Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Three Isoforms of a Hepatocyte Nuclear Factor-4 Transcription Factor with Tissue- and Stage-specific Expression in the Adult Mosquito

1998; Elsevier BV; Volume: 273; Issue: 45 Linguagem: Inglês

10.1074/jbc.273.45.29801

ISSN

1083-351X

Autores

Marianna Kapitskaya, Neal T. Dittmer, Kirk Deitsch, Wen-Long Cho, David G. Taylor, Todd Leff, Alexander S. Raikhel,

Tópico(s)

Neurobiology and Insect Physiology Research

Resumo

We cloned three isoforms of hepatocyte nuclear factor-4 (HNF-4) from the mosquito Aedes aegypti, designated AaHNF-4a, AaHNF-4b, and AaHNF-4c. AaHNF-4a and AaHNF-4b are typical members of the HNF-4 subfamily of nuclear receptors with high amino acid conservation. They differ in N-terminal regions and exhibit distinct developmental profiles in the female mosquito fat body, a metabolic tissue functionally analogous to the vertebrate liver. The AaHNF-4b mRNA is predominant during the previtellogenic and vitellogenic phases, while the AaHNF-4a mRNA is predominant during the termination phase of vitellogenesis, coinciding with the onset of lipogenesis. The third isoform, AaHNF-4c, lacks part of the A/B and the entire C (DNA-binding) domains. The AaHNF-4c transcript found in the fat body during the termination of vitellogenesis may serve as a transcriptional inhibitor. Both AaHNF-4a and AaHNF-4b bind to the cognate DNA recognition site in electrophoretic mobility shift assay. Dimerization of AaHNF-4c with other mosquito HNF-4 isoforms or with mammalian HNF-4 prevents binding to the HNF-4 response element. In transfected human 293T cells, AaHNF-4c significantly reduced the transactivating effect of the human HNF-4α1 on the apolipoprotein CIII promoter. Electrophoretic mobility shift assay confirmed the presence of HNF-4 binding sites upstream of A. aegypti vgand vcp, two yolk protein genes expressed in the female mosquito fat body during vitellogenesis. Therefore, HNF-4, an important regulator of liver-specific genes, plays a critical role in the insect fat body. We cloned three isoforms of hepatocyte nuclear factor-4 (HNF-4) from the mosquito Aedes aegypti, designated AaHNF-4a, AaHNF-4b, and AaHNF-4c. AaHNF-4a and AaHNF-4b are typical members of the HNF-4 subfamily of nuclear receptors with high amino acid conservation. They differ in N-terminal regions and exhibit distinct developmental profiles in the female mosquito fat body, a metabolic tissue functionally analogous to the vertebrate liver. The AaHNF-4b mRNA is predominant during the previtellogenic and vitellogenic phases, while the AaHNF-4a mRNA is predominant during the termination phase of vitellogenesis, coinciding with the onset of lipogenesis. The third isoform, AaHNF-4c, lacks part of the A/B and the entire C (DNA-binding) domains. The AaHNF-4c transcript found in the fat body during the termination of vitellogenesis may serve as a transcriptional inhibitor. Both AaHNF-4a and AaHNF-4b bind to the cognate DNA recognition site in electrophoretic mobility shift assay. Dimerization of AaHNF-4c with other mosquito HNF-4 isoforms or with mammalian HNF-4 prevents binding to the HNF-4 response element. In transfected human 293T cells, AaHNF-4c significantly reduced the transactivating effect of the human HNF-4α1 on the apolipoprotein CIII promoter. Electrophoretic mobility shift assay confirmed the presence of HNF-4 binding sites upstream of A. aegypti vgand vcp, two yolk protein genes expressed in the female mosquito fat body during vitellogenesis. Therefore, HNF-4, an important regulator of liver-specific genes, plays a critical role in the insect fat body. hepatocyte nuclear factors 1 and 4, respectively the apolipoprotein CIII gene promoter electrophoretic mobility shift assay post-blood meal polymerase chain reaction 20-hydroxyecdysone kilobase pair apolipoprotein factor 1 element. The insect fat body is a functional analogue of the vertebrate liver. Serving as a “protein factory” (1Wyatt G.R. Insect Biology of the Future. Academic Press, Inc., New York1980: 201-225Google Scholar), it is the insect's most powerful secretory organ, responsible for production of virtually all hemolymph proteins (2Kanost M.R. Kawooya J.K. Law J.H. Ryan R.O. Van Heysden M.C. Ziegler R. Adv. Insect Physiol. 1990; 22: 299-395Crossref Scopus (340) Google Scholar). The aptness of this biological analogy is further substantiated by the many parallels in regulatory mechanisms responsible for fat body- and liver-specific gene expression, which is governed by a combination of transcription factors synergistically interacting with regulatory elements in target genes. Indeed, the regulatory sequences of some fat body-specific genes and their liver-specific counterparts are highly conserved (3Falb D. Maniatis T. Genes Dev. 1992; 6: 454-465Crossref PubMed Scopus (77) Google Scholar, 4Abel T. Bhatt R. Maniatis T. Genes Dev. 1992; 6: 466-480Crossref PubMed Scopus (115) Google Scholar, 5Deitsch K.W. Raikhel A.S. Insect Mol. Biol. 1993; 2: 205-213Crossref PubMed Scopus (24) Google Scholar), and several fat body-specific transcription factors are similar to those found in liver-specific regulatory pathways (6Johnson P.F. Cell Growth Differ. 1990; 1: 47-52PubMed Google Scholar, 7Thummel C.S. Cell. 1995; 83: 871-877Abstract Full Text PDF PubMed Scopus (308) Google Scholar, 8Clevidence D.E. Overdier D.G. Tao W. Qian X. Pani L. Lai E. Costa R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3948-3952Crossref PubMed Scopus (220) Google Scholar, 9Cereghini S. FASEB J. 1996; 10: 267-282Crossref PubMed Scopus (473) Google Scholar). Hepatocyte nuclear factor 4 (HNF-4),1 a member of the nuclear receptor superfamily, is a transcriptional activator for a wide variety of liver genes with diverse functions (10Sladek F.M. Tronche F. Yaniv M. Transcriptional Regulation of Liver-specific Genes. R. G. Landes Co, Austin, TX1994: 207-230Google Scholar, 11Jiang G. Nepomuceno L. Hopkins K. Sladek M. Mol. Cell. Biol. 1995; 15: 5131-5143Crossref PubMed Scopus (173) Google Scholar, 12Chen W.S. Manova K. Weinstein D.C. Duncan S.A. Plump A.S. Prezioso V.R. Bachvarova R.F. Darnell Jr., J.E. Genes Dev. 1994; 8: 2466-2477Crossref PubMed Scopus (482) Google Scholar). Apart from directly regulating target genes, HNF-4 may trigger a cascade of transcription factors involved in appropriate expression of genes essential for liver function (10Sladek F.M. Tronche F. Yaniv M. Transcriptional Regulation of Liver-specific Genes. R. G. Landes Co, Austin, TX1994: 207-230Google Scholar). For example, HNF-4 activates transcription of HNF-1, another important hepatocyte transcription factor (13Kuo C.J. Conley P.B. Chen L. Sladek F.M. Darnell Jr., J.E. Crabtree G.R. Nature. 1992; 355: 457-461Crossref PubMed Scopus (369) Google Scholar, 14Tian J.-M. Schibler U. Genes Dev. 1991; 5: 2225-2234Crossref PubMed Scopus (156) Google Scholar). We are interested in understanding the molecular mechanisms of insect vitellogenesis. In the anautogenous mosquito Aedes aegypti, this process is initiated by a blood meal and involves the coordinated activity of two vitellogenic tissues: the fat body, which produces and secretes several yolk protein precursors, and the ovary, which specifically accumulates them (15Raikhel A.S. Adv. Dis. Vector Res. 1992; 9: 1-39Crossref Google Scholar). Vitellogenic events are regulated, at least in part, by the insect steroid hormone, 20-hydroxyecdysone (20E). The expression of vitellogenic genes is mediated through a 20E-triggered regulatory cascade of transcription factors (16Raikhel, A. S., Miura, K., and Segraves, W. A. (1998)Am. Zoologist, in pressGoogle Scholar), similar to that in Drosophila development (17Ashburner M. Cell. 1990; 61: 1-3Abstract Full Text PDF PubMed Scopus (110) Google Scholar). A high degree of evolutionary conservation among HNF-4 sequences suggests that the mosquito homologue may be an important transcription factor in the fat body, as it is in the vertebrate liver. Indeed, vertebrate HNF-4 cloned from rat, mouse, Xenopus, and human (10Sladek F.M. Tronche F. Yaniv M. Transcriptional Regulation of Liver-specific Genes. R. G. Landes Co, Austin, TX1994: 207-230Google Scholar, 18Sladek F.M. Zhong W. Lai E. Darnell Jr., J.E. Genes Dev. 1990; 4: 2353-2365Crossref PubMed Scopus (854) Google Scholar, 19Taraviras S. Monaghan A.P. Schutz G. Kelsey G. Mech. Dev. 1994; 48: 67-79Crossref PubMed Scopus (143) Google Scholar, 20Hata S. Inoue T. Kosuga K. Nakashima T. Tsukamoto T. Osumi T. Biochim. Biophys. Acta. 1995; 1260: 55-61Crossref PubMed Scopus (31) Google Scholar, 21Chartier F.L. Bossu J.-P. Laudet V. Fruchart J.-C. Laine B. Gene (Amst.). 1994; 147: 269-272Crossref PubMed Scopus (76) Google Scholar, 22Drewes T. Senkel S. Holewa B. Ryffel G.U. Mol. Cell. Biol. 1996; 16: 925-931Crossref PubMed Scopus (192) Google Scholar), as well as their insect counterparts fromDrosophila (23Zhong W. Sladek F.M. Darnell Jr., J.E. EMBO J. 1993; 12: 537-544Crossref PubMed Scopus (113) Google Scholar) and Bombyx mori (24Swevers L. Iatrou K. Mech. Dev. 1998; 72: 3-13Crossref PubMed Scopus (23) Google Scholar), show a very high amino acid sequence similarity in the DNA-binding, hinge, and dimerization/ligand-binding domains. The tissue distribution of HNF-4 has been conserved throughout evolution as well. The somatic tissues, where HNF-4 is expressed, are mainly restricted to the vertebrate liver, intestine, and kidney (18Sladek F.M. Zhong W. Lai E. Darnell Jr., J.E. Genes Dev. 1990; 4: 2353-2365Crossref PubMed Scopus (854) Google Scholar, 19Taraviras S. Monaghan A.P. Schutz G. Kelsey G. Mech. Dev. 1994; 48: 67-79Crossref PubMed Scopus (143) Google Scholar, 25Zhong W. Mirkovitch J. Darnell Jr., J.E. Mol. Cell. Biol. 1994; 14: 7276-7284Crossref PubMed Scopus (92) Google Scholar) or to their functional analogues in the Drosophila embryos: the fat body, midgut, and Malpighian tubules, respectively (23Zhong W. Sladek F.M. Darnell Jr., J.E. EMBO J. 1993; 12: 537-544Crossref PubMed Scopus (113) Google Scholar). In the silk moth B. mori, HNF-4 expression was detected in most tissues of the larva and pharate adult, with highest expression in the gut, fat body, and gonads (24Swevers L. Iatrou K. Mech. Dev. 1998; 72: 3-13Crossref PubMed Scopus (23) Google Scholar). In this paper, we describe the cloning and characterization of three isoforms of mosquito HNF-4: AaHNF-4a, AaHNF-4b, and AaHNF-4c. Three distinct transcripts of 2.8 kb (AaHNF-4a), 2.1 kb (AaHNF-4b), and 1.8 kb (AaHNF-4c) were detected in adult mosquitoes, and their distribution is tissue- and stage-specific. The AaHNF-4a and AaHNF-4b isoforms are typical members of the HNF-4 subfamily, and their functionality has been confirmed by their ability to bind as homodimers to the cognate DNA recognition site. In the mosquito fat body, AaHNF-4b is predominant during the previtellogenic period and the synthetic phase of vitellogenesis, while AaHNF-4a is predominant during the termination phase. In the ovaries, only the AaHNF-4b transcript was detected throughout the entire vitellogenic period. A novel finding of this work is the cloning of a unique mosquito isoform AaHNF-4c; it is distinct from AaHNF-4b in that part of the A/B and the entire C (DNA-binding) domains are absent. The AaHNF-4c transcript appears most abundantly during the termination phase of vitellogenesis. The AaHNF-4c isoform prevented AaHNF-4a, AaHNF-4b, and rat HNF-4 from binding to DNA in EMSA, suggesting that this HNF-4 isoform may serve as a transcriptional repressor. Furthermore, in transfected human embryonic kidney 293T cells, AaHNF-4c significantly reduced positive transcriptional activity of the human HNF-4α1 on the apolipoprotein CIII promoter (apo-CIIIP). In addition, we also have identified HNF-4 binding sites in the upstream region of two yolk protein precursor genes: vitellogenin (vg) (26Romans P. Tu Z. Ke Z. Hagedorn H.H. Insect Biochem. Mol. Biol. 1995; 25: 939-958Crossref PubMed Scopus (78) Google Scholar), and vitellogenic carboxypeptidase (vcp) (27Deitsch K.W. Raikhel A.S. Insect Mol. Biol. 1993; 2: 205-213Crossref PubMed Google Scholar), which are the major genes specifically expressed in the female fat body during vitellogenesis (15Raikhel A.S. Adv. Dis. Vector Res. 1992; 9: 1-39Crossref Google Scholar). Mosquitoes, A. aegypti, were reared according to Hays and Raikhel (28Hays A.R. Raikhel A.S. Roux's Arch. Dev. Biol. 1990; 199: 114-121Crossref Scopus (89) Google Scholar). Larvae were fed on a standard diet as described before (29Lea A.O. J. Med. Entomol. 1964; 1: 40-44Crossref PubMed Scopus (54) Google Scholar). Vitellogenesis was initiated by allowing females 3–5 days after eclosion to feed on an anesthetized white rat. The RNA ladder was purchased from Life Technologies, Inc.; Sequenase was from U. S. Biochemical Corp.; and restriction enzymes were from Boehringer Mannheim. Perkin-Elmer was the source of reagents for the polymerase chain reaction (PCR), and in vitro transcription and translation assays were from Promega. MSI CO supplied nitrocellulose-blotting membranes. Radionucleotides for labeling of probes and DNA sequencing were from NEN Life Science Products. All other reagents were of analytical grade from Sigma or Baker. A cDNA fragment of AaHNF-4 was first obtained by PCR, for which degenerate primers were designed based on the sequences of rat, mouse, and Drosophila HNF-4 (18Sladek F.M. Zhong W. Lai E. Darnell Jr., J.E. Genes Dev. 1990; 4: 2353-2365Crossref PubMed Scopus (854) Google Scholar, 19Taraviras S. Monaghan A.P. Schutz G. Kelsey G. Mech. Dev. 1994; 48: 67-79Crossref PubMed Scopus (143) Google Scholar, 23Zhong W. Sladek F.M. Darnell Jr., J.E. EMBO J. 1993; 12: 537-544Crossref PubMed Scopus (113) Google Scholar). Amplification was achieved in a Perkin Elmer thermal cycler using as the template cDNA reverse-transcribed from 20 μg of total RNA prepared from the fat bodies of vitellogenic female mosquitoes. The PCR-generated fragment was used as a probe to screen a λZAPII cDNA library, which was prepared from the fat bodies of vitellogenic female mosquitoes 6–48 h post-blood meal (PBM) as previously reported (30Cho W.-L. Raikhel S.A. J. Biol. Chem. 1992; 267: 21823-21829Abstract Full Text PDF PubMed Google Scholar). Several positive cDNA clones were subsequently isolated and sequenced using standard protocols (31Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Analyses of nucleotide and deduced amino acid sequences were performed using the software of the University of Wisconsin Genetics Computer Group. Total RNA was isolated from mosquitoes of different stages and tissues using the guanidine isothiocyanate method as described previously (32Bose S.G. Raikhel S.A. Biochem. Biophys. Res. Commun. 1988; 155: 436-442Crossref PubMed Scopus (41) Google Scholar). Polyadenylated mRNA was isolated using Biomag oligo(dT)20 magnetic beads and the manufacturer's protocols (PerSeptive Diagnostics, Inc.). For Northern blot analysis, total or poly(A)+ RNA was separated by electrophoresis in 1.2% agarose/formaldehyde gels in MOPS buffer, blotted to a nitrocellulose membrane, and hybridized to32P-labeled DNA probes under high stringency conditions (31Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Autoradiography was conducted at −70 °C using intensifying screens. The mosquito AaHNF-4a and -4b cDNAs were subcloned into the transcription vector pGEM.3Z (Promega) under the control of the SP6 RNA polymerase promoter. The mosquito AaHNF-4c isoform and the rat HNF-4 clone (a kind gift of Dr. F. Sladek) (18Sladek F.M. Zhong W. Lai E. Darnell Jr., J.E. Genes Dev. 1990; 4: 2353-2365Crossref PubMed Scopus (854) Google Scholar) were subcloned into pBluescript, under the control of the T3 RNA polymerase promoter. The DmGATAb clone was a gift form Dr. T. Abel and was under control of the T7 RNA polymerase promoter (33Abel T. Michelson A.M. Maniatis T. Development. 1993; 119: 623-633Crossref PubMed Google Scholar). The TNT System (Promega) was used for in vitro TNT of cDNA clones in rabbit reticulocyte lysate, utilizing the corresponding RNA polymerases. 1 μg of DNA was used in a total reaction volume of 50 μl. The TNT reactions were conducted at 30 °C for 2 h and then stored at −70 °C until needed for electrophoretic mobility shift assays. Binding reactions were carried out in a total volume of 20 μl containing 2–3 μl of the appropriate TNT sample, 10 mm Tris-HCl (pH 8.0), 50 mm NaCl, 1 mm MgCl2, 0.5 mm dithiothreitol, 0.5 mm EDTA, 2 μg poly(dI-dC), 4% glycerol, and 5 pmol (100-fold molar excess) of competitor DNA when appropriate. After incubating for 15 min at room temperature, 0.05 pmol of 32P-labeled DNA probe was added, and the solution was incubated an additional 15 min. The samples were loaded on a 5% nondenaturing polyacrylamide gel (prerun for 1 h) in 0.5× TBE and run at 10 V/cm. The gel was then dried and autoradiographed with an intensifying screen at −70 °C. To initiate heterodimer formation between AaHNF-4c and other HNF-4 isoforms, the TNT samples were first mixed together and heated at 50 °C for 1 min and then cooled at room temperature for 15 min (34Foulkes N.S. Borrelli E. Sassone-Corsi P. Cell. 1991; 64: 739-7495Abstract Full Text PDF PubMed Scopus (534) Google Scholar,35Iyer S.B. Davis D.L. Seal S.N. Burch J.B. Mol. Cell. Biol. 1991; 11: 4863-4875Crossref PubMed Scopus (79) Google Scholar). The volume was brought up to 20 μl in shift buffer, and the reaction was carried out as described above. Control incubations with each HNF-4 isoform without the addition of AaHNF-4c showed no or negligible reduction in specific binding due to heating. DNA probes for EMSA were made by annealing complementary oligonucleotides. The HNF-4 binding site (APF-1) (18, 36) in the apolipoprotein CIII gene was used as a positive control for binding. The oligonucleotides used to generate the APF-1 probe were: 5′-GCGCTGGGCAAAGGTCAC -3′ and 5′-GCAGGTGACCTTTGCCCAG-3′. The Vg HNF4 probe was made by annealing 5′-ATCGGGAGGCCAATGGTCGAG-3′ with 5′- GTCACTCGACCATTGGCCTCC, and the VCP HNF4 probe was composed of 5′- ATGCAAAGGGTCGTTAGGTCAAAT-3′ and 5′-ATCGATTTGACCTAACGACCCTTT-3′. The APF-1 probe was labeled by back-filling with Klenow fragment using [α-32P]dCTP, and the Vg and VCP HNF4 probes were labeled by back-filling with [α-32P]dATP. The BZIP-1 probe used as a nonspecific competitor and the Box-A probe used as a positive control for DmGATAb were described previously (37Dittmer N.T. Raikhel A.S. Insect Biochem. Mol. Biol. 1997; 27: 323-335Crossref PubMed Scopus (26) Google Scholar). The AaHNF-4c cDNA was cloned into the EcoRI site of the expression vector pcDNA3.1/Zeo(+) (Invitrogen). Construction of the human HNF-4α1 expression vector and the luciferase reporter construct pL854, containing the apo-CIIIP, have been previously described (38Taylor D.G. Haubenwallner S. Leff T. Nucleic Acids Res. 1996; 24: 2930-2935Crossref PubMed Scopus (25) Google Scholar). Human embryonic kidney 293T cells were seeded at a density of 1.2 × 105 in 12-well tissue culture plates and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. Each transfection contained 150 ng of pL854, 50 ng of pCMVβ-gal (CLONTECH), selected amounts of human HNF-4α1 and/or AaHNF-4c, and empty pcDNA 3.1 vector for a total of 5 μg of DNA. Cells were transfected in serum-free Dulbecco's modified Eagle's medium using LipofectAMINE reagent (Life Technologies) at a DNA:LipofectAMINE ratio of 1:4. At 4 h after transfection, the cells were incubated in Dulbecco's modified Eagle's medium plus 10% fetal bovine serum for an additional 36 h. The human liver HepG2 cells were cultured as described previously (36Leff T. Reue K. Melian A. Culver H. Breslow J.L. J. Biol. Chem. 1989; 264: 16132-16137Abstract Full Text PDF PubMed Google Scholar). Luciferase and β-galactosidase activity were determined by the Dual-Light reporter gene assay system (Tropix) using a Wallac-Berthold LB96P-2 luminometer. Putative clones encoding the mosquito HNF-4 transcription factor (AaHNF-4) were obtained by a combination of the PCR and cDNA library screening. The following strategy was used to design degenerate primers. The sense primer conformed to the P-box sequence of the DNA-binding domain, which is conserved among the members of the nuclear receptor superfamily; the antisense primer was based on the conserved sequence LDDQVA from the dimerization domain of rat, mouse, and Drosophila HNF-4 homologues (18Sladek F.M. Zhong W. Lai E. Darnell Jr., J.E. Genes Dev. 1990; 4: 2353-2365Crossref PubMed Scopus (854) Google Scholar, 20Hata S. Inoue T. Kosuga K. Nakashima T. Tsukamoto T. Osumi T. Biochim. Biophys. Acta. 1995; 1260: 55-61Crossref PubMed Scopus (31) Google Scholar, 23Zhong W. Sladek F.M. Darnell Jr., J.E. EMBO J. 1993; 12: 537-544Crossref PubMed Scopus (113) Google Scholar). A 440-base pair fragment was amplified by PCR and sequenced as described under “Materials and Methods.” After confirming that its sequence was similar to that of rodent and Drosophila HNF-4 isoforms, it was used as a probe to screen a mosquito fat body cDNA library. Restriction mapping and sequence analyses of positive cDNA clones revealed three distinct mosquito cDNAs present in the library, which we designate AaHNF-4a, AaHNF-4b, and AaHNF-4c (Fig. 1). The AaHNF-4b (1.86 kb) and AaHNF-4c (1.53 kb) cDNAs share the same sequences at the 5′-terminus (except that the 5′-end of AaHNF-4c is 23 base pairs longer), whereas the AaHNF-4a (2.43-kb) cDNA has a different 5′-terminal sequence. All three AaHNF-4 cDNAs have the same 3′-end sequences and lack a poly(A) tail, indicating that none of the cDNAs represent a full-length transcript. However, AaHNF-4b has a canonical polyadenylation signal (AATAAA) followed by an additional 14 base pairs, while the AaHNF-4a and AaHNF-4c cDNA sequences end just before the position of the AATAAA site in AaHNF-4b. In all three cDNAs, the putative start codons (ATG) are preceded by several in-frame stop codons, indicating that the open reading frame is full-length in each clone. The conceptual translation of the AaHNF-4a, AaHNF-4b, and AaHNF-4c cDNAs shows that they encode three different proteins, or isoforms, of 565, 538, and 427 amino acids, respectively. The mosquito AaHNF-4a and AaHNF-4b isoforms exhibit a structural domain organization similar to that of the rodent and insect HNF-4 homologues (Fig. 2). The C (DNA-binding), D (hinge), and E (dimerization/ligand-binding) domains are highly conserved; for example, AaHNF-4a and AaHNF-4b share 89, 65, and 79% identity with the respective domains of Drosophila HNF-4 and 91, 58, and 72% identity with B. mori (Fig. 2). An N-terminal A/B and a C-terminal proline-rich F-domain, which possibly have a transactivator function (18Sladek F.M. Zhong W. Lai E. Darnell Jr., J.E. Genes Dev. 1990; 4: 2353-2365Crossref PubMed Scopus (854) Google Scholar), are poorly conserved in the mosquito AaHNF-4, a characteristic feature of all members of the HNF-4 subfamily and, more generally, the nuclear receptor superfamily (40Mangelsdorf D.J. Thummel C. Beato M. Herrlich P. Schutz G. Umesono K. Blumberg B. Kastner P. Mark M. Chambon P. Evans R.M. Cell. 1995; 83: 835-839Abstract Full Text PDF PubMed Scopus (6082) Google Scholar). A sequence comparison of AaHNF-4a and AaHNF-4b isoforms show that they encode nearly identical polypeptides, differing only in the amino acids at their N termini (Fig. 3), strikingly similar to the B. mori isoforms BmHNF-4a and BmHNF-4b. In contrast, the first six amino acids of the shortest isoform, AaHNF-4c, are identical to those of AaHNF-4b, but the rest of the A/B domain and the entire C (DNA-binding) domain are lacking (Fig. 3). The structure of the mosquito AaHNF-4c isoform is unique among insect and vertebrate members of the HNF-4 subfamily that have been reported to date. To determine if the three AaHNF-4 cDNAs we have cloned represent respective AaHNF-4 mRNA species in the mosquito, Northern hybridizations were performed using particular portions of the cDNAs as probes (Fig. 4); a probe common to all three cDNAs (Fig. 1, common) detected three transcripts of 2.8, 2.1, and 1.8 kb; a probe specific to the 5′-untranslated region of the AaHNF-4a cDNA (5′-HNF-4a, Fig. 1) hybridized only with the 2.8-kb transcript; and the last probe, containing sequences from the A/B and C domains common to the AaHNF-4a and AaHNF-4b cDNAs but not to the AaHNF-4c (Fig. 1, ΔC), recognized the 2.8- and 2.1-kb mRNAs but not the 1.8-kb mRNA. Thus, we differentiated the 2.8-, 2.1-, and 1.8-kb mRNA species as AaHNF-4a, AaHNF-4b, and AaHNF-4c transcripts, respectively (Fig. 4). This experiment verifies that one of the transcripts indeed lacks the region encoding for a portion of the A/B domain and the entire DNA-binding domain, and therefore, AaHNF-4c does not appear to be an artifact of the cDNA library. To further confirm the presence the AaHNF-4c transcript in the mRNA pool from the mosquito fat body, we performed reverse transcription-PCR using nondegenerate primers that flanked the missing region of AaHNF-4c. cDNA was reverse transcribed from total RNA extracted from the fat bodies of female mosquitoes at 36 h PBM. The sense and antisense primers were designed based on the 5′-untranslated region and hinge domain, respectively, common to both AaHNF-4b and AaHNF-4c cDNAs. Upon primary amplification by PCR, only a band of the expected size for AaHNF-4b was detected. However, when a secondary PCR was performed, a band of the expected size for AaHNF-4c was amplified. Southern blot analyses demonstrated that both bands hybridized with a probe specific to the hinge region of HNF-4 (data not shown). To determine the distribution of AaHNF-4 expression in tissues of adult mosquitoes, polyadenylated mRNA was isolated from the whole body of males and the fat body, midgut, Malpighian tubules, ovary, and thorax of females, taken at the middle stage of the vitellogenic cycle (24 h PBM) and subjected to Northern blot analysis. A fragment of the cDNA common to all three AaHNF-4 cDNAs (Fig. 1) was used as a hybridization probe. The mosquito fat body, Malpighian tubules, and midgut exhibited significant levels of AaHNF-4 transcription. Two mosquito HNF-4 isoforms (AaHNF-4a and AaHNF-4b) were detected in these tissues (data not shown). In contrast to the somatic tissues of mosquito females, only the 2.1-kb (AaHNF-4b) transcript was found in the ovaries (Fig. 5). The highest level of ovarian AaHNF-4b mRNA was detected soon after initiation of vitellogenesis by a blood meal (6 h PBM); it dropped to an undetectable level by 36 h PBM, the time of termination of vitellogenic events in the female mosquito (Fig. 5). The high level of conservation between the mosquito HNF-4 and its vertebrate counterparts (Figs. 2 and 3) as well as the presence of three AaHNF-4 transcripts in the adult fat body (Figs. 4 and 5) suggests that it plays an important role in this metabolic tissue, similarly to that of the vertebrate HNF-4 in the liver. In an attempt to further understand the possible functions of AaHNF-4 in the vitellogenic fat body of adult mosquitoes, we characterized its expression in more detail. Total RNA from the fat body of female mosquitoes at different stages of vitellogenesis was analyzed by Northern blot hybridization using the cDNA probe common to all three AaHNF-4 isoforms. The expression pattern of the three AaHNF-4 transcripts changed differentially over the course of the vitellogenic cycle (Fig. 6). In the previtellogenic stage, all three transcripts were clearly present during the first day posteclosion, but in subsequent days only the 2.1-kb transcript (corresponding to the AaHNF-4b isoform) was present. Furthermore, its levels increased by day 5 of the previtellogenic period. During the first 18 h of vitellogenic period, only the AaHNF-4b transcript was clearly detectable. At 24 h PBM, when yolk protein gene transcription is nearing its maximum (15Raikhel A.S. Adv. Dis. Vector Res. 1992; 9: 1-39Crossref Google Scholar), the levels of the AaHNF-4a transcript began to rise again, relative to AaHNF-4b, and the AaHNF-4c transcript appeared. By 36 h PBM, the levels of HNF-4 mRNA significantly increased; AaHNF-4a became the predominant form and AaHNF-4c more pronounced. This pattern of AaHNF-4 expression was maintained until 48 h PBM, when yolk protein synthesis terminated and the fat body returned to its previtellogenic state (15Raikhel A.S. Adv. Dis. Vector Res. 1992; 9: 1-39Crossref Google Scholar). We used EMSA to determine if the mosquito HNF-4 homologue is a functional DNA-binding protein. The three AaHNF-4 cDNAs were subcloned into transcription vectors and then subjected to TNT reactions in a rabbit reticulocyte lysate system. The results of the TNT reaction were verified by utilizing [35S]methionine; SDS-polyacrylamide gel electrophoresis analyses showed that the in vitro synthesized proteins closely corresponded to their expected molecular sizes (data not shown). The TNT expressed proteins were examined for their ability to form specific binding complexes with APF-1, a sequence previously shown to be a recognition site for both rat and insect HNF-4 factors (18Sladek F.M. Zhong W. Lai E. Darnell Jr., J.E. Genes Dev. 1990; 4: 2353-2365Crossref PubMed Scopus (854) Google Scholar, 23Zhong W. Sladek F.M. Darnell Jr., J.E. EMBO J. 1993; 12: 537-544Crossref PubMed Scopus (113) Google Scholar,24Swevers L. Iatrou K. Mech. Dev. 1998; 72: 3-13Crossref PubMed Scopus (23) Google Scholar). A rat HNF-4 clone was used as a positive control. The AaHNF-4a and AaHNF-4b proteins formed DNA-protein complexes of similar mobility, which migrated slower than the complex formed by the rat HNF-4 (Fig. 7). The binding of these proteins was sequence-specific and could be competed away with an excess of cold probe (APF-1) but not with a nonspecific competitor. The protein synthesized from the AaHNF-4c cDNA, which is missing the DNA-binding domain, failed to exhibit any binding activity (data not shown). An APF-1 binding complex of intermediate mobility was observed in the retardation gel when the AaHNF-4b isoform

Referência(s)