Regulation of Immunoglobulin Promoter Activity by TFII-I Class Transcription Factors
2004; Elsevier BV; Volume: 279; Issue: 7 Linguagem: Inglês
10.1074/jbc.m311177200
ISSN1083-351X
AutoresDean Tantin, Marı́a Isabel Tussié-Luna, Ananda L. Roy, Phillip A. Sharp,
Tópico(s)Galectins and Cancer Biology
ResumoThe restriction of immunoglobulin variable region promoter activity to B lymphocytes is a well known paradigm of promoter specificity. Recently, a cis-element, located downstream of the transcription initiation site of murine heavy chain variable promoters, was shown to be critical for B cell activity and specificity. Here we show that mutation of this element, termed DICE (Downstream Immunoglobulin Control Element), reduces in vivo activity in B cells. Gel mobility shift assays show that DICE forms B cell-specific complexes that were also sensitive to DICE mutation. DICE mutation strongly reduces the ability of a distal immunoglobulin heavy chain intronic enhancer to stimulate transcription. We also identify a DICE-interacting factor: a TFII-I-related protein known as BEN (also termed Mus-TRD1 and WBSCR11). Dominant-negative and RNAi-mediated knockdown experiments indicate that BEN can both positively and negatively regulate IgH promoter activity, depending on the cell line. The restriction of immunoglobulin variable region promoter activity to B lymphocytes is a well known paradigm of promoter specificity. Recently, a cis-element, located downstream of the transcription initiation site of murine heavy chain variable promoters, was shown to be critical for B cell activity and specificity. Here we show that mutation of this element, termed DICE (Downstream Immunoglobulin Control Element), reduces in vivo activity in B cells. Gel mobility shift assays show that DICE forms B cell-specific complexes that were also sensitive to DICE mutation. DICE mutation strongly reduces the ability of a distal immunoglobulin heavy chain intronic enhancer to stimulate transcription. We also identify a DICE-interacting factor: a TFII-I-related protein known as BEN (also termed Mus-TRD1 and WBSCR11). Dominant-negative and RNAi-mediated knockdown experiments indicate that BEN can both positively and negatively regulate IgH promoter activity, depending on the cell line. During development, an organism must exclusively express some genes in particular tissues or cell types. A number of genes and their promoters have been studied in detail in order to obtain general principles from their mechanism of regulation. Among the most intensely studied are the immunoglobulin variable (V) 1The abbreviations used are: VVH and V1/2, variable, heavy, and κ chainJjoiningDdiversityDICEDownstream Immunoglobulin Control ElementEMSAelectrophoretic mobility shift assayMALDITOFmatrix-assisted laser desorption/ionization time-of-flight mass spectrometryGFPgreen fluorescent proteinGSTglutathione S-transferaseppmparts per millionEGFepidermal growth factorsiRNAsmall interfering RNAHIVhuman immunodeficiency virus. region promoters. Ig heavy chain (IgH) and κ light chain (Igκ) genes are selectively expressed in B lymphocytes, and their respective V region (VH and Vκ) promoters are normally inactive in all other tissues (reviewed in Ref. 1Henderson A. Calame K. Annu. Rev. Immunol. 1998; 16: 163-200Crossref PubMed Scopus (112) Google Scholar). The IgH and Igκ loci are sequentially activated during B lymphocyte maturation. Activation includes three principal events. Transcription initiates at various positions within each locus, including the VH and Vκ promoters (2Lennon G.G. Perry R.P. Nature. 1985; 318: 475-478Crossref PubMed Scopus (167) Google Scholar, 3Yancopoulos G.D. Alt F.W. Cell. 1985; 40: 271-281Abstract Full Text PDF PubMed Scopus (556) Google Scholar). Recombination of a V region gene segment with a joining (J) gene segment, in the case of the κ chain, and a diversity (D) and J segment, in the case of the heavy chain, forms an Ig variable region exon of a given specificity (4Tonegawa S. Nature. 1983; 302: 575-581Crossref PubMed Scopus (3292) Google Scholar). Hyperacetylation of chromatin within the Ig loci also makes it less compact and more accessible to trans-acting factors (5Kwon J. Morshead K.B. Guyon J.R. Kingston R.E. Oettinger M.A. Mol. Cell. 2000; 6: 1037-1048Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 6Stanhope-Baker P. Hudson K.M. Shaffer A.L. Constantinescu A. Schlissel M.S. Cell. 1996; 85: 887-897Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar). The relative timing of these three events is unclear; however, it has been shown that non-coding (germ line) transcription precedes recombination for some VH segments (3Yancopoulos G.D. Alt F.W. Cell. 1985; 40: 271-281Abstract Full Text PDF PubMed Scopus (556) Google Scholar, 7Corcoran A.E. Riddell A. Krooshoop D. Venkitaraman A.R. Nature. 1998; 391: 904-907Crossref PubMed Scopus (280) Google Scholar). The direct relationship between these events is also unclear; however, in the heavy chain locus, V-DJ recombination brings a downstream intronic enhancer into proximity with the VH promoter. The relocation of the enhancer greatly stimulates expression of the recombined IgH (reviewed in Ref. 8Henderson A.J. Calame K.L. Crit. Rev. Eukaryotic Gene Expression. 1995; 5: 255-280Crossref PubMed Scopus (12) Google Scholar). These multiple interdependent layers of regulation serve to tightly control Ig expression and prevent activation outside of the normal B cell maturation pathway. VH and V1/2, variable, heavy, and κ chain joining diversity Downstream Immunoglobulin Control Element electrophoretic mobility shift assay matrix-assisted laser desorption/ionization time-of-flight mass spectrometry green fluorescent protein glutathione S-transferase parts per million epidermal growth factor small interfering RNA human immunodeficiency virus. Studies from a number of laboratories have determined that in isolation, VH and Vκ promoters are preferentially active in B lymphocytes (9Mason J.O. Williams G.T. Neuberger M.S. Cell. 1985; 41: 479-487Abstract Full Text PDF PubMed Scopus (171) Google Scholar, 10Bergman Y. Rice D. Grosschedl R. Baltimore D. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 7041-7045Crossref PubMed Scopus (136) Google Scholar). A feature of most VH and Vκ promoters is the octamer motif (5′-ATGCAAAT-3′), located 10-25 nucleotides upstream of the TATA box (and inverted in the case of Vκ) (9Mason J.O. Williams G.T. Neuberger M.S. Cell. 1985; 41: 479-487Abstract Full Text PDF PubMed Scopus (171) Google Scholar, 11Parslow T.G. Blair D.L. Murphy W.J. Granner D.K. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 2650-2654Crossref PubMed Scopus (363) Google Scholar, 12Ballard D.W. Bothwell A. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 9626-9630Crossref PubMed Scopus (61) Google Scholar, 13Falkner F.G. Zachau H.G. Nature. 1984; 310: 71-74Crossref PubMed Scopus (431) Google Scholar, 14Nakajima N. Horikoshi M. Roeder R.G. Mol. Cell. Biol. 1988; 8: 4028-4040Crossref PubMed Scopus (356) Google Scholar). By using model constructs, the octamer motif appears to be a mediator of Ig promoter B cell specificity (15Wirth T. Staudt L. Baltimore D. Nature. 1987; 329: 174-178Crossref PubMed Scopus (264) Google Scholar); however, the same sequence occurs in numerous other genes, most of which are not B cell-specific. For example, the U1 small nuclear RNA and histone H2B genes both contain functional octamer sequences and are ubiquitously expressed (16Murphy J.T. Burgess R.R. Dahlberg J.E. Lund E. Cell. 1982; 29: 265-274Abstract Full Text PDF PubMed Scopus (87) Google Scholar, 17Sive H.L. Heintz N. Roeder R.G. Mol. Cell. Biol. 1986; 6: 3329-3340Crossref PubMed Scopus (98) Google Scholar, 18Gunderson S.I. Murphy J.T. Knuth M.W. Steinberg T.H. Dahlberg J.H. Burgess R.R. J. Biol. Chem. 1988; 263: 17603-17610Abstract Full Text PDF PubMed Google Scholar). Therefore, it is likely that the contribution of the octamer toward B cell specificity is dictated by other determinants within the promoter, otherwise octamer-containing genes such as U1 and H2B would also be expressed in a B cell-specific manner. In B cells, the octamer motif interacts with two POU domain transcription factors termed Oct-1 and Oct-2. Oct-1 (19Staudt L.M. Singh H. Sen R. Wirth T. Sharp P.A. Baltimore D. Nature. 1986; 323: 640-643Crossref PubMed Scopus (408) Google Scholar, 20Singh H. Sen R. Baltimore D. Sharp P.A. Nature. 1986; 319: 154-158Crossref PubMed Scopus (692) Google Scholar, 21Sturm R.A. Das G. Herr W. Genes Dev. 1988; 2: 1582-1599Crossref PubMed Scopus (520) Google Scholar) has a wide tissue distribution, whereas Oct-2 (22Clerc R.G. Corcoran L.M. LeBowitz J.H. Baltimore D. Sharp P.A. Genes Dev. 1988; 2: 1570-1581Crossref PubMed Scopus (316) Google Scholar, 23Scheidereit C. Cromlish J.A. Gerster T. Kawakami K. Balmaceda C.G. Currie R.A. Roeder R.G. Nature. 1988; 336: 551-557Crossref PubMed Scopus (265) Google Scholar) is more B cell-restricted. Genetic analyses have shown that Oct-2 is dispensable for B cell development and Ig transcription (24Corcoran L.M. Karvelas M. Nossal G.J. Ye Z.S. Jacks T. Baltimore D. Genes Dev. 1993; 7: 570-582Crossref PubMed Scopus (242) Google Scholar, 25Feldhaus A.L. Klug C.A. Arvin K.L. Singh H. EMBO J. 1993; 12: 2763-2772Crossref PubMed Scopus (71) Google Scholar). A similar finding has been made in this laboratory using Oct-1-deficient mice in this laboratory. 2V. E. H. Wang, D. Tantin, J. Chen, and P. A. Sharp, submitted. A co-activator of Oct-1 and Oct-2, principally expressed in B cells, has also been described (26Luo Y. Roeder R.G. Mol. Cell. Biol. 1995; 15: 4115-4124Crossref PubMed Scopus (250) Google Scholar, 27Gstaiger M. Knoepfel L. Georgiev O. Schaffner W. Hovens C.M. Nature. 1995; 373: 360-362Crossref PubMed Scopus (287) Google Scholar, 28Strubin M. Newell J.W. Matthias P. Cell. 1995; 80: 497-506Abstract Full Text PDF PubMed Scopus (350) Google Scholar). This protein, termed OCA-B/Bob-1/OBF-1, is also dispensable for Ig gene expression (29Kim U. Qin X.F. Gong S. Stevens S. Luo Y. Nussensweig M. Roeder R.G. Nature. 1996; 383: 542-547Crossref PubMed Scopus (218) Google Scholar, 30Nielson P.J. Georgiev O. Lorentz B. Schaffner W. Eur. J. Immunol. 1996; 26: 3214-3218Crossref PubMed Scopus (123) Google Scholar, 31Schubart D.B. Rolink A. Kosco-Vilbois R.G. Botteri F. Matthias P. Nature. 1996; 383: 538-542Crossref PubMed Scopus (251) Google Scholar). Previously, we have shown that a widespread DNA sequence, located downstream of the transcription initiation site, is an important determinant of IgH promoter activity and B lymphoid selectivity (32Tantin D. Sharp P.A. Mol. Cell. Biol. 2002; 22: 1460-1473Crossref PubMed Scopus (7) Google Scholar). This sequence is present in many IgH and some Igκ promoters. Here we further characterize the properties of this element (termed DICE), and we show that DICE can interact with a protein known as BEN/MusTRD1. The prototypic member of this family, TFII-I (also known as BAP-135), can also bind DICE with high affinity in vitro. Surprisingly, dominant-negative and RNAi knockdown experiments reveal negative as well as positive roles for BEN. We also report that DICE helps mediate the activity of the IgH intronic enhancer, as mutation of the DICE sequence reduces enhancer activity. Plasmid Constructs—The DICE sequences from the 186.2 promoter GenBank™ accession number J00530 were used in these experiments. The plasmid pGL3IgH-154+1 chim has been described (32Tantin D. Sharp P.A. Mol. Cell. Biol. 2002; 22: 1460-1473Crossref PubMed Scopus (7) Google Scholar). The corresponding point mutated plasmids were made by introducing mutated 186.2 DICE sequences into the plasmid pGL3IgH-154+1 that had been digested with HindIII and treated with alkaline phosphatase. Complimentary oligonucleotides with HindIII overhangs and phosphate groups at their 5′ ends were annealed and ligated into the digested pGL3IgH+1 plasmid, yielding the plasmids pGL3VH17.2.25/mut1 chimera and pGL3VH17.2.25/186.2mut2 chimera. The 4 oligonucleotides used are shown 5′ to 3′ as follows: Hin186.2mut1 TOP, AGCTTGATCATCGGGATCTTTACAGTTAGGAAGCACACAGGA; Hin186.2mut1BOT, AGCTTCCTGTGTGCTTCCTAACTGTAAAGATCCCAGTGATCA; Hin186.2mut2TOP, AGCTTGATCACTGTTCTCTTTTTTGTTACTGAGCACTTTGGA; and Hin186.2mut2BOT, AGCTTCCAAAGTGCTCAGTAAAAAAAAGAGAACAGTGATCA. The boldface sequence indicates the positions of the mutations. Orientation and sequence were verified by DNA sequencing. The IgH intronic enhancer was introduced into a distal XbaI site using the method described (32Tantin D. Sharp P.A. Mol. Cell. Biol. 2002; 22: 1460-1473Crossref PubMed Scopus (7) Google Scholar). The orientation of the enhancer was checked using the asymmetric BamHI site. All constructs used the same orientation. For siRNA knockdown of BEN, an siRNA (siRNA 2) that recognizes nucleotides 1244-1265 of the β isoform of mouse BEN (relative to the start codon) was used. These residues are in exon 9 and correspond to amino acids 414-422, within the second helix-loop-helix repeat of the protein. The sequence of the transcribed and cleaved siRNA is predicted to be CGACACAGCAUUCACUUCAUU. Cell Culture and Transfections—Cell lines were cultured, and transfections were performed using the FuGENE 6 transfection reagent as described (32Tantin D. Sharp P.A. Mol. Cell. Biol. 2002; 22: 1460-1473Crossref PubMed Scopus (7) Google Scholar). The plasmid pRL-TK (Promega), containing the Renilla luciferase gene under the control of the thymidine kinase promoter, was used as an internal transfection control. Activity was scored by the dual luciferase assay (Promega). Nuclear Extract—B cell nuclear extracts were prepared from cells growing in suspension in 8-liter batches according to the method of Dignam et al. (33Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (9586) Google Scholar). 3T3 extracts were prepared from batches of 16 15-cm plates. EMSA—The double-stranded oligonucleotides described above were also used as probes in gel mobility shift assays. The HindIII overhangs were filled in with Klenow fragment using radiolabeled [α-32P]dATP and [α-32P]dTTP. All probes were gel-purified. Gel mobility shift experiments were performed as described (34Roy A.L. Du H. Gregor P.D. Novina C.D. Martinez E. Roeder R.G. EMBO J. 1997; 16: 7091-7104Crossref PubMed Scopus (172) Google Scholar) with modifications. Briefly, 20-μl binding reactions were assembled on ice and contained 1 mg/ml bovine serum albumin, 1 mm dithiothreitol, 0.6× binding buffer (1× binding buffer: 20 mm Tris, pH 7.5, 100 mm NaCl, 1 mm EDTA, 20% glycerol), either 400 ng of poly(dA·dT) or 700 ng of poly(dI·dC), ∼200 cpm (∼10 μmol) of labeled double-stranded oligonucleotide probe, and the indicated amount of nuclear extract or purified protein. Subsequent to the addition of labeled probe, the samples were placed at room temperature for 20 min, after which 10 μl of sample were electrophoresed through a 0.75-mm thick 5% polyacrylamide gel (29:1 acrylamide: bis-acrylamide) containing 1% glycerol and 0.5× TBE (45 mm Tris borate, pH 8.0, 1 mm EDTA) for 2.5 h at room temperature at 100 V. After electrophoresis, the gel was dried and exposed using a Molecular Dynamics PhosphorImager from Amersham Biosciences and visualized using imaging software provided by the vendor. Latex Microspheres and Mass Spectroscopy—DNA-coated latex beads were obtained from the laboratory of Hiroshi Handa (Frontier Collaborative Research Center, Japan). The methods for coupling the beads with DNA have been described (35Handa H. Yamaguchi Y. Wada T. Millner P. High Resolution Chromatography: A Practical Approach. Oxford University Press, Oxford1999: 283-302Google Scholar). BEN was purified and identified from a 70Z/3 nuclear extract as follows: 250 μg of nuclear extract were incubated in a 1.7-ml Eppendorf tube with 17.5 μg of poly(dI·dC) and 10 μl of packed beads in a final volume of 500 μl containing 16 mm Hepes, pH 7.9, 200 mm KCl, 1 mm EDTA, 16% glycerol, 1 mm dithiothreitol, and 1 mg/ml bovine serum albumin for 20 min at room temperature, after which the mixture was centrifuged at 16,000 × g for 5 min at room temperature to pellet the beads. The supernatant was removed, and the beads were sequentially washed in buffer containing 200, 300, and 300 mm KCl. The beads were resuspended in 20 μl of SDS-PAGE loading buffer and heated to 90 °C for 2 min, and 10 μl were electrophoresed through a 10% SDS-polyacrylamide gel. Following silver staining and excision of the bands of interest, the silver grains were removed by treatment with 15 mm potassium ferricyanide and 50 mm sodium thiosulfate. The gel slice was digested with trypsin in 25 mm NH4HCO3 overnight (36Gharahdaghi F. Weinberg C.R. Meagher D.A. Imai B.S. Mische S.M. Electrophoresis. 1999; 20: 601-605Crossref PubMed Scopus (843) Google Scholar, 37Shevchenko A. Wilm M. Vorm O. Mann M. Anal. Chem. 1996; 68: 850-858Crossref PubMed Scopus (7884) Google Scholar). Peptides were eluted with two extractions of CH3CN and combined. The tryptic peptides were dried, reconstituted with 8 μl of 0.1% trifluoroacetic acid, desalted on a C18 Zip Tip (Millipore), and eluted with 4 μl of 50% CH3CN, 0.1% trifluoroacetic acid. The eluate was dried and reconstituted in 1 μl of re-crystallized α-cyano-4-hydroxycinnamic acid matrix, and 0.5 μl was applied to separate matrixassisted laser desorption/ionization-time of flight mass spectrometry (MALDI-TOF; Applied Biosystems model Voyager DESTR). Samples were analyzed in reflector mode, and the resulting spectra were screened against the NCBI data base (released June 6, 2002) using the Protein Prospector search engine (University of California, San Francisco). Purification of BEN, BEN L38/45P, and TFII-I—10 μg of plasmids encoding His6 and GST-tagged recombinant human BEN and TFII-I were transiently transfected into 293T cells. Parallel transfections with the green fluorescent protein under the control of a constitutive mammalian promoter showed a transfection efficiency of greater than 90%. The proteins were purified as described (38Cheriyath V. Roy A.L. J. Biol. Chem. 2000; 275: 26300-26308Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). Immunoprecipitation and Western Blotting—40 h post-transfection, COS7 cells were harvested, washed twice in phosphate-buffered saline, and lysed in lysis buffer (25 mm Tris-Cl, pH 8.0, 100 mm KCl, 10% glycerol, 5 mm NaF, 2 mm Na3VO4, 0.5% Nonidet P-40, and 0.1% Triton X-100) containing antiprotease mixture without EDTA (Roche Applied Science) for 30 min at 4 °C. After centrifugation at 16,000 × g for 15 min at 4 °C, the protein concentration of the supernatant was measured by the Bradford method (Bio-Rad). 250 μg of the lysate was used with the anti-GFP IP and 800 μg with the anti-TFII-I immunoprecipitation. The lysates were incubated with protein G-Sepharose (Amersham Biosciences) for 2 h of rocking at 4 °C. The Sepharose beads were then washed three times in 1 ml of lysis buffer lacking the Nonidet P-40 detergent. The beads were boiled in SDS-PAGE loading buffer for 2 min, and Western-blotted using antibodies to GFP GST-2 (Sigma) and GFP JL-8 (Clontech). The proteins were detected by chemiluminescence using ECL (Amersham Biosciences). Characteristics of DICE—In transient transfection experiments, luciferase reporter constructs containing VH promoters are preferentially expressed in B cell lines. Promoter deletion and mutagenesis of the murine 7183 family 17.2.25 promoter revealed a DNA sequence downstream of the transcription initiation site that was critical for the high promoter activity in B cells. A Gibbs motif sampler (39Lawrence C.E. Altschul S.F. Boguski M.S. Liu J.S. Neuwald A.F. Wootton J.C. Science. 1993; 262: 208-214Crossref PubMed Scopus (1459) Google Scholar) was used to show that this element is a feature of most VH and some Vκ downstream promoter regions (32Tantin D. Sharp P.A. Mol. Cell. Biol. 2002; 22: 1460-1473Crossref PubMed Scopus (7) Google Scholar). Here we term this element DICE for Downstream Immunoglobulin Control Element. DICE is composed of a 5′ end rich in pyrimidine residues and a 3′ end with a strong preference for ACAG. Interestingly, the best DICE matches were found in J558-class promoters, the most distal VH family with the most intrinsically active promoters. For example, the J558-class VH186.2 (B1-8) core promoter region contains three consensus sequences, two of which are downstream of the transcription initiation site. The first of these downstream sites is a perfect match (Fig. 1A). Searching the eukaryotic promoter data base (residues -499 to +100 relative to the transcription initiation site) for DICE did not reveal any strong non-immunoglobulin matches to the consensus (not shown). Deletion of DICE from the VH17.2.25 promoter results in a significant loss of promoter activity, which can be restored by introducing the downstream sequences from the VH186.2 promoter (32Tantin D. Sharp P.A. Mol. Cell. Biol. 2002; 22: 1460-1473Crossref PubMed Scopus (7) Google Scholar). To extend and expand upon these results, point mutations were introduced into the VH186.2 DICE consensus sequences. These mutant sequences were placed into the VH17.2.25 promoter and tested by transient transfection. In parallel, the same sequences were radiolabeled and used in EMSA to determine whether sequence- and B cell-specific nucleoprotein complexes could be identified. Fig. 1A shows the two DICE mutations used. Mutant 1 changes residues 3-5 in the 5′ end of the consensus to GGA, whereas mutant 2 changes residues 11-13 in the 3′ end to TTT. Fig. 1B depicts the averaged results from three parallel transfections by using the human B cell line BJA-B. Insertion of VH17.2.25 promoter DNA (residues -154 to +35 relative to the transcription initiation site) into the backbone vector pGL3 strongly increases reporter expression. Removal of sequences downstream of the transcription initiation site from +2 to +35 resulted in significant downregulation of promoter activity. As reported previously, replacing these residues with the corresponding sequences from the VH 186.2 promoter (IgH chimera) restores activity and results in a significant increase in activity over wild-type levels. This increase in activity may be explained by the fact that the VH186.2 downstream region contains two DICE sequences, one of which is a better match to the consensus than the DICE sequence present in 17.2.25. When mutant sequences replaced the wild-type DICE, promoter activity was reduced. In the case of mutant 1, promoter activity was markedly attenuated and approximated the activity of a construct containing no downstream promoter residues. Mutant 2 was less severe. In the gel mobility shift experiment shown in Fig. 1C, DNA segments containing the wild-type and point-mutated 186.2 residues were labeled and incubated with fibroblast (3T3) or BJA-B B cell nuclear extracts. The 3T3 extracts formed limited complexes with the 186.2 DICE sequence, which were unaffected by point mutation (lanes 2 and 3, 7 and 8, and 12 and 13). B cell extracts formed more robust nucleoprotein complexes (lanes 4 and 5) composed of two bands: a major slower mobility band (asterisk) and a minor band of faster mobility (arrow). The major band was strongly reduced with mutant 1 (lanes 9 and 10), whereas the minor band was ablated using mutant 2 (lanes 14 and 15). Similar results were obtained with extracts from murine 70Z/3 B cells (not shown). Therefore, the severity of the mutations for gene expression in vivo mirrors the degree to which complex formation is impaired with B cell extracts in vitro. The presence of two bands that can be independently affected by point mutation also suggests that DICE is composed of at least two binding sites. The complex formation observed with DICE also is highly non-linear, as a 2-fold increase in protein concentration yields a much more than linear increase in intensity (compare lanes 4 and 5). The complex could be efficiently competed by a 20-fold excess of unlabeled DNA containing the wild-type 186.2 DICE sequence, much less well using the mutant 1 DICE sequence, but not with unrelated polylinker DNA of similar length, a sequence of 24 alternating A and T residues, or single-stranded DNA (not shown). The IgH intronic enhancer is a potent B cell-specific control element (40Mercola M. Wang X.F. Olsen J. Calame K. Science. 1983; 221: 663-665Crossref PubMed Scopus (74) Google Scholar, 41Banerji J. Olson L. Schaffner W. Cell. 1983; 33: 729-740Abstract Full Text PDF PubMed Scopus (755) Google Scholar, 42Gillies S.D. Morrison S.L. Oi V.T. Tonegawa S. Cell. 1983; 33: 717-728Abstract Full Text PDF PubMed Scopus (760) Google Scholar) that interacts with numerous transcription factors, including those of the Oct, Ets, and helix-loop-helix families (8Henderson A.J. Calame K.L. Crit. Rev. Eukaryotic Gene Expression. 1995; 5: 255-280Crossref PubMed Scopus (12) Google Scholar, 43Sen R. Baltimore D. Cell. 1986; 46: 705-716Abstract Full Text PDF PubMed Scopus (2088) Google Scholar). V-DJ recombination relocates the intronic enhancer from greater than 100 kb to less than 10 kb downstream from the selected V region. From this relatively proximal location, the enhancer strongly stimulates VH promoter activity. At least one report suggests that the intronic enhancer more effectively activates VH promoters than unrelated promoters (44Garcia J.V. Bich-Thuy L.T. Stafford J. Queen C. Nature. 1986; 322: 383-385Crossref PubMed Scopus (60) Google Scholar). To assess the role of DICE in this promoter-enhancer interaction, the 700-bp core enhancer element was placed into an XbaI site 1.7 kb downstream of the reporter gene in plasmids containing wild-type and point mutant DICE sequences. These new constructs (termed EIgH chimera and EIgH mutant 1) were used in transient transfection assays with the BJA-B cells. As expected, addition of the intronic enhancer (EIg chimera) greatly stimulated reporter activity beyond that observed with the chimeric V promoter alone (IgH chimera; see Fig. 2). More importantly, the DICE point mutation eliminated the ability of a distal enhancer element to stimulate promoter expression, as the reporter activity from the promoter containing DICE mutant 1 (Ig mutant 1) displayed no increase in activity in the presence of the enhancer (EIg mutant 1). BEN/MusTRD1 Interacts with DICE—To isolate factors that interact with DICE, latex microspheres coupled to the wild-type VH186.2 segment ("DICE WT") were incubated with 70Z/3 B cell nuclear extracts and carrier DNA (35Handa H. Yamaguchi Y. Wada T. Millner P. High Resolution Chromatography: A Practical Approach. Oxford University Press, Oxford1999: 283-302Google Scholar, 45Inomata Y. Kawaguchi H. Hiramoto M. Wada T. Handa H. Anal. Biochem. 1992; 206: 109-114Crossref PubMed Scopus (66) Google Scholar). The beads were washed with 300 mm KCl, boiled in SDS loading buffer, electrophoresed through 10% SDS-PAGE gels, and silver-stained (Fig. 3A). In repeated experiments, a number of proteins were retained on the beads containing DNA. Most of these proteins were also retained using mutant 1 DNA sequences, but the degree of binding was much lower for an ∼110-kDa band (arrow). This band was excised from the gel for further analysis. Matrix-assisted laser desorption/ionization-time of flight (MALDI-TOF) mass spectroscopy of tryptic fragments from the ∼110-kDa protein identified 24 peptides. The Protein Prospector search engine (University of California, San Francisco) matched 11 of these peptides to a protein known as BEN/MusTRD/GTF2IRD1/WBSCR11 (46Yan X. Zhao X. Qian M. Guo N. Gong X. Zhu X. Biochem. J. 2000; 345: 749-757Crossref PubMed Scopus (32) Google Scholar, 47O'Mahoney J.V. Guven K.L. Lin J. Joya J.E. Robinson C.S. Wade R.P. Hardeman E.C. Mol. Cell. Biol. 1998; 18: 6641-6652Crossref PubMed Scopus (71) Google Scholar, 48Osborne L.R. Campbell T. Daradich A. Scherer S.W. Tsui L.C. Genomics. 1999; 57: 279-284Crossref PubMed Scopus (53) Google Scholar, 49Bayarsaihan D. Ruddle F.H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 7342-7347Crossref PubMed Scopus (64) Google Scholar) with a mean error of -6.9 parts per million (Δppm) (Table I). There are a number of BEN isoforms ranging from 65 to 150 kDa, with a known isoform of 105 kDa (49Bayarsaihan D. Ruddle F.H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 7342-7347Crossref PubMed Scopus (64) Google Scholar). Re-calibration of the mass spectroscopy peak set using the masses of two matched BEN peptides improved the average Δppm of the remaining peptides to +0.42 (not shown). A non-overlapping set of peptides from the same band matched mMutS/MSH2, a 104-kDa protein involved in mismatch repair. This match was not studied further but may partially account for the background band seen in the mutant DNA sequence lane (lane 3).Table IMALDI-TOF mass spectroscopy peptide matches to GTF2IRD1/BEN (all isoforms) Research Engine: MS-Fit; database: NCBI (release June 6, 2002).PeptideMassΔppmModificationMissed cleavagesStart-endSequence11086.4917–7.81 Cys-am0229–238DCGLHGQASK21086.4917–4.70649–657EPVLDTQER31120.5928+260692–700EQVQDLFNK41351.7306+151 PO41681–691LSRIDIANTLR51379.7190+330739–750KPCTFGSQNLER61739.8243–37Cys-am0380–395IACDPEAVEIVGIPDK71780.8977–3.11Met-Ox, 1 PO41213–228ALVEMNGISLLPKGSR82297.1994–160594–613FLMHPEELFVLGLPEGISLR92313.1960–151 Met-Ox0594–613FLMHPEELFVLGLPEGISLR102383.9382–482 PO4127–47KDELINSLVSALDSMCSALSK112819.3097–180542–566GPSEEPWSEERPAEESPGDVIRPLR Open table in a new tab Three of the peptides matched to BEN were predicted to be phosphorylated (Table I). The software algorithm NetPhos (50Blom N. Gammeltoft S. Brunak S. J. Mol. Biol. 1999; 294: 1351-1362Crossref PubMed Scopus (2581) Google Scholar) was used to predict potential phosphorylation sites within the BEN primary sequence. Of the three peptides, two contained predicted phosphorylation targets. Conversely, only one of the remaining seven unphosphorylated peptides was predicted to be a phosphorylation target. Although indirect, these findings provide support for t
Referência(s)