Ionizing Radiation Induces ATM-independent Degradation of p21Cip1 in Transformed Cells
2009; Elsevier BV; Volume: 284; Issue: 22 Linguagem: Inglês
10.1074/jbc.m808810200
ISSN1083-351X
AutoresScott A. Stuart, Jean Y. J. Wang,
Tópico(s)DNA Repair Mechanisms
ResumoThe cyclin-dependent kinase inhibitor p21Cip1 plays an important role in the cellular response to DNA damage. In normal cells, genotoxic stress activates the ATM-p53 pathway that up-regulates the expression of p21Cip1 leading to cell cycle arrest. However, we have found that in several neoplastic cell lines, ionizing radiation (IR) induces ubiquitin-dependent degradation of p21Cip1. This process is independent of the ATM pathway as it occurs in immortalized A-T fibroblasts. Knockdown of Skp2, an F-box protein capable of regulating the normal turnover of p21Cip1, does not prevent the IR-induced degradation. Instead, this process requires the Cul4-DDB1Cdt2 E3 ligase as knockdown of either DDB1 or Cdt2 rescues p21Cip1 degradation after IR. Mutating the proliferating cell nuclear antigen-binding site of p21Cip1 also prevents its IR-induced degradation suggesting that the p21Cip1-proliferating cell nuclear antigen interaction is critical for this event. Although ectopic expression of a nondegradable p21Cip1 did not by itself affect the clonogenic survival of HEK293 cells after IR, the degradation of p21Cip1 and other targets of the Cul4-DDB1Cdt2 E3 ligase may collectively contribute to the survival of neoplastic cells after ionizing radiation. The cyclin-dependent kinase inhibitor p21Cip1 plays an important role in the cellular response to DNA damage. In normal cells, genotoxic stress activates the ATM-p53 pathway that up-regulates the expression of p21Cip1 leading to cell cycle arrest. However, we have found that in several neoplastic cell lines, ionizing radiation (IR) induces ubiquitin-dependent degradation of p21Cip1. This process is independent of the ATM pathway as it occurs in immortalized A-T fibroblasts. Knockdown of Skp2, an F-box protein capable of regulating the normal turnover of p21Cip1, does not prevent the IR-induced degradation. Instead, this process requires the Cul4-DDB1Cdt2 E3 ligase as knockdown of either DDB1 or Cdt2 rescues p21Cip1 degradation after IR. Mutating the proliferating cell nuclear antigen-binding site of p21Cip1 also prevents its IR-induced degradation suggesting that the p21Cip1-proliferating cell nuclear antigen interaction is critical for this event. Although ectopic expression of a nondegradable p21Cip1 did not by itself affect the clonogenic survival of HEK293 cells after IR, the degradation of p21Cip1 and other targets of the Cul4-DDB1Cdt2 E3 ligase may collectively contribute to the survival of neoplastic cells after ionizing radiation. It is important that eukaryotic cells respond appropriately to DNA damage to ensure that the integrity of the genome is maintained. One family of proteins that plays an important role in the coordination of this response is the PI3K 3The abbreviations used are: PI3K, phosphatidylinositol 3-kinase; ATM, ataxia telangiectasia mutated; ATR, ATM and Rad3-related protein; IR, ionizing radiation; PCNA, proliferating cell nuclear antigen; Gy, gray; DMEM, Dulbecco's modified Eagle's medium; PVDF, polyvinylidene difluoride; GFP, green fluorescent protein; Z, benzyloxycarbonyl; fmk, fluoromethyl ketone; shRNA, short hairpin RNA; siRNA, small interfering RNA; CHX, cycloheximide; Rb, retinoblastoma; E3, ubiquitin-protein isopeptide ligase; PIKK, PI3K-related protein kinase; DNA-PK, DNA-dependent protein kinase.3The abbreviations used are: PI3K, phosphatidylinositol 3-kinase; ATM, ataxia telangiectasia mutated; ATR, ATM and Rad3-related protein; IR, ionizing radiation; PCNA, proliferating cell nuclear antigen; Gy, gray; DMEM, Dulbecco's modified Eagle's medium; PVDF, polyvinylidene difluoride; GFP, green fluorescent protein; Z, benzyloxycarbonyl; fmk, fluoromethyl ketone; shRNA, short hairpin RNA; siRNA, small interfering RNA; CHX, cycloheximide; Rb, retinoblastoma; E3, ubiquitin-protein isopeptide ligase; PIKK, PI3K-related protein kinase; DNA-PK, DNA-dependent protein kinase.-like family of protein kinases (PIKK), which includes ATM, ATR, and DNA-PK (1Shiloh Y. Nat. Rev. Cancer. 2003; 3: 155-168Crossref PubMed Scopus (2131) Google Scholar). Of these family members, ATM seems to be most important for the cellular response to ionizing radiation (IR) and other agents that generate DNA double strand breaks. Following exposure to IR, ATM kinase activity increases within minutes and leads to the phosphorylation of a number of target proteins that regulate an array of cellular processes, including the activation of cell cycle checkpoints and the initiation of DNA repair (2Matsuoka S. Ballif B.A. Smogorzewska A. McDonald III, E.R. Hurov K.E. Luo J. Bakalarski C.E. Zhao Z. Solimini N. Lerenthal Y. Shiloh Y. Gygi S.P. Elledge S.J. Science. 2007; 316: 1160-1166Crossref PubMed Scopus (2321) Google Scholar). One of the most well characterized targets of ATM is the p53 tumor suppressor protein, which is essential for the G1 checkpoint after IR (3Kastan M.B. Zhan Q. el-Deiry W.S. Carrier F. Jacks T. Walsh W.V. Plunkett B.S. Vogelstein B. Fornace Jr., A.J. Cell. 1992; 71: 587-597Abstract Full Text PDF PubMed Scopus (2923) Google Scholar, 4Kastan M.B. Onyekwere O. Sidransky D. Vogelstein B. Craig R.W. Cancer Res. 1991; 51: 6304-6311PubMed Google Scholar). ATM activation leads to phosphorylation of p53 at multiple sites resulting in both the increased stability and increased transcriptional activity of the protein (1Shiloh Y. Nat. Rev. Cancer. 2003; 3: 155-168Crossref PubMed Scopus (2131) Google Scholar). This ultimately leads to the increased expression of many p53 target genes, including the cyclin-dependent kinase inhibitor p21Cip1 (5Sherr C.J. Roberts J.M. Genes Dev. 1995; 9: 1149-1163Crossref PubMed Scopus (3205) Google Scholar).p21Cip1 was initially identified in cyclin D1 immunoprecipitates as a component of a quaternary protein complex that included cyclin D1, cyclin-dependent kinase 2 or 4, and PCNA (6Xiong Y. Zhang H. Beach D. Cell. 1992; 71: 505-514Abstract Full Text PDF PubMed Scopus (896) Google Scholar). Additional studies identified p21Cip1 as a potent inhibitor of cyclin-dependent kinases, suggesting that it played an important role in cell cycle regulation (7Xiong Y. Hannon G.J. Zhang H. Casso D. Kobayashi R. Beach D. Nature. 1993; 366: 701-704Crossref PubMed Scopus (3157) Google Scholar, 8Gu Y. Turck C.W. Morgan D.O. Nature. 1993; 366: 707-710Crossref PubMed Scopus (707) Google Scholar, 9Harper J.W. Adami G.R. Wei N. Keyomarsi K. Elledge S.J. Cell. 1993; 75: 805-816Abstract Full Text PDF PubMed Scopus (5216) Google Scholar). This was confirmed by several independent studies that identified p21Cip1 as an important mediator of the G1 cell cycle arrest that occurs in response to a variety of cellular stresses (9Harper J.W. Adami G.R. Wei N. Keyomarsi K. Elledge S.J. Cell. 1993; 75: 805-816Abstract Full Text PDF PubMed Scopus (5216) Google Scholar, 10el-Deiry W.S. Tokino T. Velculescu V.E. Levy D.B. Parsons R. Trent J.M. Lin D. Mercer W.E. Kinzler K.W. Vogelstein B. Cell. 1993; 75: 817-825Abstract Full Text PDF PubMed Scopus (7890) Google Scholar, 11Noda A. Ning Y. Venable S.F. Pereira-Smith O.M. Smith J.R. Exp. Cell Res. 1994; 211: 90-98Crossref PubMed Scopus (1309) Google Scholar). In particular, it is now well established that p21Cip1 is critical for the p53-dependent G1 arrest that occurs following DNA damage (10el-Deiry W.S. Tokino T. Velculescu V.E. Levy D.B. Parsons R. Trent J.M. Lin D. Mercer W.E. Kinzler K.W. Vogelstein B. Cell. 1993; 75: 817-825Abstract Full Text PDF PubMed Scopus (7890) Google Scholar, 12Deng C. Zhang P. Harper J.W. Elledge S.J. Leder P. Cell. 1995; 82: 675-684Abstract Full Text PDF PubMed Scopus (1935) Google Scholar, 13Di Leonardo A. Linke S.P. Clarkin K. Wahl G.M. Genes Dev. 1994; 8: 2540-2551Crossref PubMed Scopus (1011) Google Scholar, 14Dulic V. Kaufmann W.K. Wilson S.J. Tlsty T.D. Lees E. Harper J.W. Elledge S.J. Reed S.I. Cell. 1994; 76: 1013-1023Abstract Full Text PDF PubMed Scopus (1414) Google Scholar).In addition to binding cyclin-dependent kinases, p21Cip1 also directly binds the DNA polymerase processivity factor PCNA through its C-terminal region. This association has been shown to lead to inhibition of PCNA-dependent DNA replication in vitro (15Waga S. Hannon G.J. Beach D. Stillman B. Nature. 1994; 369: 574-578Crossref PubMed Scopus (1579) Google Scholar, 16Gulbis J.M. Kelman Z. Hurwitz J. O'Donnell M. Kuriyan J. Cell. 1996; 87: 297-306Abstract Full Text Full Text PDF PubMed Scopus (640) Google Scholar, 17Chen J. Jackson P.K. Kirschner M.W. Dutta A. Nature. 1995; 374: 386-388Crossref PubMed Scopus (511) Google Scholar). Thus, up-regulation of p21Cip1 following DNA damage may potentially target both the cell cycle machinery and the DNA replication machinery. However, high levels of p21Cip1 may also inhibit PCNA-dependent repair following DNA damage. In fact, it has been shown that p21Cip1 is degraded following UV radiation and that this degradation is required to facilitate DNA repair (18Bendjennat M. Boulaire J. Jascur T. Brickner H. Barbier V. Sarasin A. Fotedar A. Fotedar R. Cell. 2003; 114: 599-610Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar). This UV-induced degradation of p21Cip1 was shown to require ATR, a PIKK family member known to be activated in response to UV (1Shiloh Y. Nat. Rev. Cancer. 2003; 3: 155-168Crossref PubMed Scopus (2131) Google Scholar). In addition, the F-box protein Skp2, which functions as an adaptor protein for the SCF E3 ligase, was also shown to be required, although several recent reports have suggested that the Cul4A-DDB1 complex may actually be the E3 ligase responsible for this event (19Abbas T. Sivaprasad U. Terai K. Amador V. Pagano M. Dutta A. Genes Dev. 2008; 22: 2496-2506Crossref PubMed Scopus (302) Google Scholar, 20Nishitani H. Shiomi Y. Iida H. Michishita M. Takami T. Tsurimoto T. J. Biol. Chem. 2008; 283: 29045-29052Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar).Here we report that in many transformed cell lines, ionizing radiation leads to the degradation of p21Cip1. We show that this IR-inducible degradation is dependent on the Cul4A-DDB1 E3 ligase but is independent of ATM and other PIKK family members.EXPERIMENTAL PROCEDURESReagents—Cycloheximide, epoxomicin, wortmannin, N-ethylmaleimide, and 1,10-phenanthroline were from Sigma. Z-VAD and MG132 were from EMD Biosciences. Complete protease inhibitor tablets were from Roche Applied Science. KU-55933 was a gift from Graeme Smith (Kudos Pharmaceuticals). Phleomycin was a gift from Richard Kolodner (University of California, San Diego).Plasmids—All HA-p21 plasmids were constructed using PCR to introduce the HA tag and necessary restriction sites into p21, p21ΔPCNA, or p21K6R. All fragments were then cloned into the multiple cloning site of pcDNA3.1+ (Invitrogen). The original p21K6R plasmid was a gift from Jim Roberts (Fred Hutchinson Cancer Research Center).Cell Culture—All cells were supplemented with 10% fetal bovine serum (Sigma) and 1% penicillin/streptomycin (Mediatech) unless otherwise indicated. HEK293, COS-1, HeLa, and HCT116 cells were cultured in DMEM with high glucose and l-glutamine (Mediatech). A-T fibroblasts (Coriell Repository) were grown in DMEM and supplemented with 100 μg/ml hygromycin B (Sigma). BJ normal human foreskin fibroblasts (between population doublings 30–45) were grown in Eagle's minimal essential media with Earle's balanced salt solution (ATCC). Saos-2 cells were grown in McCoy's 5a medium (Invitrogen) supplemented with 15% fetal bovine serum and 1% penicillin/streptomycin. Transfections were carried out using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions.Immunoblotting—Cells were lysed in RIPA buffer, and protein concentration was determined using the DC protein assay (Bio-Rad). Equal amounts of protein were run on 5, 12, or 4–20% Tris-glycine gels (Invitrogen). Proteins were transferred to PVDF membranes (Millipore) for 1 h at 100 V or overnight at 40 V using a cooling coil. Membranes were incubated in primary antibody for 2 h at room temperature or overnight at 4 °C and in secondary antibody for 1 h at room temperature. Where LICOR analysis was used, PVDF-FL membranes (Millipore) were used.Immunoprecipitation—Primary antibodies were conjugated to A/G UltraLink resin (Pierce) for at least 4 h at 4 °C, and 1.0 μg of conjugated antibody was incubated with 1.0 mg of whole cell lysate overnight at 4 °C. The resin was washed three times in RIPA buffer and resuspended in 25 μl of 3× sample buffer.Antibodies—Antibodies from Santa Cruz Biotechnology were as follows: p21Cip1 (C-19 and H164), Chk1 (G4), Chk2 (A12), SV40 LT (polyclonal antibody 101), and rabbit IgG. Antibodies from Cell Signaling were as follows: p21 (DCS60 and 12D1), ATR (2790), DNA-PK (4602), and Skp2 (4358). DDB1 was from Pharmingen (612488). GFP was from Covance (B34). PCNA was from EMD Biosciences (PC10). ATM pS1981 was from Rockland Immunochemicals. ATM 5C2 was a gift from Dr. Eva Lee (University of California, Irvine). Secondary antibodies were from Pierce and LICOR.IR Experiments—Cells were seeded at 75–90% confluence in 60-mm dishes, and media were changed at least every 48 h. Cells were irradiated 2.5 or 4.5 days after seeding with a JL Shepherd Mark 1 137Cs irradiator using a dose rate of 4 Gy/min.Ubiquitination Assay—To preserve endogenously ubiquitinated p21Cip1, we adopted a method developed for the detection of endogenously ubiquitinated IκB. 4G. Pineda, personal communication. Cells were immediately lysed in 500 μl of 95 °C ubiquitin lysis buffer (20 mm Tris, pH 7.5, 150 mm NaCl, 1% SDS, 45 μm N-ethylmaleimide, 60 μm 1,10-phenanthroline, 2× protease inhibitor) and boiled for 10 min. Lysates were sonicated continuously for 30 s and spun at 14,000 rpm for 30 min. Clarified lysates were diluted in dilution buffer (lysis buffer without SDS) to a final volume of 5 ml. Lysates were immunoprecipitated with 1.0 μg of p21Cip1 polyclonal antibody (Santa Cruz Biotechnology H-164) conjugated to 10 μl of protein A/G UltraLink resin (Pierce) overnight at 4 °C. The resin was then washed in 20 mm Tris, pH 7.5, 10% glycerol containing 150, 300, and 500 mm NaCl (washed two times with each buffer). The resin was washed once more in wash buffer with 150 mm salt prior to being run on a 4–20% Tris-glycine gel and transferred to a PVDF membrane and incubated with a monoclonal primary antibody (Cell Signaling DCS60).Lentiviral shRNA—All shRNAs were from Sigma. The shRNA sequences for DDB1 experiments were as follows: CCGGCGACCGTAAGAAGGTGACTTTCTCGAGAAAGTCACCTTCTTACGGTCGTTTTTG, CCGGCGTGTACTCTATGGTGGAATTCTCGAGAATTCCACCATAGAGTACACGTTTTTG, and CCGGCCTATCACAATGGTGACAAATCTCGAGATTTGTCACCATTGTGATAGGTTTTTG. The skp2 shRNA sequence was CCGGGCCTAAGCTAAATCGAGAGAACTCGAGTTCTCTCGATTTAGCTTAGGCTTTTT. For virus production, the shRNA plasmids were cotransfected along with the pMDL, pRev, and pVSVG packaging plasmids into 293FT cells (Invitrogen) using the calcium phosphate method. Media were changed 12 h after transfection, and viral supernatants were collected 36 h later. Viral supernatants were filtered, and Polybrene (Sigma) was added to 8 μg/ml prior to infection of target cells. Target cells were infected for 48 h and selected with 2.0 μg/ml puromycin until control cells were dead and completely detached from the dish.siRNA—siRNA sequences were as follows: Skp2, CCUAUCGAACUCAGUUAUAdTdT and CCUUAGACCUCACAGGUAAdTdT (Ambion); ATR, CGAGACUUCUGCGGAUUGCdTdT (Dharmacon); DNA-PK, CAAGCGACUUUAUAGCCUUdTdT (Ambion); and DDB1, ACUAGAUCGCGAUAAUAAAdTdT (Qiagen). The siRNAs were transfected at 50 nm with 10 μl of Lipofectamine 2000 (Invitrogen) 60 h prior to irradiation.Quantitative PCR—Total RNA was extracted from HEK293 cells with the RNeasy kit (Qiagen) and reverse-transcribed into cDNA using the high capacity cDNA reverse transcription kit (Applied Biosystems). Real time PCR was run on the 7900 HT Fast real time PCR system (Applied Biosystems) using the Power SYBR Green PCR master mix (Applied Biosystems). Primers were as follows: actin, CGAGAAGATGACCCAGATCATGTT (forward) and CCTCGTAGATGGGCACAGTGT (reverse); p21Cip1, GGCGGGCTGCATCCA (forward) and AGTGGTGTCTCGGTGACAAAGTC (reverse).Clonogenic Survival—5 × 106 HEK293 cells were cotransfected with 50 ng of GFP and 100 ng of the indicated p21Cip1 constructs. Cells were irradiated 60 h later. Cells were trypsinized 6 h post-IR, and the GFP-positive cells were sorted directly into 6-well plates containing 2 ml of conditioned media using a FACSAria cell sorter. Colonies of >50 cells were counted 10–14 days later.RESULTSp21Cip1 Is Degraded following IR—We have observed that irradiation of confluent HEK293 cells leads to a transient reduction in p21Cip1 protein levels between 30 and 90 min after IR (Fig. 1A). Although reduction in p21Cip1 levels is observed at lower densities, confluent HEK293 cells were used because these cells, which normally express p21Cip1 at low levels, up-regulate p21Cip1 as cell density increases (supplemental Fig. S1) making it easier to evaluate the extent of p21Cip1 degradation. As all other cell lines used in this study (many of which express p21Cip1 at low levels presumably because of impaired p53 function) were also found to up-regulate p21Cip1 with increasing cell density (data not shown), we conducted all subsequent experiments with confluent cultures of cells.To determine whether the IR-induced decrease in p21Cip1 protein level was due to protein degradation, we pretreated HEK293 cells with cycloheximide (CHX) and looked at the half-life of p21Cip1 with or without IR (Fig. 1B). We noticed that following a dose of 10 Gy IR, the half-life of p21Cip1 decreased from more than an hour to less than 30 min. Importantly, we observed no decrease in the rate of p21Cip1 transcription in these cells during this same time period, suggesting that the decrease in p21Cip1 protein level is entirely due to a decrease in protein stability (supplemental Fig. S1).To establish whether degradation of p21Cip1 occurred over a broad range of IR doses, we irradiated HEK293 cells with doses ranging from 0.5 to 20 Gy. Although a dose of 0.5 Gy had only a very modest effect, doses between 2 and 20 Gy all led to a significant reduction in p21Cip1 half-life (Fig. 1C) (data not shown). In addition, we were also able to detect a decrease in p21Cip1 half-life in HEK293 cells following treatment with the DNA-damaging agent phleomycin, suggesting that degradation of p21Cip1 may occur in response to other agents that induce DNA double strand breaks (Fig. 1D). Although p21Cip1 has been shown to be cleaved by caspase-3 in some cell lines following IR (21Gervais J.L. Seth P. Zhang H. J. Biol. Chem. 1998; 273: 19207-19212Abstract Full Text Full Text PDF PubMed Scopus (194) Google Scholar), both the IR-induced and phleomycin-induced degradation of p21Cip1 occurred in the presence of the broad specificity caspase inhibitor Z-VAD-fmk (Fig. 1D), demonstrating that the degradation we observe is not because of caspase cleavage of p21Cip1.p21Cip1 Is Degraded in Transformed Cell Lines after IR—We examined p21Cip1 levels in a number of cell lines following IR and observed that COS-1, Saos-2, and HeLa cells all rapidly degraded p21Cip1 after IR (Fig. 2A) (data not shown). In contrast, HCT116 cells exhibited only a modest reduction in p21Cip1 after IR (Fig. 2A). Furthermore, irradiation of BJ human fibroblasts had no effect on p21Cip1 levels (Fig. 2B). Quantification of p21 levels showed that the half-life of p21 in HEK293 cells went from 2 h to less than 30 min after IR (Fig. 2C). Similar experiments with BJ fibroblasts confirmed that there was no change in the half-life of p21 in these cells after IR (Fig. 2C).FIGURE 2IR-induced degradation of p21Cip1 occurs in transformed cells. A and B, indicated cells were pretreated with 25 μg/ml CHX and left untreated or irradiated with 10 Gy IR. All immunoblots were run using equal amounts of whole cell lysate and are representative of multiple experiments. C, same as in A and B, except LICOR secondary antibodies were used, and LICOR imaging software was used to quantify p21 levels. p21 levels were normalized to tubulin. Graphs are from three independent experiments with representative experiments shown below. D, Western blot of HCT116 or HCT116 p53-/- cells pretreated with 25 μg/ml CHX for 1 h prior to 10 Gy IR. E, Western blot of BJ human foreskin fibroblasts infected with a control retrovirus or a retrovirus expressing SV40 T-antigen. Infected cells were selected with 2.0 μg/ml puromycin until control cells were dead and detached from the dish. Selected cells were cultured to confluence and pretreated with 25 μg/ml CHX for 1 h prior to 10 Gy IR. Vertical lines indicate gel lanes that were spliced together.View Large Image Figure ViewerDownload Hi-res image Download (PPT)We noticed that the cell lines that degrade p21Cip1 most efficiently after IR all lack functional p53 and Rb proteins, either because of impairment by viral proteins (HEK293, COS-1, HeLa) or by way of genetic losses (Saos-2). To test whether the lack of p53 function was responsible for the different rates of p21Cip1 degradation, we compared the half-life of p21Cip1 in wild-type and p53-deficient HCT116 cells. Following irradiation, p53-deficient HCT116 cells exhibited only a modest decrease in p21Cip1 stability, and this decrease was similar to that seen in the parental HCT116 cells (Fig. 2D). Thus, p53 loss alone does not permit p21Cip1 degradation after IR. To determine whether the combined loss of p53 and Rb function would cause a more robust degradation of p21Cip1, we infected BJ fibroblasts with a control retrovirus or a retrovirus expressing the SV40 large T-antigen, which impairs both p53 and Rb (22Ahuja D. Saenz-Robles M.T. Pipas J.M. Oncogene. 2005; 24: 7729-7745Crossref PubMed Scopus (398) Google Scholar). Cells expressing T-antigen exhibited no increase in the rate of p21Cip1 degradation after IR relative to control cells (Fig. 2E), demonstrating that although the IR-induced degradation of p21Cip1 appears to be most robust in cells that lack functional p53 and Rb, other unidentified factors must also influence whether p21Cip1 is degraded after IR.IR-induced Degradation of p21Cip1 Is Independent of ATM—It is well established that the ATM protein plays an important role in orchestrating the cellular response to ionizing radiation (1Shiloh Y. Nat. Rev. Cancer. 2003; 3: 155-168Crossref PubMed Scopus (2131) Google Scholar). To determine whether ATM is required for the IR-induced degradation of p21Cip1, we treated HEK293 cells with KU55933, a small molecule inhibitor of the ATM kinase that does not target other PIKK family members (23Hickson I. Zhao Y. Richardson C.J. Green S.J. Martin N.M. Orr A.I. Reaper P.M. Jackson S.P. Curtin N.J. Smith G.C. Cancer Res. 2004; 64: 9152-9159Crossref PubMed Scopus (968) Google Scholar). Pretreatment of cells with this inhibitor led to a significant reduction in the phosphorylation of multiple ATM target sites after IR but failed to prevent the IR-induced degradation of p21Cip1 (Fig. 3A), suggesting this event may occur independently of ATM. To further rule out a role for ATM in this response, we compared the IR-induced degradation of p21Cip1 in a pair of SV40 immortalized A-T fibroblasts, one of which has been reconstituted with human ATM. Following irradiation, the degradation of p21Cip1 occurred with nearly identical kinetics in both cell lines, showing that ATM is not required for the IR-induced degradation of p21Cip1 (Fig. 3B).FIGURE 3IR-induced degradation of p21Cip1 is independent of ATM. A, Western blot of whole cell lysates from HEK293 cells pretreated for 1 h with DMSO or 10 μm KU55933 prior to 10 Gy IR. Phospho-specific antibodies to ATM or the ATM target Chk2 were used to verify the efficacy of the inhibitor. B, Western blot of whole cell lysates from immortalized A-T fibroblasts or reconstituted A-T fibroblasts pretreated with 25 μg/ml cycloheximide for 1 h prior to 10 Gy IR. C, Western blot of whole cell lysate from HEK293 cells pretreated with 25 μg/ml CHX and DMSO or 100 μm wortmannin for 1 h prior to 10 Gy IR. Phospho-specific antibodies to ATM or ATR target sites were used to verify the efficacy of the inhibitor. D, A-T cells were transfected with siRNAs to ATR or DNA-PK, either individually or in combination. 60 h post-transfection, cells were pretreated with 25 μg/ml CHX for 1 h prior to irradiation with 10 Gy IR. Cells were collected 1 h after IR, and equal amounts of whole cell lysate were analyzed by Western blot.View Large Image Figure ViewerDownload Hi-res image Download (PPT)The possibility exists that in the absence of ATM, other PIKK family members, such as ATR, may orchestrate the IR-induced degradation of p21Cip1. To address this possibility, we treated HEK293 cells with high concentrations (100 μm) of the fungal metabolite wortmannin, a general inhibitor of the PI3K family of kinases. At these concentrations, wortmannin has been shown to inhibit ATM, ATR, and DNA-PK (24Sarkaria J.N. Tibbetts R.S. Busby E.C. Kennedy A.P. Hill D.E. Abraham R.T. Cancer Res. 1998; 58: 4375-4382PubMed Google Scholar). As shown in Fig. 3C, the IR-induced phosphorylation of ATM target sites was significantly reduced in the presence of 100 μm wortmannin, whereas phosphorylation of an ATR target site on Chk1 was undetectable. Despite the apparent inhibition of both ATM and ATR under these conditions, p21Cip1 was still degraded in these cells after IR (Fig. 3C). To further rule out compensation from other PIKK family members, we also transfected A-T cells with siRNAs against both ATR and DNA-PK. Cells receiving both siRNAs, which exhibit about 90% knockdown of both proteins, still degrade p21Cip1 after IR (Fig. 3D). This suggests that the IR-induced degradation of p21Cip1 is independent of each of the PI3K-related kinases.Degradation of p21Cip1 Is Dependent on the Ubiquitin-Proteasome System—To assess the proteasome dependence of p21Cip1 degradation after IR, we treated HEK293 cells with the proteasome inhibitor MG132 for 1 h prior to IR. We found that pretreatment with this inhibitor completely prevented the IR-induced degradation of p21Cip1 (Fig. 4A). As MG132 inhibits proteases other than the proteasome (25Lee D.H. Goldberg A.L. Trends Cell Biol. 1998; 8: 397-403Abstract Full Text Full Text PDF PubMed Scopus (1232) Google Scholar), we also treated cells with epoxomicin, a much more specific inhibitor of the proteasome (26Meng L. Mohan R. Kwok B.H. Elofsson M. Sin N. Crews C.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 10403-10408Crossref PubMed Scopus (816) Google Scholar). Pretreatment with this inhibitor also prevented degradation of p21Cip1 (Fig. 4B), demonstrating that the IR-induced degradation of p21Cip1 is proteasome-dependent.FIGURE 4p21Cip1 is degraded by the ubiquitin-proteasome system following IR. A, Western blot of whole cell lysates from HEK293 cells pretreated with 25 μg/ml CHX and DMSO or 25 μm MG132 for 1 h prior to 10 Gy IR. B, Western blot of whole cell lysates from HEK293 cells pretreated with 25 μg/ml CHX and DMSO or 5 μm epoxomicin for 1 h prior to 10 Gy IR. C, HEK293 cells were pretreated with DMSO or 25 μm MG132 for 30 min prior to IR. Cells were collected at the indicated time points as described under "Experimental Procedures." p21Cip1 was immunoprecipitated from 1.0 mg of whole cell lysate using a polyclonal antibody to p21Cip1, and a Western blot was performed using a p21Cip1 monoclonal antibody. D, schematic of the p21-HA and p21(K6R)-HA constructs. E, HEK293 cells were transfected with 5.0 μg of total DNA, including 50 ng of GFP and 100 ng of p21-HA or p21(K6R)-HA. Cells were pretreated with 25 μg/ml CHX for 1 h prior to irradiation with 10 Gy IR. Cells were collected 1 h after IR, and equal amounts of whole cell lysate were analyzed by Western blot.View Large Image Figure ViewerDownload Hi-res image Download (PPT)To determine whether p21Cip1 is ubiquitinated after IR, we immunoprecipitated endogenous p21Cip1 from MG132-treated HEK293 cells in the presence of N-ethylmaleimide and 1,10-phenanthroline, two inhibitors of deubiquitinating enzymes (27Guterman A. Glickman M.H. J. Biol. Chem. 2004; 279: 1729-1738Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). As shown in Fig. 4C, in the absence of MG132, significantly less p21Cip1 was immunoprecipitated from irradiated cells, again showing that p21Cip1 is degraded after IR (Fig. 4C, lower panel). In cells pretreated with MG132, we observed several higher molecular weight forms of p21Cip1, consistent with reports that the normal turnover of p21Cip1 can involve ubiquitination (28Sheaff R.J. Singer J.D. Swanger J. Smitherman M. Roberts J.M. Clurman B.E. Mol. Cell. 2000; 5: 403-410Abstract Full Text Full Text PDF PubMed Scopus (360) Google Scholar, 29Bloom J. Amador V. Bartolini F. DeMartino G. Pagano M. Cell. 2003; 115: 71-82Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar). Following irradiation of MG132-treated cells, we observed a time-dependent increase in the higher molecular weight forms of p21Cip1 (Fig. 4C), suggesting that p21Cip1 is ubiquitinated after IR. Importantly, the increase in these higher molecular weight forms of p21Cip1 peaks around 30 min, which correlates well with the kinetics of p21Cip1 degradation after IR (Fig. 1A).To show that ubiquitination is required for p21Cip1 degradation following IR,
Referência(s)