG from a particular anatomic area: two homogenates each were prepared from male cheek and male nose and one homogenate each from male forehead, female cheek, and female forehead. Each homogenate was assayed in duplicate using C-19, C-18, and C-21 (progestins) steroids as substrates (Table II, C-21 data not shown). Specific activity of 17β-HSD was greatest using estradiol as a substrate followed by testosterone, estrone, androstenedione, progesterone, and 20α-hydroxyprogesterone, respectively. The specific activity of 17β-HSD with C-18 steroids as substrates was ≈20% higher compared with C-19 steroids. Oxidation was the preferred reaction type in all samples tested. The ratio (mean ± SEM) of oxidative activity to reductive activity was 1.38 ± 0.06 with C-19 steroids and 1.44 ± 0.11 with C-18 steroids.Table IIHomogenized and intact SG prefer to oxidize androgens and estrogensaSeven samples of sebaceous glands from facial areas described in the text were assayed at pH 7 in homogenized and in intact SG for the oxidative and reductive activity of 17β-HSD using C-19 and C-18 as substrates (1 μM). Cofactor (500 μM) was added in assays of homogenates, but not intact glands.Homogenized SGIntact SGSubstrateActivitybSpecific activity (pmol per min per mg protein). Data expressed are mean ± SEM of seven determinations.OX/REDcOX/RED ratio represents the mean ratio (±SEM) of the specific activity obtained using testosterone or estradiol as a substrate divided by the specific activity using androstenedione or estrone as substrates, respectively. Ratios obtained with each of the seven data sets were used to determine the mean.ActivitybSpecific activity (pmol per min per mg protein). Data expressed are mean ± SEM of seven determinations.OX/REDcOX/RED ratio represents the mean ratio (±SEM) of the specific activity obtained using testosterone or estradiol as a substrate divided by
Referência(s)