Tissue- and Gene-specific Recruitment of Steroid Receptor Coactivator-3 by Thyroid Hormone Receptor during Development
2005; Elsevier BV; Volume: 280; Issue: 29 Linguagem: Inglês
10.1074/jbc.m503999200
ISSN1083-351X
AutoresBindu D. Paul, Daniel R. Buchholz, Liezhen Fu, Yun‐Bo Shi,
Tópico(s)Genetic and Clinical Aspects of Sex Determination and Chromosomal Abnormalities
ResumoNumerous coactivators that bind nuclear hormone receptors have been isolated and characterized in vitro. Relatively few studies have addressed the developmental roles of these cofactors in vivo. By using the total dependence of amphibian metamorphosis on thyroid hormone (T3) as a model, we have investigated the role of steroid receptor coactivator 3 (SRC3) in gene activation by thyroid hormone receptor (TR) in vivo. First, expression analysis showed that SRC3 was expressed in all tadpole organs analyzed. In addition, during natural as well as T3-induced metamorphosis, SRC3 was up-regulated in both the tail and intestine, two organs that undergo extensive transformations during metamorphosis and the focus of the current study. We then performed chromatin immunoprecipitation assays to investigate whether SRC3 is recruited to endogenous T3 target genes in vivo in developing tadpoles. Surprisingly, we found that SRC3 was recruited in a gene- and tissue-dependent manner to target genes by TR, both upon T3 treatment of premetamorphic tadpoles and during natural metamorphosis. In particular, in the tail, SRC3 was not recruited in a T3-dependent manner to the target TRβA promoter, suggesting either no recruitment or constitutive association. Finally, by using transgenic tadpoles expressing a dominant negative SRC3 (F-dnSRC3), we demonstrated that F-dnSRC3 was recruited in a T3-dependent manner in both the intestine and tail, blocking the recruitment of endogenous coactivators and histone acetylation. These results suggest that SRC3 is utilized in a gene- and tissue-specific manner by TR during development. Numerous coactivators that bind nuclear hormone receptors have been isolated and characterized in vitro. Relatively few studies have addressed the developmental roles of these cofactors in vivo. By using the total dependence of amphibian metamorphosis on thyroid hormone (T3) as a model, we have investigated the role of steroid receptor coactivator 3 (SRC3) in gene activation by thyroid hormone receptor (TR) in vivo. First, expression analysis showed that SRC3 was expressed in all tadpole organs analyzed. In addition, during natural as well as T3-induced metamorphosis, SRC3 was up-regulated in both the tail and intestine, two organs that undergo extensive transformations during metamorphosis and the focus of the current study. We then performed chromatin immunoprecipitation assays to investigate whether SRC3 is recruited to endogenous T3 target genes in vivo in developing tadpoles. Surprisingly, we found that SRC3 was recruited in a gene- and tissue-dependent manner to target genes by TR, both upon T3 treatment of premetamorphic tadpoles and during natural metamorphosis. In particular, in the tail, SRC3 was not recruited in a T3-dependent manner to the target TRβA promoter, suggesting either no recruitment or constitutive association. Finally, by using transgenic tadpoles expressing a dominant negative SRC3 (F-dnSRC3), we demonstrated that F-dnSRC3 was recruited in a T3-dependent manner in both the intestine and tail, blocking the recruitment of endogenous coactivators and histone acetylation. These results suggest that SRC3 is utilized in a gene- and tissue-specific manner by TR during development. Thyroid hormone (T3) 1The abbreviations used are: T3, triiodothyronine; RXR, 9-cis-retinoic acid receptor; TR, thyroid hormone receptor; TRE, thyroid hormone response element; ChIP, chromatin immunoprecipitation; RT, reverse transcriptase. affects diverse organ functions and metabolism in vertebrates (1Lazar M.A. Endocr. Rev. 1993; 14: 184-193Crossref PubMed Scopus (811) Google Scholar, 2Shi Y.-B. Amphibian Metamorphosis: From Morphology to Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar, 3Yen P.M. Physiol. Rev. 2001; 81: 1097-1142Crossref PubMed Scopus (1541) Google Scholar) and plays critical roles in postembryonic organogenesis and tissue remodeling in vertebrates (1Lazar M.A. Endocr. Rev. 1993; 14: 184-193Crossref PubMed Scopus (811) Google Scholar, 2Shi Y.-B. Amphibian Metamorphosis: From Morphology to Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar, 3Yen P.M. Physiol. Rev. 2001; 81: 1097-1142Crossref PubMed Scopus (1541) Google Scholar, 4Tata J.R. BioEssays. 1993; 15: 239-248Crossref PubMed Scopus (214) Google Scholar, 5Atkinson B.G. Dev. Genet. 1994; 15: 313-319Crossref Scopus (36) Google Scholar, 6Hetzel B.S. The Story of Iodine Deficiency: An International Challenge in Nutrition. Oxford University Press, Oxford1989Google Scholar). The effects of T3 are mediated by T3 receptors (TRs), which are transcription factors belonging to the nuclear receptor superfamily (3Yen P.M. Physiol. Rev. 2001; 81: 1097-1142Crossref PubMed Scopus (1541) Google Scholar, 7Oppenheimer J.H. Schwartz H.L. Mariash C.N. Kinlaw W.B. Wong N.C. Freake H.C. Endocr. Rev. 1987; 8: 288-308Crossref PubMed Scopus (379) Google Scholar, 8Samuels H.H. Forman B.M. Horowitz Z.D. Ye S. J. Clin. Invest. 1988; 81: 957-967Crossref PubMed Scopus (205) Google Scholar, 9Evans R.M. Science. 1988; 240: 889-895Crossref PubMed Scopus (6324) Google Scholar, 10Mangelsdorf D.J. Thummel C. Beato M. Herrlich P. Schutz G. Umesono K. Blumberg B. Kastner P. Mark M. Chambon P. Cell. 1995; 83: 835-839Abstract Full Text PDF PubMed Scopus (6085) Google Scholar, 11Tsai M.J. O'Malley B.W. Annu. Rev. Biochem. 1994; 63: 451-486Crossref PubMed Scopus (2699) Google Scholar). TR forms a heterodimer with 9-cis-retinoic acid receptor (RXR) and binds to thyroid hormone response elements (TREs) of T3-responsive promoters to modulate transcription. TR/RXR heterodimers function to repress or activate target gene transcription in the absence or presence of T3, respectively, by recruiting corepressors or coactivators (3Yen P.M. Physiol. Rev. 2001; 81: 1097-1142Crossref PubMed Scopus (1541) Google Scholar, 12Ito M. Roeder R.G. Trends Endocrinol. Metab. 2001; 12: 127-134Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar, 13Rachez C. Freedman L.P. Gene (Amst.). 2000; 246: 9-21Crossref PubMed Scopus (289) Google Scholar, 14Zhang J. Lazar M.A. Annu. Rev. Physiol. 2000; 62: 439-466Crossref PubMed Scopus (576) Google Scholar, 15Burke L.J. Baniahmad A. FASEB J. 2000; 14: 1876-1888Crossref PubMed Scopus (175) Google Scholar, 16Jepsen K. Rosenfeld M.G. J. Cell Sci. 2002; 115: 689-698Crossref PubMed Google Scholar, 17Jones P.L. Shi Y.-B. Workman J.L. Current Topics in Microbiology and Immunology: Protein Complexes that Modify Chromatin. Springer-Verlag, Berlin2003: 237-268Google Scholar). The best characterized coactivators for TR belong to the SRC or p160 family, comprising three homologous members, SRC1/NCoA-1, SRC2/TIF2/GRIP1, and SRC3/pCIP/ACTR/AIB-1/RAC-3/TRAM-1 (18Hong H. Kohli K. Trivedi A. Johnson D.L. Stallcup M.R. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 4948-4952Crossref PubMed Scopus (614) Google Scholar, 19Voegel J.J. Heine M.J. Zechel C. Chambon P. Gronemeyer H. EMBO J. 1996; 15: 3667-3675Crossref PubMed Scopus (952) Google Scholar, 20Anzick S.L. Kononen J. Walker R.L. Azorsa D.O. Tanner M.M. Guan X.Y. Sauter G. Kallioniemi O.P. Trent J.M. Meltzer P.S. Science. 1997; 277: 965-968Crossref PubMed Scopus (1432) Google Scholar, 21Chen H. Lin R.J. Schiltz R.L. Chakravarti D. Nash A. Nagy L. Privalsky M.L. Nakatani Y. Evans R.M. Cell. 1997; 90: 569-580Abstract Full Text Full Text PDF PubMed Scopus (1268) Google Scholar, 22Li H. Gomes P.J. Chen J.D. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 8479-8484Crossref PubMed Scopus (504) Google Scholar, 23Takeshita A. Cardona G.R. Koibuchi N. Suen C.S. Chin W.W. J. Biol. Chem. 1997; 272: 27629-27634Abstract Full Text Full Text PDF PubMed Scopus (325) Google Scholar, 24Torchia J. Rose D.W. Inostroza J. Kamei Y. Westin S. Glass C.K. Rosenfeld M.G. Nature. 1997; 387: 677-684Crossref PubMed Scopus (1107) Google Scholar, 25Suen C.S. Berrodin T.J. Mastroeni R. Cheskis B.J. Lyttle C.R. Frail D.E. J. Biol. Chem. 1998; 273: 27645-27653Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar, 26Onate S.A. Tsai S.Y. Tsai M.J. O'Malley B.W. Science. 1995; 270: 1354-1357Crossref PubMed Scopus (2058) Google Scholar). These proteins share considerable structural homology and are evolutionarily related, being about 40% identical among each other, with extensive similarity at the N-terminal basic helix-loop-helix and PAS dimerization domain (27McKenna N.J. Lanz R.B. O'Malley B.W. Endocr. Rev. 1999; 20: 321-344Crossref PubMed Scopus (1654) Google Scholar, 28Westin S. Rosenfeld M.G. Glass C.K. Adv. Pharmacol. 2000; 47: 89-112Crossref PubMed Scopus (91) Google Scholar, 29Leo C. Chen J.D. Gene (Amst.). 2000; 245: 1-11Crossref PubMed Scopus (440) Google Scholar). The central region of SRC proteins contain three leucine rich, LXXLL (L, leucine; X, any amino acid) motifs, forming short amphipathic α-helices (19Voegel J.J. Heine M.J. Zechel C. Chambon P. Gronemeyer H. EMBO J. 1996; 15: 3667-3675Crossref PubMed Scopus (952) Google Scholar, 26Onate S.A. Tsai S.Y. Tsai M.J. O'Malley B.W. Science. 1995; 270: 1354-1357Crossref PubMed Scopus (2058) Google Scholar, 30Heery D.M. Kalkhoven E. Hoare S. Parker M.G. Nature. 1997; 387: 733-736Crossref PubMed Scopus (1772) Google Scholar, 31Ding X.F. Anderson C.M. Ma H. Hong H. Uht R.M. Kushner P.J. Stallcup M.R. Mol. Endocrinol. 1998; 12: 302-313Crossref PubMed Google Scholar, 32Voegel J.J. Heine M.J. Tini M. Vivat V. Chambon P. Gronemeyer H. EMBO J. 1998; 17: 507-519Crossref PubMed Scopus (432) Google Scholar) and constitute the receptor interaction domain. SRC proteins interact with nuclear receptors directly in a ligand-dependent manner and facilitate transcription via distinct activation domains, AD1 and AD2. AD1, which has two LXXLL motifs, can bind to the histone acetyltransferase CBP/p300 (21Chen H. Lin R.J. Schiltz R.L. Chakravarti D. Nash A. Nagy L. Privalsky M.L. Nakatani Y. Evans R.M. Cell. 1997; 90: 569-580Abstract Full Text Full Text PDF PubMed Scopus (1268) Google Scholar, 32Voegel J.J. Heine M.J. Tini M. Vivat V. Chambon P. Gronemeyer H. EMBO J. 1998; 17: 507-519Crossref PubMed Scopus (432) Google Scholar, 33Demarest S.J. Martinez-Yamout M. Chung J. Chen H. Xu W. Dyson H.J. Evans R.M. Wright P.E. Nature. 2002; 415: 549-553Crossref PubMed Scopus (354) Google Scholar). SRCs themselves have also been reported to possess weak intrinsic histone acetyltransferase activity (21Chen H. Lin R.J. Schiltz R.L. Chakravarti D. Nash A. Nagy L. Privalsky M.L. Nakatani Y. Evans R.M. Cell. 1997; 90: 569-580Abstract Full Text Full Text PDF PubMed Scopus (1268) Google Scholar, 34Spencer T.E. Jenster G. Burcin M.M. Allis C.D. Zhou J. Mizzen C.A. McKenna N.J. Onate S.A. Tsai S.Y. Tsai M.J. O'Malley B.W. Nature. 1997; 389: 194-198Crossref PubMed Scopus (1066) Google Scholar). AD2 has been reported to interact with chromatin modifying enzymes including methylases such as coactivator-associated arginine methyltransferase-1 (CARM-1) and protein arginine methyltransferase-1 (PRMT-1) (35Chen D. Ma H. Hong H. Koh S.S. Huang S.M. Schurter B.T. Aswad D.W. Stallcup M.R. Science. 1999; 284: 2174-2177Crossref PubMed Scopus (1003) Google Scholar, 36Koh S.S. Chen D.G. Lee Y.H. Stallcup M.R. J. Biol. Chem. 2001; 276: 1089-1098Abstract Full Text Full Text PDF PubMed Scopus (306) Google Scholar). Despite the enormous accumulation of molecular and biochemical information on coactivator-nuclear receptor interactions, the in vivo role of SRCs and their physiological significance in nuclear receptor-mediated developmental processes in vertebrates have remained essentially unexplored. Even when gene knock-out studies reveal that cofactor deficiency leads to specific development defects (37Xu J. Liao L. Ning G. Yoshida-Komiya H. Deng C. O'Malley B.W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6379-6384Crossref PubMed Scopus (458) Google Scholar, 38Gehin M. Mark M. Dennefeld C. Dierich A. Gronemeyer H. Chambon P. Mol. Cell. Biol. 2002; 22: 5923-5927Crossref PubMed Scopus (224) Google Scholar, 39Yao T.P. Oh S.P. Fuchs M. Zhou N.D. Ch'ng L.E. Newsome D. Bronson R.T. Li E. Livingston D.M. Eckner R. Cell. 1998; 93: 361-372Abstract Full Text Full Text PDF PubMed Scopus (824) Google Scholar, 40Wang Z. Rose D.W. Hermanson O. Liu F. Herman T. Wu W. Szeto D. Gleiberman A. Krones A. Pratt K. Rosenfeld R. Glass C.K. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 13549-13554Crossref PubMed Scopus (170) Google Scholar, 41Jepsen K. Hermanson O. Onami T.M. Gleiberman A.S. Lunyak V. McEvilly R.J. Kurokawa R. Kumar V. Liu F. Seto E. Hedrick S.M. Mandel G. Glass C.K. Rose D.W. Rosenfeld M.G. Cell. 2000; 102: 753-763Abstract Full Text Full Text PDF PubMed Scopus (426) Google Scholar, 42Ito M. Yuan C.X. Okano H.J. Darnell R.B. Roeder R.G. Mol Cell. 2000; 5: 683-693Abstract Full Text Full Text PDF PubMed Scopus (259) Google Scholar), the underlying molecular mechanisms are unknown, largely due to the fact that these cofactors are involved in transcriptional regulation by many diverse transcription factors and the difficulty to access and manipulate postembryonic development in mammals. Amphibian metamorphosis bears strong similarities to postembryonic development in mammals (2Shi Y.-B. Amphibian Metamorphosis: From Morphology to Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar, 4Tata J.R. BioEssays. 1993; 15: 239-248Crossref PubMed Scopus (214) Google Scholar, 5Atkinson B.G. Dev. Genet. 1994; 15: 313-319Crossref Scopus (36) Google Scholar) and offers a unique opportunity to study the role of cofactors in nuclear receptor function in vertebrate development. A major advantage of this model is that all tissues/organs require T3 despite undergoing vastly different transformations during metamorphosis (2Shi Y.-B. Amphibian Metamorphosis: From Morphology to Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar, 43Dodd M.H.I. Dodd J.M. Lofts B. Physiology of the Amphibia. Academic Press, New York1976: 467-599Crossref Google Scholar). These changes range from the development of adult organs de novo from undifferentiated stem cells to the regression of larval-specific organs such as the gills and tail and occur at developmentally distinct stages. All these changes are believed to be due to gene regulation by T3 through TR (44Buchholz D.R. Tomita A. Fu L. Paul B.D. Shi Y.-B. Mol. Cell. Biol. 2004; 24: 9026-9037Crossref PubMed Scopus (115) Google Scholar) and can be easily manipulated by blocking the synthesis of endogenous T3 or adding physiological concentrations of T3 to the tadpole rearing water. We have shown earlier that the mRNAs of TR interacting cofactors, SRC2, SRC3, and p300, are expressed during metamorphosis, among which SRC3 is up-regulated during both natural and T3-induced metamorphosis, supporting a role for this coactivator (45Paul B.D. Shi Y.-B. Cell Res. 2003; 13: 459-464Crossref PubMed Scopus (32) Google Scholar). In this study, we show that SRC3 is also up-regulated at the protein level during natural as well as T3-induced metamorphosis. More importantly, by using chromatin immunoprecipitation (ChIP) assay on wild type and transgenic animals, we demonstrated that SRC3 is recruited to T3-responsive genes in developing animals in a tissue- and gene-dependent manner during both natural and T3-induced metamorphosis, implicating that SRC3 utilization by TR is affected by tissue and promoter context. Animals and Treatment—Wild type tadpoles of the African clawed toad Xenopus laevis were obtained from Xenopus I. Inc. (Dexter, MI), and developmental stages were determined according to Nieuwkoop and Faber (46Nieuwkoop P.D. Faber J. Normal Table of Xenopus laevis. 1st Ed. North Holland Publishing, Amsterdam1956Google Scholar). Stage 54 premetamorphic tadpoles at a density of two tadpoles per liter of deionized water were treated with the indicated amount of T3 for 2–3 days. The concentrations of T3 used were according to published protocols. In the experiments conducted, varying the T3 concentration between 10 and 50 nm did not affect the conclusions. Transgenic tadpoles were generated as described (47Paul B.D. Fu L. Buchholz D.R. Shi Y.-B. Mol. Cell. Biol. 2005; (in press)Google Scholar). RNA Isolation and Reverse Transcriptase PCR (RT-PCR)—RNA was isolated using the TRIzol reagent (Invitrogen) per the manufacturer's recommendations. RT-PCRs were carried out using the Superscript One-Step RT-PCR kit (Invitrogen). The expression of the ribosomal protein L8 (rpl8) was used as an internal control (48Shi Y.-B. Liang V. C.-T. Biochim. Biophys. Acta. 1994; 1217: 227-228Crossref PubMed Scopus (117) Google Scholar). The sequences of the primers used were (5′-3′): CGTGGTGCTCCTCTTGCCAAG and GACGACCAGTACGACGAGCAG for rpl8 (48Shi Y.-B. Liang V. C.-T. Biochim. Biophys. Acta. 1994; 1217: 227-228Crossref PubMed Scopus (117) Google Scholar), CACTTAGCAACAGGGATCAGC and CTTGTCCCAGTAGCAATCATC for TH/bZIP (49Furlow J.D. Brown D.D. Mol. Endocrinol. 1999; 13: 2076-2089Crossref PubMed Scopus (78) Google Scholar), ATAGTTAATGCGCCCGAGGGTGGA and CTTTTCTATTCTCTCCACGCTAGC for TRβA (50Yaoita Y. Shi Y.B. Brown D.D. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 7090-7094Crossref PubMed Scopus (158) Google Scholar), GGACATATGAGTGGATTAGGGGAA and CACGGATCCCTACACATCGTCATTAGA for SRC3 (51Kim H.J. Lee S.K. Na S.Y. Choi H.S. Lee J.W. Mol. Endocrinol. 1998; 12: 1038-1047Crossref PubMed Scopus (43) Google Scholar, 52Metz A. Knoechel S. Buechler P. Koester M. Knoechel W. Mech. Dev. 1998; 74: 29-39Crossref PubMed Scopus (41) Google Scholar), CCTGATGCATGCAAAACT and GTTCATCCTGGAAAGCAG for ST3 (53Patterton D. Hayes W.P. Shi Y.B. Dev. Biol. 1995; 167: 252-262Crossref PubMed Scopus (140) Google Scholar). PCR was also done on RNA samples without reverse transcription as a control for genomic DNA contamination (data not shown). 0.5 μg of total RNA was used in a 25-μl reaction and with the following reaction conditions: 42 °C for 30 min for the RT reaction, followed by 21–25 cycles of 94 °C for 30 s, 55 °C for 30 s and 72 °C for 30 s. The resulting products were analyzed on an agarose gel stained with ethidium bromide. Preparation of Tadpole Tissues for Western Blot Analysis—Tadpoles were sacrificed by decapitation on ice. The dissected organs were sliced into small pieces and homogenized in buffer containing 50 mm Tris-HCl, pH 8.0, 1% SDS, 1 mm dithiothreitol, and protease inhibitor mixture (Roche Diagnostics Corp.). The lysate was centrifuged at 11,000 × g for 5 min, and the protein in the supernatant was quantitated by Bradford's assay (Bio-Rad). Equal amounts of protein were loaded on an 8–16% Tris-glycine gel and transferred onto a polyvinylidene difluoride membrane for Western blot analysis. Chromatin Immunoprecipitation Assays—ChIP assay with tissues from tadpoles was performed as described previously (54Sachs L.M. Shi Y.-B. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 13138-13143Crossref PubMed Scopus (105) Google Scholar, 55Damjanovski S. Sachs L.M. Shi Y.-B. Baniahmad A. Methods in Molecular Biology: Thyroid Hormone Receptors. 202. Humana Press, Inc., Totowa, NJ2002: 153-176Google Scholar) with minor modifications (56Tomita A. Buchholz D.R. Shi Y.-B. Mol. Cell. Biol. 2004; 24: 3337-3346Crossref PubMed Scopus (96) Google Scholar). The following antibodies were used in the assay: anti-Xenopus TR (57Wong J. Shi Y.-B. J. Biol. Chem. 1995; 270: 18479-18483Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar), anti-acetylated histone H4 (Upstate Biotechnology, Lake Placid, NY), anti-FLAG M2-agarose (Sigma), and anti-Xenopus SRC3 (47Paul B.D. Fu L. Buchholz D.R. Shi Y.-B. Mol. Cell. Biol. 2005; (in press)Google Scholar). Immunoprecipitation of dnSRC3 was carried out using anti-FLAG M2-agarose beads (Sigma). Preclearing for the anti-FLAG antibody was done using protein G-Sepharose beads (Amersham Biosciences). After reverse cross-linking, DNA was purified using a PCR purification kit (Qiagen). Quantitative PCR was carried out with ChIP DNA sample in duplicate on an ABI 7000 (Applied Biosystems) using promoter-specific primers and FAM (6-carboxyfluorescein)-labeled Taq-man probes (Applied Biosystems). To perform relative quantitation, six 3-fold serial dilutions from a large batch of ChIP input DNA prepared from intestines prepared especially for the purpose of serving as standards were used for the quantification of the experimental samples. The calculated standard curves ranged in slope from -3.30 to -3.50, where theoretical amplification has a slope of -3.32. Also included was a no template control where double distilled water was added instead of sample DNA as a control for PCR product contamination. Results from the experimental samples were within the range of the standard curve. The primers used for conventional and quantitative PCR were reported previously (44Buchholz D.R. Tomita A. Fu L. Paul B.D. Shi Y.-B. Mol. Cell. Biol. 2004; 24: 9026-9037Crossref PubMed Scopus (115) Google Scholar, 56Tomita A. Buchholz D.R. Shi Y.-B. Mol. Cell. Biol. 2004; 24: 3337-3346Crossref PubMed Scopus (96) Google Scholar). Expression and T3 Regulation of SRC3 in Developing Animals—We studied the expression of SRC3 using RT-PCR in different organs of X. laevis tadpoles. SRC3 was expressed in all organs analyzed, including the intestine, heart, liver, fore limb, hind limb, brain, and tail, with a higher level of expression in the brain (Fig. 1A). We next studied the expression of SRC3 protein during T3-induced metamorphosis in the tail and intestine, two organs that undergo dramatic changes during development (2Shi Y.-B. Amphibian Metamorphosis: From Morphology to Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar, 43Dodd M.H.I. Dodd J.M. Lofts B. Physiology of the Amphibia. Academic Press, New York1976: 467-599Crossref Google Scholar, 58Shi Y.-B. Gilbert L.I. Tata J.R. Atkinson B.G. Metamorphosis: Post-embryonic Reprogramming of Gene Expression in Amphibian and Insect Cells. Academic Press, New York1996: 508-538Google Scholar). X. laevis tadpoles at stage 54 (46Nieuwkoop P.D. Faber J. Normal Table of Xenopus laevis. 1st Ed. North Holland Publishing, Amsterdam1956Google Scholar) were treated with T3, which is known to induce the expression of T3-response genes in these organs and initiate metamorphosis (2Shi Y.-B. Amphibian Metamorphosis: From Morphology to Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar, 43Dodd M.H.I. Dodd J.M. Lofts B. Physiology of the Amphibia. Academic Press, New York1976: 467-599Crossref Google Scholar). The tail and intestine of these animals were dissected out and subjected to Western blotting using anti-SRC3 antibodies to detect the expression of the SRC3 protein. In parallel, total RNA isolated from the two organs was analyzed by RT-PCR to check the expression of the SRC3 transcript. The expression of SRC3 protein was up-regulated in the T3-treated tadpoles in the intestine and tail (Fig. 1, B and D, top panels), just like SRC3 mRNA (Fig. 1, B and D, bottom panels) (45Paul B.D. Shi Y.-B. Cell Res. 2003; 13: 459-464Crossref PubMed Scopus (32) Google Scholar). Furthermore, during natural metamorphosis, the expression of SRC3 was also found to be up-regulated at the climax of metamorphosis (stage 62) as compared with premetamorphosis (stage 54) in the intestine and tail (Fig. 1, C and E, top panels), again like SRC3 mRNA (Fig. 1, B and D, bottom panels) (45Paul B.D. Shi Y.-B. Cell Res. 2003; 13: 459-464Crossref PubMed Scopus (32) Google Scholar). These results suggest a role of SRC3 in tissue transformation during both natural and T3-induced metamorphosis. Gene- and Tissue-dependent Recruitment of SRC3 to T3-responsive Promoters by TR—To study the involvement of SRC3 in T3-mediated transcription in vivo, we focused on the intestine and the tail. The metamorphosis of the intestine and the tail have been well characterized (2Shi Y.-B. Amphibian Metamorphosis: From Morphology to Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar, 43Dodd M.H.I. Dodd J.M. Lofts B. Physiology of the Amphibia. Academic Press, New York1976: 467-599Crossref Google Scholar, 58Shi Y.-B. Gilbert L.I. Tata J.R. Atkinson B.G. Metamorphosis: Post-embryonic Reprogramming of Gene Expression in Amphibian and Insect Cells. Academic Press, New York1996: 508-538Google Scholar). These two organs share a number of similarities. Cell death or apoptosis is the major event at early stages of metamorphosis in both organs. A number of T3-response genes are similarly regulated in both organs (58Shi Y.-B. Gilbert L.I. Tata J.R. Atkinson B.G. Metamorphosis: Post-embryonic Reprogramming of Gene Expression in Amphibian and Insect Cells. Academic Press, New York1996: 508-538Google Scholar), including the TRβA and TH/bZIP genes, whose promoters have been shown to contain TREs (49Furlow J.D. Brown D.D. Mol. Endocrinol. 1999; 13: 2076-2089Crossref PubMed Scopus (78) Google Scholar, 59Ranjan M. Wong J. Shi Y.B. J. Biol. Chem. 1994; 269: 24699-24705Abstract Full Text PDF PubMed Google Scholar). Thus, we carried out ChIP assays to determine the recruitment of endogenous SRC3 to the T3-responsive promoters, TRβA and TH/bZIP in the tail and intestine. We treated premetamorphic X. laevis tadpoles at stage 54 (46Nieuwkoop P.D. Faber J. Normal Table of Xenopus laevis. 1st Ed. North Holland Publishing, Amsterdam1956Google Scholar) with T3 for 2 days, which is known to initiate metamorphosis (2Shi Y.-B. Amphibian Metamorphosis: From Morphology to Molecular Biology. John Wiley & Sons, Inc., New York1999Google Scholar, 43Dodd M.H.I. Dodd J.M. Lofts B. Physiology of the Amphibia. Academic Press, New York1976: 467-599Crossref Google Scholar). As expected, both TRβA and TH/bZIP genes were up-regulated in the intestine and tail as shown by RT-PCR analysis of total RNA isolated from the two organs (Fig. 2, bottom panels). When the nuclei were isolated from the intestine and tail and subjected to ChIP assays with antibodies against TR, acetylated histone H4 (AcH4), and SRC3, we found that as expected, TR was bound constitutively to both promoters, while an increase in levels of acetylated histone H4 was observed with T3 treatment (Fig. 2, A–D, lane 2), correlating with transcriptional activation and consistent with previous results (60Sachs L.M. Damjanovski S. Jones P.L. Li Q. Amano T. Ueda S. Shi Y.B. Ishizuya-Oka A. Comp Biochem. Physiol. B. Biochem. Mol. Biol. 2000; 126: 199-211Crossref PubMed Scopus (105) Google Scholar). In the intestine, an increased association of SRC3 was observed at both TH/bZIP and TRβA promoters upon T3 treatment (lane 2 of Fig. 2, A and B). Surprisingly, in the tail, T3 treatment led to an increased recruitment of SRC3 only at the TH/bZIP promoter (Fig. 2C, lane 2) but not the TRβA promoter (Fig. 2D, lane 2). To investigate whether this tissue- and gene-dependent recruitment of SRC3 is an artifact of precociously metamorphosis induced by T3 or occurs physiologically during metamorphosis, we carried out ChIP assays by using organs isolated from premetamorphic tadpoles or tadpoles at the climax of metamorphosis when endogenous levels of T3 are high. As observed during T3-induced metamorphosis, TR bound the promoters constitutively, and the acetylation levels of histone H4 was much higher at the climax of metamorphosis at both promoters in both organs (lane 2 of Fig. 3, A–D). Furthermore, in the intestine, we found that SRC3 was recruited to both promoters at the climax of metamorphosis (stage 62) but not in premetamorphic tadpoles (stage 54) (Fig. 3, A and B, lane 2). In the tail, SRC3 recruitment to the TH/bZIP promoter was low in premetamorphic tadpoles (stage 54) and high at the climax (stage 62) (Fig. 3C, compare lanes 1 and 2), whereas SRC3 binding to the TRβA promoter was similar or even lower at the climax compared with that in premetamorphic tadpoles (Fig. 3D, lanes 1 and 2). To confirm the differential recruitment of SRC3, we conducted quantitative real-time PCR on the SRC3 ChIP samples. The results again showed that SRC3 was recruited to both the promoters in intestine in a ligand-dependent manner (Fig. 4A) and to the TH/bZIP promoter but not the TRβA promoter in the tail (Fig. 4B). For comparison, the levels of histone H4 acetylation were also analyzed by real-time PCR on the H4 ChIP samples and found to be increased by the T3 treatment in all cases, accompanying gene activation (Fig. 4, C and D). Real time PCR analysis of ChIP samples from premetamorphic (stage 54) and naturally metamorphosing (stage 62) tadpoles yielded essentially identical results, i.e. with increased recruitment of SRC3 to both the promoters in the intestine (Fig. 5A) but only TH/bZIP promoter in tail (Fig. 5B) at the metamorphic climax, and enhanced histone acetylation in all cases (Fig. 5, C and D). Thus, the results from both natural and T3-induced metamorphosis indicate that even though T3-dependent gene activation through TR involves increased acetylation at both promoters in both organs, SRC3 is utilized in a gene- and tissue-specific manner during the T3 activation process. The agreement between T3-induced and natural metamorphosis further argues that this T3-dependent differential recruitment is physiologically important for proper gene regulation and tissue remodeling.Fig. 5Real-time PCR analysis showing differential SRC3 recruitment to T3-dependent promoters during natural metamorphosis. Chromatin was isolated for ChIP assay from the intestine (A, C) and tail (B, D) of premetamorphic tadpoles at stage 54 and metamorphic tadpoles at stage 62. The TRE regions in the ChIP samples were analyzed using quantitative PCR. Three tadpoles were used per treatment.View Large Image
Referência(s)