Gene therapy for human α1-antitrypsin deficiency in an animal model using SV40-Derived vectors
2004; Elsevier BV; Volume: 127; Issue: 4 Linguagem: Inglês
10.1053/j.gastro.2004.07.058
ISSN1528-0012
AutoresYuyou Duan, Jian Wu, Jian–Liang Zhu, Shu–Ling Liu, Iwata Ozaki, David S. Strayer, Mark Α. Zern,
Tópico(s)Animal Genetics and Reproduction
ResumoBackground & Aims:In most genetic diseases, the goal of gene therapy is to deliver a particular transgene; however, sometimes a deleterious gene product must be eliminated. Because of the promise of recombinant simian virus 40 (rSV40) vectors, we tested their ability to deliver a transgene and to target a transcript for destruction by direct administration of the vectors to the liver of an animal model for human α1-antitrypsin (α1-AT) deficiency. Methods:Therapy of human α1-AT deficiency requires stable transduction of resting hepatocytes, both to deliver wild-type α1-AT and to inhibit production of mutant α1-AT. Transgenic mice carrying the mutant human α1-AT PiZ allele were treated through an indwelling portal vein catheter with a simian virus 40 (SV40)-derived vector carrying a ribozyme designed to target the human transcript. Results: Treated transgenic mice showed marked decreases of human α1-AT messenger RNA and the protein in the liver, and serum levels of human α1-AT were decreased to 50% ± 5% of pretreatment values 3–16 weeks after transduction. Moreover, when normal mice were treated with an SV40-derived vector containing a modified human α1-AT complementary DNA engineered to be resistant to cleavage by the α1-AT ribozyme, they expressed human α1-AT messenger RNA and protein in their livers and serum levels of human α1-AT remained >1 μg/mL for 1 year. Conclusions:These results represent the initial steps toward a novel approach to the gene therapy of α1-AT deficiency. Background & Aims:In most genetic diseases, the goal of gene therapy is to deliver a particular transgene; however, sometimes a deleterious gene product must be eliminated. Because of the promise of recombinant simian virus 40 (rSV40) vectors, we tested their ability to deliver a transgene and to target a transcript for destruction by direct administration of the vectors to the liver of an animal model for human α1-antitrypsin (α1-AT) deficiency. Methods:Therapy of human α1-AT deficiency requires stable transduction of resting hepatocytes, both to deliver wild-type α1-AT and to inhibit production of mutant α1-AT. Transgenic mice carrying the mutant human α1-AT PiZ allele were treated through an indwelling portal vein catheter with a simian virus 40 (SV40)-derived vector carrying a ribozyme designed to target the human transcript. Results: Treated transgenic mice showed marked decreases of human α1-AT messenger RNA and the protein in the liver, and serum levels of human α1-AT were decreased to 50% ± 5% of pretreatment values 3–16 weeks after transduction. Moreover, when normal mice were treated with an SV40-derived vector containing a modified human α1-AT complementary DNA engineered to be resistant to cleavage by the α1-AT ribozyme, they expressed human α1-AT messenger RNA and protein in their livers and serum levels of human α1-AT remained >1 μg/mL for 1 year. Conclusions:These results represent the initial steps toward a novel approach to the gene therapy of α1-AT deficiency. To be effective, a viral gene delivery vehicle for liver-directed therapy of genetic diseases should (1) provide for stable transgene expression sustained over a prolonged period; (2) be relatively nonimmunogenic and nontoxic to avoid hepatocyte necrosis and allow repeat administration; (3) be available at high titers to enable transduction of a large percentage of hepatocytes; (4) transduce resting cells, because most hepatocytes are not cycling at any specific point in time; and (5) be replication deficient. To satisfy these requirements, we have established a vector system based on simian virus 40 (SV40) for gene delivery to the liver. Our previous studies indicated that SV40-derived vectors meet all of the criteria previously mentioned, including stable expression of the transgene for more than 1 year. Thus, they are excellent candidates for in vivo hepatic gene therapy.1Strayer D.S. Kondo R. Milano J. Duan L.-X. Use of SV40-based vectors to transduce foreign genes to normal human peripheral blood mononuclear cells.Gene Ther. 1997; 4: 219-225Crossref PubMed Scopus (67) Google Scholar, 2Strayer D.S. Zern M.A. Gene delivery to the liver using simian virus 40-derived vectors.Semin Liver Dis. 1999; 19: 71-81Crossref PubMed Scopus (30) Google Scholar, 3Strayer D.S. Zern M.A. Chowdhury J.R. What can SV40-derived vectors do for gene therapy.Curr Opin Mol Ther. 2002; 4: 313-323PubMed Google Scholarα1-Antitrypsin (α1-AT) deficiency is a genetic disorder that leads to emphysema and chronic liver disease. The lung disease is believed to reflect insufficient normal α1-AT activity in the circulation,4Hubbard R. Crystal R. α1-antitrypsin augmentation therapy for α1-antitrypsin deficiency.Am J Med. 1988; 84: 52-62Abstract Full Text PDF PubMed Scopus (91) Google Scholar whereas the liver disease occurs because abnormal α1-AT accumulates in hepatocytes.5Errickson S. Velez R. Risk of cirrhosis and primary liver cancer in α1-antitrypsin deficiency.N Engl J Med. 1986; 314: 736-739Crossref PubMed Scopus (475) Google Scholar To address both the hepatic and pulmonary manifestations of the disease, we developed a strategy that would both inhibit the synthesis of the abnormal protein and lead to synthesis of the normal protein. The first objective was accomplished by using hammerhead ribozymes designed to cleave mutated α1-AT messenger RNA (mRNA) at a specific site. We determined that these ribozymes inhibited α1-AT expression in a hepatoma cell line, PLC/PRF/5.6Ozaki I. Zern M.A. Liu S.L. Wei D.L. Pomerantz R.J. Duan L.X. Ribozyme-mediated specific gene replacement of α1-antitrypsin gene in human hepatoma cells.J Hepatol. 1999; 31: 53-60Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 7Zern M.A. Ozaki I. Duan L.-X. Pomerantz R. Liu S.-L. Strayer D.S. A novel SV40-based vector successfully transduces and expresses an α1-antitrypsin ribozyme in a human hepatoma-derived cell line.Gene Ther. 1999; 6: 114-120Crossref PubMed Scopus (47) Google Scholar The second step in this approach was to deliver functional α1-AT that would not be recognized by the ribozymes used to target the mutated α1-AT mRNA. Therefore, we modified the base sequences of the human α1-AT complementary DNA (cDNA) at the site targeted by the ribozyme, without changing the normal amino acid sequence, to yield an mRNA product resistant to the site-specific hammerhead ribozyme cleavage.7Zern M.A. Ozaki I. Duan L.-X. Pomerantz R. Liu S.-L. Strayer D.S. A novel SV40-based vector successfully transduces and expresses an α1-antitrypsin ribozyme in a human hepatoma-derived cell line.Gene Ther. 1999; 6: 114-120Crossref PubMed Scopus (47) Google ScholarIn the present study, we report the use of the SV40-derived ribozyme and modified cDNA vectors in mice. Our results suggest that this novel approach for the gene therapy of α1-AT deficiency is an effective strategy when the SV40-derived vectors are used as a delivery system.Materials and methodsRecombinant SV40 vectorsProduction of recombinant Tag-deleted SV40 viruses has been described elsewhere.1Strayer D.S. Kondo R. Milano J. Duan L.-X. Use of SV40-based vectors to transduce foreign genes to normal human peripheral blood mononuclear cells.Gene Ther. 1997; 4: 219-225Crossref PubMed Scopus (67) Google Scholar, 2Strayer D.S. Zern M.A. Gene delivery to the liver using simian virus 40-derived vectors.Semin Liver Dis. 1999; 19: 71-81Crossref PubMed Scopus (30) Google Scholar, 3Strayer D.S. Zern M.A. Chowdhury J.R. What can SV40-derived vectors do for gene therapy.Curr Opin Mol Ther. 2002; 4: 313-323PubMed Google Scholar, 7Zern M.A. Ozaki I. Duan L.-X. Pomerantz R. Liu S.-L. Strayer D.S. A novel SV40-based vector successfully transduces and expresses an α1-antitrypsin ribozyme in a human hepatoma-derived cell line.Gene Ther. 1999; 6: 114-120Crossref PubMed Scopus (47) Google Scholar Briefly, the Tag and tag genes were excised from the viral genome and replaced by a polylinker with bacterial phage SP6 and T7 promoters downstream from 2 tandem SV40 early promoters. This viral genome, cloned into pGEM13 as a NotI fragment,1Strayer D.S. Kondo R. Milano J. Duan L.-X. Use of SV40-based vectors to transduce foreign genes to normal human peripheral blood mononuclear cells.Gene Ther. 1997; 4: 219-225Crossref PubMed Scopus (67) Google Scholar, 2Strayer D.S. Zern M.A. Gene delivery to the liver using simian virus 40-derived vectors.Semin Liver Dis. 1999; 19: 71-81Crossref PubMed Scopus (30) Google Scholar, 3Strayer D.S. Zern M.A. Chowdhury J.R. What can SV40-derived vectors do for gene therapy.Curr Opin Mol Ther. 2002; 4: 313-323PubMed Google Scholar is called pSV5. The SP6 and T7 sequences were included in the polylinker to facilitate the sequencing of the cloned inserts by using standard SP6 and T7 primers. The modified SV40 viral genome was recombined with a portion of pT7Blue plasmid (Novagen, Madison, WI) at the PmeI site by removing pGEM13 sequence from pSV5 with NotI to form a new SV40 construct, pT7SVP. SV40 viral DNA in pT7SVP remains almost the same as wild-type SV40 after removing Tag and tag genes. It contains intact late genes (3 capsid genes, one regulatory gene), regulatory sequences (SV40 promoters, polyAs for early and late genes, and so on), origin of SV40 replication, and packing signals. The pT7 plasmid DNA as a carrier in pT7SVP contains the replication origin of the plasmid and an ampicillin-resistant gene. Recombinant SV40 (rSV40)-derived replication-deficient viruses could be produced by removing pT7 plasmid carrier after gene cloning.A modified α1-AT cDNA resistant to an α1-AT ribozyme yet capable of producing a wild-type protein has been described in detail.7Zern M.A. Ozaki I. Duan L.-X. Pomerantz R. Liu S.-L. Strayer D.S. A novel SV40-based vector successfully transduces and expresses an α1-antitrypsin ribozyme in a human hepatoma-derived cell line.Gene Ther. 1999; 6: 114-120Crossref PubMed Scopus (47) Google Scholar The construct entails altering the third nucleotide of each amino acid codon in the region flanking the target region of the AT589 ribozyme. As a template for the modified α1-AT cDNA, the full-length cDNA of α1-AT was cloned into pT7Blue-T vector to generate pT7 α1-AT by reverse-transcription polymerase chain reaction (RT-PCR) from the RNA extracted from HepG2 hepatoma cells. For introduction of the mutations, 2 primers containing modified nucleotide sequences of α1-AT were synthesized. First, 2 PCR fragments were amplified by using Vent DNA Polymerase (New England Biolabs, Mississauga, Ontario, Canada). These 2 PCR products were mixed and annealed, and then an extension reaction was performed with Taq DNA polymerase (Perkin-Elmer, Branchburg, NJ). This mixture was used for PCR amplification as the template for the generation of the modified α1-AT. The PCR products were then cloned into the pT7Blue-T vector to generate pT7m α1-AT. A 1.3-kilobase fragment containing the modified α1-AT cDNA excised from pT7α-AT with XbaI and XhoI, blunted by Klenow, was then cloned into the blunted XhoI site of pT7SVP vector to be expressed under the control of the 2 SV40 early promoters (Figure 1). The orientation of modified α1-AT cDNA was verified by PCR using primersSP6 and T7.The details of the construction and screening of functional α1-AT ribozymes have been reported by us previously.6Ozaki I. Zern M.A. Liu S.L. Wei D.L. Pomerantz R.J. Duan L.X. Ribozyme-mediated specific gene replacement of α1-antitrypsin gene in human hepatoma cells.J Hepatol. 1999; 31: 53-60Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar Briefly, 11–15 bases of antisense sequence against α1-AT mRNA were flanked on both sides of the hammerhead motif to allow the ribozyme to associate with α1-AT mRNA through their complementary sequences. For the construction of the ribozymes, 2 complementary oligonucleotides were synthesized on the DNA synthesizer (model 392; Applied Biosystems, Inc., Foster City, CA). The ribozymes were synthesized by incubating 2 oligonucleotides to form a hemiduplex, and PCR amplifications were performed. The PCR products were then cloned directly into the pT7Blue-T vector to generate a plasmid pT7ATRzs. The ribozyme construct, containing a transfer RNA promoter,6Ozaki I. Zern M.A. Liu S.L. Wei D.L. Pomerantz R.J. Duan L.X. Ribozyme-mediated specific gene replacement of α1-antitrypsin gene in human hepatoma cells.J Hepatol. 1999; 31: 53-60Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar was then cloned into the multiple cloning site of pT7SV(Δ) vector that was derived from pBSV-1, containing the modified SV40 genome (Figure 1).2Strayer D.S. Zern M.A. Gene delivery to the liver using simian virus 40-derived vectors.Semin Liver Dis. 1999; 19: 71-81Crossref PubMed Scopus (30) Google ScholarIn all cases, recombinant viruses were produced by removing the carrier plasmid from rSV40 vectors with PmeI, recircularizing it, and transfecting it into a packaging cell line (COS-7 cells). Tag is required for virus replication8Myers R.M. Tjian R. Construction and analysis of simian virus 40 origins defective in tumor antigen binding and DNA replication.Proc Natl Acad Sci U S A. 1980; 77: 6491-6495Crossref PubMed Scopus (107) Google Scholar, 9Tornow J. Polvino-Bodnar M. Santangelo G. Cole C.N. Two separable functional domains of simian virus 40 large T antigen: carboxyl-terminal region of simian virus 40 large T antigen is required for efficient capsid protein synthesis.J Virol. 1985; 53: 415-424Crossref PubMed Google Scholar; however, Tag expressed by a packaging cell line can support viral replication in trans.10Lehn H. Human papillomavirus DNA replication mediated by simian virus 40 T antigen in trans.J Gen Virol. 1986; 67: 1581-1589Crossref PubMed Scopus (3) Google Scholar The resulting modified SV40 viruses were called SV(mAT) and SV(AT589T). Crude viruses from cell lysates of COS-7 cells were band purified by discontinuous sucrose density gradient ultracentrifugation. Virus stocks were titrated by in situ PCR using a method we developed specifically for this purpose.11Strayer D.S. Duan L. Ozaki I. Milano J. Bobraski L.E. Bagastra O. Titering replication-defective virus for use in gene transfer.Biotechniques. 1997; 22: 447-450PubMed Google ScholarIn vitro transductionThe human hepatoma cell lines HLE, HLF (kindly provided by Health Science Research Resources Bank, Tokyo, Japan), and PLC/PRF/5 (from American Type Culture Collection, Manassas, VA) were grown in Dulbecco's modified Eagle medium supplemented with 10% fetal bovine serum. HLE and HLF cells, with a very low level of α1-AT mRNA, were seeded at 5 × 105 cells/60-mm dish and transduced the next day with SV(mAT) containing the modified α1-AT cDNA (100 μL of rSV40 at a titer of 1.2 × 1012 IU/mL). PLC/PRF/5 cells with a high level of α1-AT mRNA were also seeded at 5 × 105 cells/60-mm dish and transduced with SV(AT589T) containing the ribozyme (100 μL of rSV40 at a titer of 1.2 × 1012 IU/mL). Total RNA from transduced or untransduced cells was extracted using RNeasy Mini Kit (Qiagen, Valencia, CA) at 72 hours after transduction, quantitated, and kept at −80°C until further use. cDNA was generated from the RNA template and used for the evaluation of α1-AT mRNA levels in the transduced cells by quantitative RT-PCR as described in the following text.Animal experimentsTransgenic mice expressing mutant human α1-AT (PiZ allele) were a kind gift from Stratagene, Inc. (La Jolla, CA). Surgical procedures for the placement of an indwelling catheter into the portal vein and subsequent injections through the catheter were performed according to Vrancken et al.12Vrancken Peeters M.J.T.F.D. Lieber A. Perkins J. Kay M.A. Method for multiple portal vein infusions in mice: quantitation of adenovirus-mediated hepatic gene transfer.Biotechniques. 1996; 20: 278-285PubMed Google Scholar and described in detail13Liu L. Zern M.A. Lizarzburu M.E. Nantz M.H. Wu J. Poly(cationic lipid)-mediated in vivo gene delivery to mouse liver.Gene Ther. 2003; 10: 180-187Crossref PubMed Scopus (51) Google Scholar and approved by the Animal Care and Use Administrative Advisory Committee of the University of California, Davis. The animals were anesthetized with pentobarbital (60 mg/kg) for the surgical procedures and recovered 2–4 hours after the operation. The transgenic mice, which were confirmed to possess the human α1-AT PiZ gene by PCR, were used for the experiments. Transgenic mice or ICR mice were injected with the recombinant viruses multiple times through the indwelling catheter in the portal vein while under ether anesthesia. The injections followed a designed protocol, as detailed in Results. The total volume of each injection was approximately 0.3 mL. Blood samples were collected by tail incision at various intervals following viral injection, and the animals were killed to obtain liver tissue at the end of the observation period.In situ RT-PCRThis method for evaluating transduced viral gene expression, developed by Bagasra et al., has been described elsewhere.14Bagasra O. Hauptman S.P. Lischner H.W. Sachs M. Pomerantz R.J. Detection of human immunodeficiency virus type 1 in mononuclear cells by in situ polymerase chain reaction.N Engl J Med. 1992; 326: 385-391Crossref Scopus (251) Google Scholar, 15Bagasra O, Seshamna T, Hansen J, Pomerantz RJ. In situ polymerase chain reaction and hybridization to detect low abundance nucleic acid targets. In: Ausubel FM, et al., eds. Current protocols in molecular biology. New York, NY: Wiley, 1995:14.8.1–14.8.23.Google Scholar Briefly, paraffin-fixed sections of the livers were transferred to specially designed, siliconized slides. Slides were then fixed and treated with proteinase K and hydrogen peroxide. To perform the amplification of RNA sequences for the SV40 viral vector, reverse transcription was performed for the specific sequences using antisense primers. For this purpose, specimens were first treated with ribonuclease-free deoxyribonuclease in a humidified chamber. Reverse transcription of the viral transcripts to cDNA was performed using the downstream oligonucleotide (oligo[dT]20; Invitrogen Life Technologies, Carlsbad, CA) as a primer. A slide well without reverse transcriptase was used as a negative control to test for DNA contamination. A DNA/in situ/PCR amplification procedure was then performed using a viral gene-specific primer pair (forward primer, 5′AAACTGTGACTGGTGTGAGCGCTG3′; reverse primer, 5′ACCCCAATGTCTGGGGTCAAGATA3′, with an amplicon of 220 base pairs from the overlapping DNA fragment between the SV40 VP1 and VP2 genes). These slides were placed in a specifically designed heat block of a thermocycler for amplification. Hybridization was performed with the biotinylated oligonucleotide probes (5′CAGGAATGGCTGTAGATTTGTATAGGCCAGATGATTACTATGATATTTTATTTCCTGGAG3′; Sigma Genosys, The Woodlands, TX). The tissue sections were washed to remove unbound probes and incubated with avidin-peroxidase. Color was developed with 3-amino-9-ethylcarbazole. The tissues were counterstained with Gill's hematoxylin. An additional control for the in situ PCR experiments included the use of nonsense primer sets for vector amplification.RNA analysisTotal RNA both from the livers of transgenic and ICR mice and from PLC/PRF/5, HLE, and HLF cells was extracted by a modification of the method of Chomczynski and Sacchi16Chomczynski P. Sacchi N. Single-step method of RNA extraction by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem. 1987; 162: 156-159Crossref PubMed Scopus (62986) Google Scholar using the RNeasy Mini Kit (Qiagen). Expression of mRNA from livers was detected by Northern blot hybridization analysis as previously described6Ozaki I. Zern M.A. Liu S.L. Wei D.L. Pomerantz R.J. Duan L.X. Ribozyme-mediated specific gene replacement of α1-antitrypsin gene in human hepatoma cells.J Hepatol. 1999; 31: 53-60Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 7Zern M.A. Ozaki I. Duan L.-X. Pomerantz R. Liu S.-L. Strayer D.S. A novel SV40-based vector successfully transduces and expresses an α1-antitrypsin ribozyme in a human hepatoma-derived cell line.Gene Ther. 1999; 6: 114-120Crossref PubMed Scopus (47) Google Scholar using a human α1-AT cDNA probe and using human transferrin and 28S as controls.Gene expression of human α1-AT, mouse α1-AT, mouse albumin, and mouse β-actin from cells and mouse livers was also evaluated by real-time quantitative RT-PCR as described in detail by us previously.17Wege H. Le H.T. Chui M.S. Liu L. Wu J. Giri R. Malhi H. Sappal B.S. Kumaran V. Gupta S. Zern M.A. Telomerase reconstitution immortalizes human fetal hepatocytes without disrupting their differentiation potential.Gastroenterology. 2003; 124: 432-444Abstract Full Text PDF PubMed Scopus (158) Google Scholar Following the digestion with deoxyribonuclease I, total RNA was used to generate cDNA by using ThermoScript RT-PCR Systems and oligo(dT)20 (Applied Biosystems) to prime first-strand synthesis. The generated cDNA was used for quantitative PCR amplification. TaqMan PCR was used to quantitate expression of human α1-AT in comparison with human-specific glyceraldehyde-3-phosphate dehydrogenase (in human hepatoma cell lines) or mouse-specific β-actin (in mouse tissue) as housekeeping controls. SYBR PCR was used to quantitate expression of mouse α1-AT and mouse albumin in comparison with mouse-specific β-actin as housekeeping control. Following amplification with the TaqMan Universal PCR Master Mix (Applied Biosystems) or SYBR PCR Master Mix (Applied Biosystems) in the ABI Prism 7700 Thermal Cycler (Applied Biosystems), semilog amplification curves were determined by calculation of ΔΔCT and expression levels were normalized to the housekeeping controls. All primers and probes are listed in Table 1 (primers/probe set for human-specific glyceraldehyde-3-phosphate dehydrogenase amplification; Applied Biosystems) and were specifically designed based on human or murine target gene sequences.Table 1Primer/Probe Sets Used in This StudyGenePrimer/probe sets5′-LabelingaAll hybridization probes were quenched with 6-carboxytetramethylrhodamine. F, forward primer; P, hybridization probe; FAM, 6-carboxyfluorescein; R, reverse primer.Concentration (nmol/L)Primers for TaqMan PCR Human α1-ATF: TCGCTACAGCCTTTGCAATG300P: AGCCTTCATGGATCTGAGCCTCCGGFAM300R: TTGAGGGTACGGAGGAGTTCC50 Mouse β-actinF: ACGGCCAGGTCATCACTATTG300P: CAACGAGCGGTTCCGATGCCCFAM300R: ATACCCAAGAAGGAAGGCTGGA50Primers for SYBR PCR Mouse α1-ATF: GGGTGACACTCACACGCAGA300R: TGGATGTCAGCCTCCGATG50 Mouse albuminF: GCAAGGCTGCTGACAAGGA300R: GGCGTCTTTGCATCTAGTGACA50 Mouse β-actinF: ACGGCCAGGTCATCACTATTG300R: ATACCCAAGAAGGAAGGCTGGA50a All hybridization probes were quenched with 6-carboxytetramethylrhodamine. F, forward primer; P, hybridization probe; FAM, 6-carboxyfluorescein; R, reverse primer. Open table in a new tab Protein extraction and western blot analysisProteins from livers of transgenic and ICR mice were extracted as previously described18Frizell E. Liu S.L. Abraham A. Ozaki I. Eghbali M. Sage E.H. Zern M.A. Expression of SPARC in normal and fibrotic livers.Hepatology. 1995; 21: 847-854PubMed Google Scholar and were detected by Western blot analysis as previously described.6Ozaki I. Zern M.A. Liu S.L. Wei D.L. Pomerantz R.J. Duan L.X. Ribozyme-mediated specific gene replacement of α1-antitrypsin gene in human hepatoma cells.J Hepatol. 1999; 31: 53-60Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 7Zern M.A. Ozaki I. Duan L.-X. Pomerantz R. Liu S.-L. Strayer D.S. A novel SV40-based vector successfully transduces and expresses an α1-antitrypsin ribozyme in a human hepatoma-derived cell line.Gene Ther. 1999; 6: 114-120Crossref PubMed Scopus (47) Google Scholar Primary goat anti-human α1-AT antibodies (MP Biomedicals, Inc., Irvine, CA) were used for detection of human α1-AT, and primary rabbit anti-mouse albumin antibodies (MP Biomedicals, Inc.) were used for detection of mouse albumin. Donkey anti-goat immunoglobulin (Ig) G horseradish peroxidase conjugate and goat anti-rabbit IgG horseradish peroxidase conjugate (Santa Cruz Biotechnology, Inc., Santa Cruz, CA) were used as second antibodies for imaging by enhanced chemiluminescence imaging reagents (Amersham Bioscience, Buckinghamshire, UK). Cruz Marker MW standard (Santa Cruz Biotechnology, Inc.) was loaded for reference. Densitometry analysis for Western blots was performed with a Molecular Dynamics ImageQuaNTTM program (Sunnyvale, CA).Enzyme-linked immunosorbent assay for human α1-AT in mouse serumMouse blood samples were collected by tail incision at different intervals after the injection of viral vectors. Human α1-AT levels in mouse serum were quantified by enzyme-linked immunosorbent assay (ELISA) with mouse anti-human α1-AT monoclonal antibodies (Chemicon International, Inc., Temecula, CA) as coating antibodies (in 35 mmol/L absorption carbonate buffer, pH 9.6, coating overnight, at 4°C) and rabbit anti-human α1-AT IgG (Boehringer Mannheim, Indianapolis, IN) as capture antibodies in blocking buffer (1% bovine serum albumin in 1.0 mmol/L phosphate-buffered saline, pH 7.4). Peroxidase-conjugated goat anti-rabbit IgG (Dako, Carpinteria, CA) was applied as a detection antibody in washing buffer (0.1% Tween 20 in blocking buffer), and o-phenylenediamine (Sigma Chemical Co., St. Louis, MO) was used for color development in phosphate-citrate buffer (pH 5) containing 1.5 μL/mL of 30% H2O2 at room temperature for 150 seconds. The reaction was stopped by the addition of 2.0 mol/L H2SO4 before spectrophotometric measurement of absorbency at 490 nm. The sensitivity of detection for purified human α1-AT (Sigma Chemical Co.) and for human α1-AT in mouse serum was 0.1 ng/mL. This ELISA could not detect any human α1-AT in normal mouse serum.Statistical analysisData from in vitro transduction experiments were analyzed using unpaired Student t test. The serum levels of human α1-AT in transgenic mice before and after rSV40 infection were evaluated by Wilcoxon signed rank sum test. P < 0.05 was considered statistically significant.ResultsTransduction of SV40-derived ribozyme and α1-AT-modified cDNA vectors in hepatoma cell linesThree days after transduction with SV(mAT) containing the modified α1-AT cDNA, quantitative RT-PCR showed that human α1-AT expression in 2 hepatoma cell lines, HLE and HLF, was enhanced by 14- ± 0.6-fold and 13.2- ± 0.4-fold, respectively, compared with untransduced cells (Figure 2A). Human α1-AT mRNA levels in PLC/PRF/5 cells transduced with SV(AT589T) containing the ribozyme were reduced to 30% ± 3.8% at 72 hours compared with untransduced cells (Figure 2B).Figure 2Effects of SV40-derived vectors on human α1-AT mRNA levels in human hepatoma cells. (A) Quantitative RT-PCR analysis of human α1-AT expression in HLE and HLF cells after transduction with SV(mAT), containing human α1-AT–modified cDNA. RNA was extracted from the transduced HLE or HLF cells 72 hours after transduction, and α1-AT mRNA levels were evaluated by quantitative RT-PCR using human glyceraldehyde-3-phosphate dehydrogenase as a housekeeping gene. The data were summarized from 2 independent experiments and expressed as fold increase compared with untransduced cells. (B) Quantitative RT-PCR analysis of human α1-AT mRNA levels in PLC/PRF/5 cells after transduction with SV(AT589T), containing α1-AT ribozyme. Human α1-AT mRNA levels in the transduced cells were determined 72 hours after the transduction by quantitative RT-PCR using human glyceraldehyde-3-phosphate dehydrogenase as a housekeeping gene and expressed as relative levels of gene expression based on untransduced controls. The data were summarized from 5 independent experiments. ***P < 0.001 compared with controls.View Large Image Figure ViewerDownload (PPT)In vivo transduction efficiencyTwo inoculations daily for 4 days with the SV40-derived vector designed to deliver the modified α1-AT cDNA, SV(mAT), transduced approximately 90% of hepatocytes, as evaluated by in situ RT-PCR (Figure 3A). This figure shows the presence of RNA transcribed from the modified virus. Control mouse liver was negative (Figure 3B). Pathologic immune responses, hepatocyte necrosis, and inflammation were not apparent despite high levels of infection (Figure 3C). Serum alanine aminotransferase levels were normal when the mice were tested 2 days after the last injection (data not shown).Figure 3In situ RT-PCR of a liver section after injection with SV(mAT) via the portal vein. Mice were injected 8 times over 4 days through an indwelling catheter in the portal vein. Each injection consisted of 0.3 mL of high-titer virus (∼1 × 1012 IU/mL). For the amplification of RNA sequences for SV40, reverse transcription was performed for the specific sequences using antisense primers as described in Materials and Methods. Brown color is indicative of SV40 RNA within the cells. (A) Injected mouse liver. The mouse was killed 2 days after the last injection. (B) Untransduced mouse liver. (C) Histology of the liver from a mouse after 2 inoculations a day for 4 days with SV(mAT), containing modified α1-AT cDNA (H&E staining). The mouse was killed 4 days after the last injection.View Large Image Figure ViewerDownload (PPT)Long-term human α1-AT production in ICR mice after the inoculation of an SV40-derived vector containing modified α1-AT cDNAWhen RNA was extracted from the livers of normal mice that had been treated with an rSV40 vector containing the modified α1-AT cDNA, Northern blot analysis showed successful transduction of the modified human α1-AT in the mouse liver. No human α1-AT transcripts were found in the untreated mice, even
Referência(s)