Conformation, Recognition by High Mobility Group Domain Proteins, and Nucleotide Excision Repair of DNA Intrastrand Cross-links of Novel Antitumor Trinuclear Platinum Complex BBR3464
2001; Elsevier BV; Volume: 276; Issue: 25 Linguagem: Inglês
10.1074/jbc.m103118200
ISSN1083-351X
AutoresJana Zehnulová, Jana Kašpárková, Nicholas P. Farrell, Viktor Brabec,
Tópico(s)DNA and Nucleic Acid Chemistry
ResumoThe new antitumor trinuclear platinum compound [{trans-PtCl(NH3)2}2μ-trans-Pt(NH3)2{H2N(CH2)6NH2}2]4+(designated as BBR3464) is currently in phase II clinical trials. DNA is generally considered the major pharmacological target of platinum drugs. As such it is of considerable interest to understand the patterns of DNA damage. The bifunctional DNA binding of BBR3464 is characterized by the rapid formation of long range intra- and interstrand cross-links. We examined how the structures of the various types of the intrastrand cross-links of BBR3464 affect conformational properties of DNA, and how these adducts are recognized by high mobility group 1 protein and removed from DNA during in vitro nucleotide excision repair reactions. The results have revealed that intrastrand cross-links of BBR3464 create a local conformational distortion, but none of these cross-links results in a stable curvature. In addition, we have observed no recognition of these cross-links by high mobility group 1 proteins, but we have observed effective removal of these adducts from DNA by nucleotide excision repair. These results suggest that the processing of the intrastrand cross-links of BBR3464 in tumor cells sensitive to this drug may not be relevant to its antitumor effects. Hence, polynuclear platinum compounds apparently represent a novel class of platinum anticancer drugs acting by a different mechanism than cisplatin and its analogues. The new antitumor trinuclear platinum compound [{trans-PtCl(NH3)2}2μ-trans-Pt(NH3)2{H2N(CH2)6NH2}2]4+(designated as BBR3464) is currently in phase II clinical trials. DNA is generally considered the major pharmacological target of platinum drugs. As such it is of considerable interest to understand the patterns of DNA damage. The bifunctional DNA binding of BBR3464 is characterized by the rapid formation of long range intra- and interstrand cross-links. We examined how the structures of the various types of the intrastrand cross-links of BBR3464 affect conformational properties of DNA, and how these adducts are recognized by high mobility group 1 protein and removed from DNA during in vitro nucleotide excision repair reactions. The results have revealed that intrastrand cross-links of BBR3464 create a local conformational distortion, but none of these cross-links results in a stable curvature. In addition, we have observed no recognition of these cross-links by high mobility group 1 proteins, but we have observed effective removal of these adducts from DNA by nucleotide excision repair. These results suggest that the processing of the intrastrand cross-links of BBR3464 in tumor cells sensitive to this drug may not be relevant to its antitumor effects. Hence, polynuclear platinum compounds apparently represent a novel class of platinum anticancer drugs acting by a different mechanism than cisplatin and its analogues. cis-diamminedichloroplatinum(II) cross-link high mobility group nucleotide excision repair base pair(s) high mobility group 1 domain A high mobility group 1 domain B dimethyl sulfate diethyl pyrocarbonate fast protein liquid chromatography cell-free extract Chinese hamster ovary bovine serum albumin The trinuclear compound [{trans-PtCl(NH3)2}2μ-trans-Pt(NH3)2{H2N(CH2)6NH2}2]4+(Fig. 1) is currently in phase II clinical trials. The compound, designated as BBR3464, is the lead representative of an entirely new structural class of DNA-modifying anticancer agents based on the poly(di,tri)nuclear platinum structural motif (1Farrell N. Kelland L.R. Farrell N.P. Platinum-based Drugs in Cancer Therapy. Humana Press Inc., Totowa, NJ2000: 321-338Google Scholar, 2Farrell N. Qu Y. Bierbach U. Valsecchi M. Menta E. Lippert B. Cisplatin: Chemistry and Biochemistry of a Leading Anticancer Drug. Wiley-VCH, Weinheim, Germany1999: 479-496Google Scholar, 3Qu Y. Rauter H. Fontes A.P.S. Bandarage R. Kelland L.R. Farrell N. J. Med. Chem. 2000; 43: 3189-3192Crossref PubMed Scopus (65) Google Scholar). In phase I trials, objective partial responses in pancreatic and lung cancers as well as melanoma were observed (4Calvert P.M. Highley M.S. Hughes A.N. Plummer E.R. Azzabi A.S.T. Verrill M.W. Camboni M.G. Verdi E. Bernareggi A. Zuchetti M. Robinson A.M. Carmichael J. Calvert A.H. Clin. Cancer Res. 1999; 5: 3796sGoogle Scholar, 5Sessa C. Capri G. Gianni L. Peccatori F. Grasselli G. Bauer J. Zucchetti M. Vigano L. Gatti A. Minoia C. Liati P. VandenBosch S. Bernareggi A. Camboni G. Marsoni S. Ann. Oncol. 2000; 11: 977-983Abstract Full Text PDF PubMed Scopus (75) Google Scholar). These results suggest the potential for genuinely complementary clinical anticancer activity of BBR3464 in comparison to cis-diamminedichloroplatinum(II) (cisplatin).1 Cisplatin has a major role in combination chemotherapy for several solid tumors, such as germ cell tumors, lung cancer, head and neck cancer, ovarian cancer, and bladder cancer (6Rosenberg B. Lippert B. Cisplatin: Chemistry and Biochemistry of a Leading Anticancer Drug. Wiley-VCH, Weinheim, Germany1999: 3-30Google Scholar, 7Wong E. Giandomenico C.M. Chem. Rev. 1999; 99: 2451-2466Crossref PubMed Scopus (1767) Google Scholar, 8O'Dwyer P.J. Stevenson J.P. Johnson S.W. Lippert B. Cisplatin: Chemistry and Biochemistry of a Leading Anticancer Drug. Wiley-VCH, Weinheim, Germany1999: 31-72Google Scholar, 9O'Dwyer P.J. Stevenson J.P. Johnson S.W. Drugs. 2000; 59: 19-27Crossref PubMed Scopus (202) Google Scholar). The specific choice of BBR3464 as clinical candidate comes from preclinical studies showing cytotoxicity at 10-fold lower concentration than cisplatin and collateral sensitivity in cisplatin-resistant cell lines (1Farrell N. Kelland L.R. Farrell N.P. Platinum-based Drugs in Cancer Therapy. Humana Press Inc., Totowa, NJ2000: 321-338Google Scholar, 4Calvert P.M. Highley M.S. Hughes A.N. Plummer E.R. Azzabi A.S.T. Verrill M.W. Camboni M.G. Verdi E. Bernareggi A. Zuchetti M. Robinson A.M. Carmichael J. Calvert A.H. Clin. Cancer Res. 1999; 5: 3796sGoogle Scholar, 10Perego P. Caserini C. Gatti L. Carenini N. Romanelli S. Supino R. Colangelo D. Viano I. Leone R. Spinelli S. Pezzoni G. Manzotti C. Farrell N. Zunino F. Mol. Pharmacol. 1999; 55: 528-534PubMed Google Scholar). Importantly, BBR3464 also displays consistently high antitumor activity in human tumor xenografts characterized as mutant p53 (1Farrell N. Kelland L.R. Farrell N.P. Platinum-based Drugs in Cancer Therapy. Humana Press Inc., Totowa, NJ2000: 321-338Google Scholar, 11Pratesi G. Perego P. Polizzi D. Righetti S.C. Supino R. Caserini C. Manzotti C. Giuliani F.C. Pezzoni G. Tognella S. Spinelli S. Farrell N. Zunino F. British J. Cancer. 1999; 80: 1912-1919Crossref PubMed Scopus (121) Google Scholar). This important feature suggests that the new agent may find utility in the over 60% of cancer cases where mutant p53 status has been indicated. DNA damage by chemotherapeutic agents is in many cases mediated through the p53 pathway (12Janus F. Albrechtsen N. Dornreiter I. Wiesmüller L. Grosse F. Deppert W. Cell. Mol. Life Sci. 1999; 55: 12-27Crossref PubMed Scopus (122) Google Scholar). Consistently, cytotoxicity displayed in mutant cell lines would suggest an ability to bypass this pathway (11Pratesi G. Perego P. Polizzi D. Righetti S.C. Supino R. Caserini C. Manzotti C. Giuliani F.C. Pezzoni G. Tognella S. Spinelli S. Farrell N. Zunino F. British J. Cancer. 1999; 80: 1912-1919Crossref PubMed Scopus (121) Google Scholar). DNA is generally considered the major pharmacological target of platinum drugs (13Johnson N.P. Butour J.-L. Villani G. Wimmer F.L. Defais M. Pierson V. Brabec V. Prog. Clin. Biochem. Med. 1989; 10: 1-24Crossref Google Scholar). As such it is of considerable interest to understand the patterns of DNA damage that may lead to differential cell signaling induced by polynuclear platinum complexes in comparison to those induced by mononuclear agents such as cisplatin and carboplatin. Previous results have indicated a unique DNA binding profile for BBR3464, strengthening the original hypothesis that modification of DNA binding in manners distinct from that of cisplatin will also lead to a distinct and unique profile of antitumor activity (14Brabec V. Kasparkova J. Vrana O. Novakova O. Cox J.W. Qu Y. Farrell N. Biochemistry. 1999; 38: 6781-6790Crossref PubMed Scopus (215) Google Scholar). The bifunctional DNA binding of BBR3464 is characterized by the rapid formation of long range intra- and interstrand cross-links (CLs). Since the central platinum unit does not contribute to covalent binding to DNA, it is not surprising that the DNA binding profile of BBR3464 is shared by dinuclear platinum compounds with simple diamine and polyamine (spermidine, spermine) linkers (14Brabec V. Kasparkova J. Vrana O. Novakova O. Cox J.W. Qu Y. Farrell N. Biochemistry. 1999; 38: 6781-6790Crossref PubMed Scopus (215) Google Scholar,15Zaludova R. Zakovska A. Kasparkova J. Balcarova Z. Kleinwachter V. Vrana O. Farrell N. Brabec V. Eur. J. Biochem. 1997; 246: 508-517Crossref PubMed Scopus (114) Google Scholar). 2T. D. McGregor, J. Kasparkova, K. Neplechova, O. Novakova, H. Penazova, O. Vrana, V. Brabec, and N. Farrell, submitted for publication. The incorporation into the linker backbone of charge and hydrogen-bonding capacity dramatically increases the DNA affinity and affects the charge/lipophilicity balance as well as increasing the distance between the two platinum-DNA binding coordination spheres. All of these features may contribute to contribute to differentiating DNA binding, cellular uptake, and antitumor activity within the polynuclear platinum family itself (1Farrell N. Kelland L.R. Farrell N.P. Platinum-based Drugs in Cancer Therapy. Humana Press Inc., Totowa, NJ2000: 321-338Google Scholar, 17Roberts J.D. Beggiolin G. Manzotti C. Piazzoni L. Farrell N. J. Inorg. Biochem. 1999; 77: 47-50Crossref PubMed Scopus (72) Google Scholar, 18Roberts J.D. Peroutka J. Farrell N. J. Inorg. Biochem. 1999; 77: 51-57Crossref PubMed Scopus (109) Google Scholar). The high charge on BBR3464 facilitates rapid binding to DNA, which is significantly faster than that of the neutral cisplatin. This feature is also manifested in rapid binding to single-stranded DNA (19Kloster M.B.G. Hannis J.C. Muddiman D.C. Farrell N. Biochemistry. 1999; 38: 14731-14737Crossref PubMed Scopus (74) Google Scholar). Bifunctional binding to duplex DNA preferentially involves guanine (G) residues. Quantitation of interstrand DNA cross-linking in natural and linear DNA indicated ∼20% of the DNA to be interstrand cross-linked. This value is significantly higher than that for cisplatin; on the other hand, an intriguing aspect of BBR3464 is that long range delocalized CLs in which the platinated sites are separated by one or more base pairs are equally or even more probable than interstrand adducts. The (platinum,platinum) intrastrand CLs of BBR3464 are thus analogues of the major adducts of cisplatin, which forms on DNA ∼90% bifunctional intrastrand adducts between neighboring purine residues, affording an unwound duplex with a directional fixed kink and a widened, shallow minor groove (20Jamieson E.R. Lippard S.J. Chem. Rev. 1999; 99: 2467-2498Crossref PubMed Scopus (2639) Google Scholar). The structure of these adducts determined by phasing assay based on gel electrophoresis and by chemical probes of DNA conformation has revealed (21Marrot L. Leng M. Biochemistry. 1989; 28: 1454-1461Crossref PubMed Scopus (65) Google Scholar, 22Schwartz A. Marrot L. Leng M. Biochemistry. 1989; 28: 7975-7978Crossref PubMed Scopus (47) Google Scholar, 23Bellon S.F. Lippard S.J. Biophys. Chem. 1990; 35: 179-188Crossref PubMed Scopus (155) Google Scholar, 24Bellon S.F. Coleman J.H. Lippard S.J. Biochemistry. 1991; 30: 8026-8035Crossref PubMed Scopus (293) Google Scholar) that these adducts induce the overall helix bend of 32–34° toward major groove, DNA unwinding of 13°, severe perturbation of hydrogen bonding within the 5′-coordinated GC bp, and distortion extended over at least 4–5 bp at the site of the CL. Similarly, the minor 1,3-intrastrand CL of cisplatin also bends the helix axis toward the major groove by ∼35° and locally unwinds DNA by ∼23° (24Bellon S.F. Coleman J.H. Lippard S.J. Biochemistry. 1991; 30: 8026-8035Crossref PubMed Scopus (293) Google Scholar, 25Teuben J.M. Bauer C. Wang A.H.J. Reedijk J. Biochemistry. 1999; 38: 12305-12312Crossref PubMed Scopus (75) Google Scholar). Another important feature of the conformational alteration induced by this lesion is that DNA is locally denatured and flexible at the site of the adduct (23Bellon S.F. Lippard S.J. Biophys. Chem. 1990; 35: 179-188Crossref PubMed Scopus (155) Google Scholar, 26Anin M.F. Leng M. Nucleic Acids Res. 1990; 18: 4395-4400Crossref PubMed Scopus (63) Google Scholar), in contrast to the case of the 1,2-intrastrand adduct. Given the recent advances in our understanding of the structural basis for the conformational alteration caused by intrastrand CLs of cisplatin, it is of considerable interest to examine how the structures of the various types of the intrastrand CLs of BBR3464 affect conformational properties of DNA. Some structures altered by platinum adducts, such as stable directional bending and unwinding, attract various damaged DNA-binding proteins such as those containing high mobility group (HMG) domain (27Zlatanova J. Yaneva J. Leuba S.H. FASEB J. 1998; 12: 791-799Crossref PubMed Scopus (117) Google Scholar, 28Ohndorf U.M. Rould M.A. He Q. Pabo C.O. Lippard S.J. Nature. 1999; 399: 708-712Crossref PubMed Scopus (530) Google Scholar, 29Zamble D.B. Lippard S.J. Lippert B. Cisplatin: Chemistry and Biochemistry of a Leading Anticancer Drug. Wiley-VCH, Weinheim, Germany1999: 73-110Google Scholar). This binding of these proteins has been postulated to mediate the antitumor properties of the platinum drugs (28Ohndorf U.M. Rould M.A. He Q. Pabo C.O. Lippard S.J. Nature. 1999; 399: 708-712Crossref PubMed Scopus (530) Google Scholar, 29Zamble D.B. Lippard S.J. Lippert B. Cisplatin: Chemistry and Biochemistry of a Leading Anticancer Drug. Wiley-VCH, Weinheim, Germany1999: 73-110Google Scholar). In addition, several reports have demonstrated (30Zamble D.B. Mu D. Reardon J.T. Sancar A. Lippard S.J. Biochemistry. 1996; 35: 10004-10013Crossref PubMed Scopus (311) Google Scholar, 31Reardon J.T. Vaisman A. Chaney S.G. Sancar A. Cancer Res. 1999; 59: 3968-3971PubMed Google Scholar, 32Moggs J.G. Szymkowski D.E. Yamada M. Karran P. Wood R.D. Nucleic Acids Res. 1997; 25: 480-490Crossref PubMed Scopus (117) Google Scholar) that intrastrand CLs of cisplatin are removed from DNA during nucleotide excision repair (NER) reactions and that NER is also a major mechanism contributing to cisplatin resistance. Therefore, in addition to examining the structural alterations induced in DNA by the intrastrand CLs of BBR3464, we also investigated in the present work how these adducts are recognized by HMG1 protein and removed from DNA during in vitro NER reactions. BBR3464 (Fig. 1) was prepared by standard methods. Cisplatin was obtained from Sigma (Prague, Czech Republic). The stock solutions of platinum compounds were prepared at the concentration of 1 × 10−3min 10 mm NaClO4 and stored at 4 °C in the dark. The synthetic oligodeoxyribonucleotides (Fig. 1) were synthesized and purified as described previously (33Brabec V. Reedijk J. Leng M. Biochemistry. 1992; 31: 12397-12402Crossref PubMed Scopus (136) Google Scholar). HMG1 domain A (HMG1domA) and HMG1 domain B (HMG1domB) (residues 1–84 and 85–180, respectively) were prepared by M. Stros as described previously (34Stros M. J. Biol. Chem. 1998; 273: 10355-10361Abstract Full Text Full Text PDF PubMed Google Scholar); their sequences (34Stros M. J. Biol. Chem. 1998; 273: 10355-10361Abstract Full Text Full Text PDF PubMed Google Scholar) were derived from rat HMG1 cDNA. T4 DNA ligase, T4 polynucleotide kinase, and T4 DNA polymerase were purchased from New England Biolabs (Beverly, MA). Acrylamide, bis(acrylamide), urea, and NaCN were from Merck KgaA (Darmstadt, Germany). Dimethyl sulfate (DMS), KMnO4, diethyl pyrocarbonate (DEPC), KBr, and KHSO5 were from Sigma (Prague, Czech Republic). [γ-32P]ATP was from Amersham Pharmacia Biotech.ATP and deoxyribonucleoside triphosphates were from Roche Molecular Biochemicals (Mannheim, Germany). The single-stranded oligonucleotides (the top strands of the duplexes in Fig. 1) were reacted in stoichiometric amounts with BBR3464. The platinated oligonucleotides were repurified by ion-exchange fast protein liquid chromatography (FPLC). It was verified by platinum flameless atomic absorption spectrophotometry and by the measurements of the optical density that the modified oligonucleotides contained three platinum atoms. It was also verified using DMS footprinting of platinum on DNA (35Brabec V. Leng M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 5345-5349Crossref PubMed Scopus (266) Google Scholar, 36Comess K.M. Costello C.E. Lippard S.J. Biochemistry. 1990; 29: 2102-2110Crossref PubMed Scopus (85) Google Scholar, 37Lemaire M. Thauvette L. Deforesta B. Viel A. Beauregard G. Potier M. Biochem. J. 1990; 267: 431-439Crossref PubMed Scopus (95) Google Scholar) that in the platinated top strands of all duplexes the N7 position of the two guanine (G) residues was not accessible for reaction with DMS. Briefly, platinated and nonmodified top strands (5′ end-labeled with 32P) were reacted with DMS. DMS methylates the N7 position of G residues in DNA, producing alkali-labile sites (38Maxam A.M. Gilbert W. Methods Enzymol. 1980; 65: 499-560Crossref PubMed Scopus (9015) Google Scholar). However, if N7 is coordinated to platinum, it cannot be methylated. The oligonucleotides were then treated with hot piperidine and analyzed by denaturing 24% polyacrylamide gel electrophoresis. For the nonmodified oligonucleotides, shortened fragments due to the cleavage of the strand at one methylated G were observed in the gel. However, no such bands were detected for the oligonucleotides modified by BBR3464. These results indicate that one BBR3464 molecule was coordinated to both G resides in the top strands of all duplexes. If not stated otherwise, the platinated top strands were allowed to anneal with unplatinated complementary strands (bottom strands in Fig. 1) in 50 mm NaCl plus 10 mm Tris-HCl (pH 7.4) and used immediately in further experiments. This annealing procedure included a rapid heating of the mixture of the complementary oligonucleotides to 60 °C followed by the incubation at 25 °C for 2 h. It was verified that under these conditions the intrastrand CLs of BBR3464 were stable for at least 24 h. FPLC purification and flameless atomic absorption spectrophotometry measurements were carried out on an Amersham Pharmacia Biotech FPLC system with MonoQ HR 5/5 column and a Unicam 939 AA spectrometer equipped with a graphite furnace, respectively. Other details have been described previously (33Brabec V. Reedijk J. Leng M. Biochemistry. 1992; 31: 12397-12402Crossref PubMed Scopus (136) Google Scholar, 35Brabec V. Leng M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 5345-5349Crossref PubMed Scopus (266) Google Scholar, 39Brabec V. Sip M. Leng M. Biochemistry. 1993; 32: 11676-11681Crossref PubMed Scopus (112) Google Scholar). The modification by KMnO4, DEPC, and KBr/KHSO5 were performed as described previously (39Brabec V. Sip M. Leng M. Biochemistry. 1993; 32: 11676-11681Crossref PubMed Scopus (112) Google Scholar, 40Bailly C. Gentle D. Hamy F. Purcell M. Waring M.J. Biochem. J. 1994; 300: 165-173Crossref PubMed Scopus (35) Google Scholar, 41Ross S.A. Burrows C.J. Nucleic Acids Res. 1996; 24: 5062-5063Crossref PubMed Scopus (51) Google Scholar, 42Bailly C. Waring M.J. Fox K.R. Drug-DNA Interaction Protocols. Humana Press Inc, Totowa, NJ1997: 51-79Google Scholar). The strands of the duplexes (22 bp shown in Fig. 1 B) were 5′ end-labeled with [γ-32P]ATP. In the case of the platinated oligonucleotides, the platinum complex was removed after reaction of the DNA with the probe by incubation with 0.2 m NaCN (pH 11) at 45 °C for 10 h in the dark. Unplatinated 15- and 19–22-mer single strands (bottom strands in Fig. 1 B) were 5′ end-labeled with [γ-32P]ATP by using T4 polynucleotide kinase. Then they were annealed (see above) with their phosphorylated complementary strands (unplatinated or containing intrastrand CL of BBR3464 between G residues). Unplatinated and intrastrand CL-containing duplexes were allowed to react with T4 DNA ligase. The resulting samples along with ligated unplatinated duplexes were subsequently examined on 8% native polyacrylamide (mono:bis(acrylamide) ratio = 29:1) electrophoresis gels. Other details of these experiments were as described in previously published papers (23Bellon S.F. Lippard S.J. Biophys. Chem. 1990; 35: 179-188Crossref PubMed Scopus (155) Google Scholar, 43Koo H.S. Wu H.M. Crothers D.M. Nature. 1986; 320: 501-506Crossref PubMed Scopus (886) Google Scholar). The 20-mer oligonucleotides 5′-d(AGAAGAAGACCAGAGAGAGG), 5′-d(AGAAGAACACAAGAGAGAGG), or 5′-d(AGAAGAACAACAGAGAGAGG) were 5′ end-labeled and annealed (see above) to their complementary strands 5′-d(CCTCTCTCTG*G*TCTTCTTCT), 5′-d(CCTCTCTCTTG*TG*TTCTTCT), or 5′-d(CCTCTCTCTG*TTG*TTCTTCT) respectively, where the asterisks represent a platinum CL. The duplexes (0.4 nm) were incubated with increasing concentrations of proteins in 20-μl sample volumes containing 10 mm HEPES (pH 7.5), 10 mm MgCl2, 50 mm LiCl, 100 mm NaCl, 1 mm spermidine, 0.2 mg/ml BSA, and 0.05% Nonidet P40. Samples were incubated on ice for 30 min and then made 7% in sucrose and 0.017% in xylene cyanol prior loading on prerun, precooled (4 °C) 6% native polyacrylamide gels (mono:bis(acrylamide) ratio = 29:1). Gels were electrophoresed for 3 h, visualized by using a Molecular Dynamics PhosphorImager (Storm 860 system), and the bands were quantitated with the ImageQuant software. The 20-mer oligonucleotides 5′d(CCTCTCTCTTG*G*TTCTTCTT), 5′d(CCTCTCTCTTG*TG*TTCTTCT), and 5′d(CCTCTCTCTTG*TTTG*TTCTCT), where the asterisks represent a BBR3464 CL, were used for preparation of linear 148-bp duplexes with centrally located 1,2-, 1,3-, or 1,5-intrastrand CL of BBR3464 at nucleotides 75 and 76, 75 and 77, or 75 and 78, respectively. Uniquely modified 20-mers were end-labeled to introduce a radiolabel at the 11th phosphodiester bond 5′ to the CL, annealed with a set of five complementary and partially overlapping oligonucleotides, and ligated with T4 DNA ligase. Full-length substrates were separated from unligated products in a 6% denaturing polyacrylamide gel, purified by electroelution, reannealed, and stored in annealing buffer (50 mm Tris-HCl (pH 7.9), 100 mm NaCl, 10 mm MgCl2, and 1 mm dithiothreitol) at −20 °C. Other details of the purification of DNA substrates for NER were the same as described previously (44Matsunaga T. Mu D. Park C.-H. Reardon J.T. Sancar A. J. Biol. Chem. 1995; 270: 20862-20869Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 45Buschta-Hedayat N. Buterin T. Hess M.T. Missura M. Naegeli H. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 6090-6095Crossref PubMed Scopus (96) Google Scholar). Oligonucleotide excision reactions were performed in cell-free extracts (CFEs) prepared from the HeLa S3 and CHO AA8 cell lines as described (31Reardon J.T. Vaisman A. Chaney S.G. Sancar A. Cancer Res. 1999; 59: 3968-3971PubMed Google Scholar, 46Manley J.L. Fire A. Cano A. Sharp P.A. Gefter M.L. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 3855-3859Crossref PubMed Scopus (735) Google Scholar). These extracts were kindly provided by J. T. Reardon and A. Sancar from the University of North Carolina (Chapel Hill, NC).In vitro repair of intrastrand CLs of BBR3464 was measured with excision assay using these CFEs and 148-bp linear DNA substrates (see above) in the same way as described previously (31Reardon J.T. Vaisman A. Chaney S.G. Sancar A. Cancer Res. 1999; 59: 3968-3971PubMed Google Scholar) with small modifications. The reaction mixtures (25 μl) contained 10 fmol of radiolabeled DNA, 50 μg of CFE, 20 μm each of dATP, dCTP, dGTP, and TTP in the reaction buffer (23 mm HEPES (pH 7.9), 44 mm KCl, 4.8 mm MgCl2, 0.16 mm EDTA, 0.52 mm dithiothreitol, 1.5 mm ATP, 5 μg of BSA, and 2.5% glycerol) and were incubated at 30 °C for 40 min. DNA was deproteinized and precipitated by ethanol. The excision products were separated on 10% denaturing polyacrylamide gels and visualized by using a Molecular Dynamics PhosphorImager (Storm 860 system), and the bands were quantitated with the ImageQuant software. Mapping of incision sites was performed as described in a previous report (31Reardon J.T. Vaisman A. Chaney S.G. Sancar A. Cancer Res. 1999; 59: 3968-3971PubMed Google Scholar) with small modifications. Briefly, the major excision product (gel-purified) was further incubated for 10 min at 30 °C with T4 DNA polymerase (0.15 units) in 10 μl of buffer composed of 50 mm Tris-HCl (pH 8.8), 15 mm(NH4)2SO4, 7 mmMgCl2, 0.1 mm EDTA, 50 mmβ-mercaptoethanol, and 20 μg/ml BSA, supplemented with 0.5 μg ofSmaI-digested pBluescript DNA, and visualized by autoradiography following resolution in 10% denaturing polyacrylamide gel. Similar analyses using radiolabeled, platinated 20-mers (used in the nucleotide excision assays) were also used to identify the nucleotide(s) at which the exonuclease activity of T4 DNA polymerase is blocked 3′ to the lesion. The location of the 5′ incision site made by the excinuclease was determined by comparison with the length of excision products observed in the absence of T4 DNA polymerase digestion. We demonstrated in our previous paper (14Brabec V. Kasparkova J. Vrana O. Novakova O. Cox J.W. Qu Y. Farrell N. Biochemistry. 1999; 38: 6781-6790Crossref PubMed Scopus (215) Google Scholar) that preferential G binding of BBR3464 results in various types of adducts including long range intrastrand and interstrand CLs. Quantitation of cross-linking revealed that intrastrand CLs are equally or even more probable than interstrand adducts. Considering these facts we have designed a series of synthetic oligodeoxyribonucleotide duplexes, TGGT, TGTGT, and TGTTTGT, whose sequences are shown in Fig. 1. The pyrimidine-rich top strands of these duplexes only contained two G residues in the sequences TGGT, TGTGT, and TGTTGT in the center (Fig.1, bold). These top strands were modified by BBR3464 so that they contained a single 1,2-, 1,3-, and 1,5-intrastrand adduct of this platinum complex between two G residues at these central sequences. The 1,2-intrastrand CL is formed between neighboring G sites, whereas, in 1,3- and 1,5-intrastrand CLs, the platinated G sites are separated by one or three nucleotides, respectively. The cross-linked top strands of the duplexes TGGT, TGTGT, or TGTTTGT were hybridized with their complementary strands. The samples of the platinated TGGT, TGTGT, or TGTTTGT duplexes in which the upper strand was only 5′ end-labeled with 32P were reacted with DMS, which does not react with platinated G because the N7 position is no longer accessible (35Brabec V. Leng M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 5345-5349Crossref PubMed Scopus (266) Google Scholar). The adducts were removed by NaCN (36Comess K.M. Costello C.E. Lippard S.J. Biochemistry. 1990; 29: 2102-2110Crossref PubMed Scopus (85) Google Scholar, 47Lemaire M.A. Schwartz A. Rahmouni A.R. Leng M. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 1982-1985Crossref PubMed Scopus (215) Google Scholar), and then the sample was treated with piperidine. In the unplatinated duplexes, the central G residues in the top strands were reactive with DMS (data not shown). They were no longer reactive in all three cross-linked duplexes. This observation confirms that the two G residues in the upper strands remained platinated even after the duplex was formed and were involved in the intrastrand CL (36Comess K.M. Costello C.E. Lippard S.J. Biochemistry. 1990; 29: 2102-2110Crossref PubMed Scopus (85) Google Scholar, 47Lemaire M.A. Schwartz A. Rahmouni A.R. Leng M. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 1982-1985Crossref PubMed Scopus (215) Google Scholar). The oligonucleotide duplexes containing a site-specific 1,2-, 1,3-, or 1,5-intrastrand CL between G residues were further analyzed by chemical probes of DNA conformation. The intrastrand cross-linked duplexes (22-bp, shown in Fig. 1 B) were treated with several chemical agents that are used as tools for monitoring the existence of conformations other than canonical B-DNA. These agents include KMnO4, DEPC, and bromine. They react preferentially with single-stranded DNA and distorted double-stranded DNA (39Brabec V. Sip M. Leng M. Biochemistry. 1993; 32: 11676-11681Crossref PubMed Scopus (112) Google Scholar, 40Bailly C. Gentle D. Hamy F. Purcell M. Waring M.J. Biochem. J. 1994; 300: 165-173Crossref PubMed Scopus (35) Google Scholar, 41Ross S.A. Burrows C.J. Nucleic Acids Res. 1996; 24: 5062-5063Crossref PubMed Scopus (51) Google Scholar, 42Bailly C. Waring M.J. Fox K.R. Drug-DNA Interaction Protocols. Humana Press Inc, Totowa, NJ1997: 51-79Google Scholar, 48Nielsen P.E. J. Mol. Recognit. 1990; 3: 1-24Crossref PubMed Scopus (130) Google Scholar). The results of the analysis by chemical probes of the TGGT(22), TGTGT(22), or TGTTTGT(22) duplexes containing intrastrand CLs of BBR3464 are summarized in Fig. 2 B. KMnO4 is hyperreactive with thymine (T) residues in single-stranded nucleic acids and in distorted DNA as compared with B-DNA (40Bailly C. Gentle D. Hamy F. Purcell M. Waring M.J. Biochem. J. 1994; 300: 165-173Crossref PubMed Scopus (35) Google Scholar, 42Bailly C. Waring M.J. Fox K.R. Drug-DNA Interaction Protocols. Humana Press Inc, Totowa, NJ1997: 51-79Google Scholar, 49McCarthy J.G. Williams L.D. Rich A. Biochemistry. 1990; 29: 6071-6081Cr
Referência(s)