Fructose-6-phosphate Aldolase Is a Novel Class I Aldolase from Escherichia coli and Is Related to a Novel Group of Bacterial Transaldolases
2001; Elsevier BV; Volume: 276; Issue: 14 Linguagem: Inglês
10.1074/jbc.m008061200
ISSN1083-351X
AutoresMelanie Schürmann, Georg A. Sprenger,
Tópico(s)Enzyme Structure and Function
ResumoWe have cloned an open reading frame from theEscherichia coli K-12 chromosome that had been assumed earlier to be a transaldolase or a transaldolase-related protein, termed MipB. Here we show that instead a novel enzyme activity, fructose-6-phosphate aldolase, is encoded by this open reading frame, which is the first report of an enzyme that catalyzes an aldol cleavage of fructose 6-phosphate from any organism. We propose the name FSA (forfructose-six phosphatealdolase; gene name fsa). The recombinant protein was purified to apparent homogeneity by anion exchange and gel permeation chromatography with a yield of 40 mg of protein from 1 liter of culture. By using electrospray tandem mass spectroscopy, a molecular weight of 22,998 per subunit was determined. From gel filtration a size of 257,000 (± 20,000) was calculated. The enzyme most likely forms either a decamer or dodecamer of identical subunits. The purified enzyme displayed a Vmax of 7 units mg−1 of protein for fructose 6-phosphate cleavage (at 30 °C, pH 8.5 in 50 mm glycylglycine buffer). For the aldolization reaction a Vmaxof 45 units mg−1 of protein was found;Km values for the substrates were 9 mmfor fructose 6-phosphate, 35 mm for dihydroxyacetone, and 0.8 mm for glyceraldehyde 3-phosphate. FSA did not utilize fructose, fructose 1-phosphate, fructose 1,6-bisphosphate, or dihydroxyacetone phosphate. FSA is not inhibited by EDTA which points to a metal-independent mode of action. The lysine 85 residue is essential for its action as its exchange to arginine (K85R) resulted in complete loss of activity in line with the assumption that the reaction mechanism involves a Schiff base formation through this lysine residue (class I aldolase). Another fsa-related gene,talC of Escherichia coli, was shown to also encode fructose-6-phosphate aldolase activity and not a transaldolase as proposed earlier. We have cloned an open reading frame from theEscherichia coli K-12 chromosome that had been assumed earlier to be a transaldolase or a transaldolase-related protein, termed MipB. Here we show that instead a novel enzyme activity, fructose-6-phosphate aldolase, is encoded by this open reading frame, which is the first report of an enzyme that catalyzes an aldol cleavage of fructose 6-phosphate from any organism. We propose the name FSA (forfructose-six phosphatealdolase; gene name fsa). The recombinant protein was purified to apparent homogeneity by anion exchange and gel permeation chromatography with a yield of 40 mg of protein from 1 liter of culture. By using electrospray tandem mass spectroscopy, a molecular weight of 22,998 per subunit was determined. From gel filtration a size of 257,000 (± 20,000) was calculated. The enzyme most likely forms either a decamer or dodecamer of identical subunits. The purified enzyme displayed a Vmax of 7 units mg−1 of protein for fructose 6-phosphate cleavage (at 30 °C, pH 8.5 in 50 mm glycylglycine buffer). For the aldolization reaction a Vmaxof 45 units mg−1 of protein was found;Km values for the substrates were 9 mmfor fructose 6-phosphate, 35 mm for dihydroxyacetone, and 0.8 mm for glyceraldehyde 3-phosphate. FSA did not utilize fructose, fructose 1-phosphate, fructose 1,6-bisphosphate, or dihydroxyacetone phosphate. FSA is not inhibited by EDTA which points to a metal-independent mode of action. The lysine 85 residue is essential for its action as its exchange to arginine (K85R) resulted in complete loss of activity in line with the assumption that the reaction mechanism involves a Schiff base formation through this lysine residue (class I aldolase). Another fsa-related gene,talC of Escherichia coli, was shown to also encode fructose-6-phosphate aldolase activity and not a transaldolase as proposed earlier. fructose-1,6-bisphosphate aldolase fructose 1,6-bisphosphate d-fructose 6-phosphate fructose-6-phosphate aldolase open reading frames base pair polyacrylamide gel electrophoresis polymerase chain reaction isopropyl-1-thio-β-d- galactopyranoside Aldolases are lyases that typically catalyze a stereoselective addition of a keto donor on an aldehyde acceptor molecule (1Machajewski T.D. Wong C.-H. Angew. Chem. Intl. Ed. Engl. 2000; 39: 1352-1375Crossref PubMed Scopus (852) Google Scholar). Aldol condensation and cleavage reactions play crucial roles in the central sugar metabolic pathways of all organisms. For instance in glycolysis, fructose 1,6-bisphosphate is reversibly cleaved into the triose dihydroxyacetone phosphate and glyceraldehyde 3-phosphate, whereas in gluconeogenesis, the bisphosphate is formed through action of aldolase (fructose-1,6-bisphosphate or FBP aldolase,1 EC 4.1.2.13). FBP aldolases and other aldolases can be broadly divided into two groups according to their reaction mechanisms. Class I aldolases are characterized by a covalent intermediate, which is a protonated Schiff base formed between a lysine residue and the carbonyl carbon of the substrate (2Rutter W.J. Fed. Proc. 1964; 23: 1248-1257PubMed Google Scholar, 3Horecker B.L. Tsolas O. Lai C.Y. Boyer P.D. The Enzymes. 3rd Ed. 7. Academic Press, New York1972: 213-258Google Scholar, 4Marsh J.J. Lebherz H.G. Trends Biochem. Sci. 1992; 17: 110-113Abstract Full Text PDF PubMed Scopus (171) Google Scholar). Class II aldolases have an absolute requirement for a divalent metal ion that stabilizes the reaction intermediates by polarization of the substrate carbonyl (5Mildvan A.S. Kobes R.D. Rutter W.J. Biochemistry. 1971; 10: 1191-1204Crossref PubMed Scopus (51) Google Scholar). Class I and II aldolases vary in other criteria such as subunit structure, pH profile, and substrate affinity. They share little if any sequence homology and are apparently of different evolutionary origins (2Rutter W.J. Fed. Proc. 1964; 23: 1248-1257PubMed Google Scholar). Class II aldolases prevail in bacteria, in fungi, and algae (4Marsh J.J. Lebherz H.G. Trends Biochem. Sci. 1992; 17: 110-113Abstract Full Text PDF PubMed Scopus (171) Google Scholar). Class I FBP aldolases are mainly distributed in higher eukaryotes including animals, plants, protozoa, and algae; they generally are tetramers (4Marsh J.J. Lebherz H.G. Trends Biochem. Sci. 1992; 17: 110-113Abstract Full Text PDF PubMed Scopus (171) Google Scholar). Bacterial class I FBP aldolases are known from Staphylococcus carnosus (6Witke C. Götz F. J. Bacteriol. 1993; 175: 7495-7499Crossref PubMed Google Scholar),Escherichia coli (7Thomson G.J. Howlett G.J. Ashcroft A.E. Berry A. Biochem. J. 1998; 331: 437-445Crossref PubMed Scopus (60) Google Scholar), or from the archaeonHalobacterium vallismortis (4Marsh J.J. Lebherz H.G. Trends Biochem. Sci. 1992; 17: 110-113Abstract Full Text PDF PubMed Scopus (171) Google Scholar, 8Krishnan G. Altekar W. Eur. J. Biochem. 1991; 195: 343-350Crossref PubMed Scopus (26) Google Scholar). They either form monomers (S. carnosus; see Ref. 6Witke C. Götz F. J. Bacteriol. 1993; 175: 7495-7499Crossref PubMed Google Scholar) or homodecamers (H. vallismortis; see Ref. 8Krishnan G. Altekar W. Eur. J. Biochem. 1991; 195: 343-350Crossref PubMed Scopus (26) Google Scholar). Recently, a class I aldolase (dhnA; see Ref. 7Thomson G.J. Howlett G.J. Ashcroft A.E. Berry A. Biochem. J. 1998; 331: 437-445Crossref PubMed Scopus (60) Google Scholar) has been described for E. coliin addition to the well known class II FBP aldolase of glycolysis (9Alefounder P.R. Baldwin S.A. Perham R.N. Short N.J. Biochem. J. 1989; 257: 529-534Crossref PubMed Scopus (56) Google Scholar). Microbial FBP aldolases are known to split fructose 1,6-bisphosphate only. In higher eukaryotes, fructose 1-phosphate is a lesser substrate of aldolase (2Rutter W.J. Fed. Proc. 1964; 23: 1248-1257PubMed Google Scholar, 10Gefflaut T. Blonski C. Perie J. Willson M. Prog. Biophys. Mol. Biol. 1995; 63: 301-340Crossref PubMed Scopus (124) Google Scholar), whereas fructose 6-phosphate is either an inhibitor of FBP aldolase (11Crans D.C. Sudhakar K. Zamborelli T.J. Biochemistry. 1992; 31: 6812-6821Crossref PubMed Scopus (53) Google Scholar) or a very weak substrate (less than 0.01% relative activity compared with FBP); however, no aldol formation from dihydroxyacetone and glyceraldehyde-3-P was reported (12Richards O.C. Rutter W.J. J. Biol. Chem. 1961; 236: 3185-3192Abstract Full Text PDF PubMed Google Scholar). Muscle and plant chloroplast FBP aldolases are reported to split sedoheptulose 1,7-bisphosphate (13Horecker B.L. Smyrniotis P.Z. Hiatt H.H. Marks P.A. J. Biol. Chem. 1955; 212: 827-836Abstract Full Text PDF PubMed Google Scholar, 14Flechner A. Gross W. Martin W.F. Schnarrenberger C. FEBS Lett. 1999; 447: 200-202Crossref PubMed Scopus (54) Google Scholar). To our best knowledge, no aldol cleavage of fructose 6-phosphate has been reported so far from any organism (1Machajewski T.D. Wong C.-H. Angew. Chem. Intl. Ed. Engl. 2000; 39: 1352-1375Crossref PubMed Scopus (852) Google Scholar). Transaldolases (EC 2.2.1.2) are class I aldolases that serve in transfer reactions in the pentose phosphate cycle. Transaldolases use fructose-6-P as donor and transfer a dihydroxyacetone group to acceptor compounds as erythrose-4-P or glyceraldehyde-3-P (3Horecker B.L. Tsolas O. Lai C.Y. Boyer P.D. The Enzymes. 3rd Ed. 7. Academic Press, New York1972: 213-258Google Scholar, 15Bonsignore A. Pontremoli S. Grazi E. Mangiarotti M. Biochem. Biophys. Res. Commun. 1959; 1: 79-82Crossref Scopus (6) Google Scholar, 16Sprenger G.A. Schörken U. Sprenger G. Sahm H. J. Bacteriol. 1995; 177: 5930-5936Crossref PubMed Google Scholar, 17Jia J. Huang W. Schörken U. Sahm H. Sprenger G.A. Lindqvist Y. Schneider G. Structure. 1996; 4: 715-724Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 18Jia J. Schörken U. Lindqvist Y. Sprenger G.A. Schneider G. Protein Sci. 1997; 6: 119-124Crossref PubMed Scopus (63) Google Scholar). As a side reaction, formation of fructose-6-P from dihydroxyacetone and glyceraldehyde-3-P is known, but the corresponding aldol cleavage reaction has not been documented (3Horecker B.L. Tsolas O. Lai C.Y. Boyer P.D. The Enzymes. 3rd Ed. 7. Academic Press, New York1972: 213-258Google Scholar). Recently, a group of gene sequences presumably encoding transaldolase-like proteins (19Reizer J. Reizer A. Saier M.H. Microbiology. 1995; 141: 961-971Crossref PubMed Scopus (40) Google Scholar) has been reported as outcome of total genome analyses of various Eubacteria and Archaebacteria. We have cloned two of these sequences (mipBand talC) from the genome of E. coli K-12. During the course of characterization of the gene products, however, we noticed that the corresponding proteins did not act as transaldolases. Instead, they perform a novel reaction, cleavage, or formation of fructose 6-phosphate as shown in Reaction 1. Here we present results in the characterization of fructose-6-phosphate aldolase encoded by the gene fsa(formerly termed mipB). Sugar phosphates, antibiotics, and other fine chemicals were purchased from Sigma unless indicated otherwise. Aldehydes and erythrose were from Fluka (Neu-Ulm, Germany). Auxiliary enzymes (triose-phosphate isomerase/glycerol-3-phosphate dehydrogenase, phosphoglucose isomerase, and glucose-6-phosphate dehydrogenase), restriction endonucleases, Taq DNA polymerase and T4 DNA ligase, were from Roche Molecular Biochemicals. SDS was from Serva (Heidelberg, Germany); acrylamide/bisacrylamide was from Roth (Karlsruhe, Germany); chromatographic standards (Combithek) were from Roche Molecular Biochemicals; and Q-Sepharose HP was from Amersham Pharmacia Biotech. Glycylglycine, NADH, and NADP(H) were purchased from Biomol (Hamburg, Germany). Bacterial media were from Difco. The bacterial strains and plasmids used in this study are listed in Table I. The strains were grown under aeration at 37 °C in LB medium (20Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) with appropriate antibiotics added. Ampicillin was used in a concentration of 100 mg/liter.Table IStrains and plasmids used in this studyStrain designationRelevant genotype/markerRef./originMC4100F− araD139 Δ(argF-lac)U169 rpsL150 relA1deoC1 ptsF2521JM109recA hsdR relA thiΔ(lac-proAB)/F′ traD proAB+ laclqlacZΔM1537Yanisch-Perron C. Vieira J. Messing J. Gene ( Amst. ). 1985; 33: 103-119Crossref PubMed Scopus (11410) Google ScholarPlasmidsRelevant markersRef./originpUC18bla (ampicillin resistance)38Vieira J. Messing J. Gene ( Amst. ). 1982; 19: 259-268Crossref PubMed Scopus (3770) Google ScholarpUC19bla(ampicillin resistance)38Vieira J. Messing J. Gene ( Amst. ). 1982; 19: 259-268Crossref PubMed Scopus (3770) Google ScholarpBLKSbla (ampicillin resistance)StratagenepUC18fsapUC18 with 740-bpPstI-SalI fsa fragmentThis studypUC18talCpUC18 with 730-bpPstI-SalI talC fragmentThis studypUC19TM0295pUC19 with 680-bpPstI-SalI TM0295 fragment fromT. maritimaThis studypBLKSywjHpBLKS with 790-bp PstI-SalI ywjH fragment from B. subtilisThis studyAll strains are derived from E. coli K-12. Open table in a new tab All strains are derived from E. coli K-12. Chromosomal DNA of E. coli strain MC4100 (21Casadaban M.J. J. Mol. Biol. 1976; 104: 541-555Crossref PubMed Scopus (1285) Google Scholar) was prepared and used as template for oligonucleotide-directed DNA amplification (22Mullis K.B. Faloona F.A. Methods Enzymol. 1987; 155: 335-350Crossref PubMed Scopus (3797) Google Scholar). Standard techniques for cloning (20Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) and transformation (23Hanahan D. J. Mol. Biol. 1983; 166: 557-580Crossref PubMed Scopus (8098) Google Scholar) were applied. The E. coli mipB gene was amplified by polymerase chain reaction using primers MipB5 (5′ GATGTGCGTCGACTGTTCAGAGAGTTTTCCC 3′) and MipB3 (5′ GAGGCTGCAGAACGTCCGGTTAAATCGACG 3′) corresponding to base pairs 862,865 to 862,896 (5′-end) and 863,497 to 863,527 bps (3′-end), respectively, of the sequence deposited at EMBL/GenBankTM (Isomura and coworkers, 2M. Isomura, T. Oqino, and T. Mizuno, personal communication. GenBankTM accession number ECD188; see Ref. 24Blattner F.R. Plunkett III, G. Bloch C.A. Perna N.T. Burland V. Riley M. Collado-Vides J. Glasner J.D. Rode C.K. Mayhew G.F. Gregor J. Davis N.W. Kirkpatrick H.A. Goeden M.A. Rose D.J. Mau B. Shao Y. Science. 1997; 277: 1453-1474Crossref PubMed Scopus (5935) Google Scholar); the underlined sequences denote the engineered restriction sites forSalI and PstI, respectively. 20 pmol of each primer were used with template chromosomal DNA (500 ng). The resulting 0.7-kilobase pair PCR fragment was purified, cleaved withPstI plus SalI, and ligated with pUC18 which had been opened likewise. Strain JM109 was used for transformations; resulting clones were checked for their integrity by restriction analyses and DNA sequencing using an automatic nonradioactive system (LI-COR, MWG Biotech, Ebersberg, Germany). Site-directed mutagenesis was carried out using the Chameleon Double-stranded Site-directed Mutagenesis kit from Stratagene. Mutagenesis primers were 5′ GGCGGTCACCGGAACGCGCACCACGATATCCGC 3′ and 5′ CATCATTGGAAAACGCTCTTCGGGGCG 3′. Data bank searches were done using the NCBI Blast server with the program of Altschul et al. (25Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (58771) Google Scholar). Preliminary sequence data were obtained from The Institute for Genomic Research. FSA (formerly MipB) aldolase from recombinant strain JM109/pUC18fsa was purified by the following procedure; all operations were carried out at 4 °C in glycylglycine buffer (50 mm; pH 8.0; 1 mm dithiothreitol). A single colony was inoculated into 50 ml of LB + ampicillin and incubated overnight at 37 °C with shaking. This culture served as starter for the main culture that was performed in three 2-liter Erlenmeyer flasks (400 ml of LB + ampicillin medium each) with shaking at 37 °C. Cells were collected by centrifugation (yield of 24 g wet weight). After washing with glycylglycine buffer, pellets were broken by ultrasonic treatment (Branson Sonifier, Danbury, CT) eight times for 30 s at 40 watts under cooling in an ethanol/ice bath. After centrifugation at 20,000 × g, the supernatant was used as cell-free extract. Cell-free extract was dissolved in 240 ml of buffer and directly applied onto a Q-Sepharose HP anion exchange column (XK 26/20; 26 × 200 mm). At a flow rate of 1 ml/min, FSA was eluted in a linear NaCl gradient at a concentration of 352–380 mmNaCl. Active fractions were pooled, diluted 4-fold with buffer, and passed over a gel filtration column (Superdex G-200, Amersham Pharmacia Biotech). SDS-polyacrylamide gel electrophoresis (PAGE) was carried out in the presence of 1% SDS on 12% vertical polyacrylamide gels using the buffer system of Laemmli (26Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (205531) Google Scholar). Gels were run at room temperature in a Bio-Rad MiniProteanII chamber with a LKB 2297 Macrodrive 5 power supply at a constant voltage of 100 V. For native polyacrylamide gel electrophoresis, gradient gels were run for 6 h with a constant voltage of 125 V. Protein bands were visualized by staining with Coomassie Brilliant Blue R-250. By using different reference marker proteins, the subunit mass of the FSA was calculated from a plot of the log of the molecular mass versus the relative mobility on SDS-polyacrylamide gels. Purified FSA was blotted onto polyvinylidene difluoride membranes (Immobilon-P from Millipore) in a semi-dry blot apparatus and stained with Amido Black. The protein band was cut out and subjected to N-terminal sequenation. Electrospray tandem mass spectroscopy was carried out as described (27Rai D.K. Alvelius G. Landin B. Griffiths W.J. Rapid Commun. Mass Spectrom. 2000; 14: 1184-1194Crossref PubMed Scopus (18) Google Scholar) using a Q-TOF (Micromass, Manchester, UK). Two different assays for fructose-6-phosphate aldolase activity were used (all at 30 °C in a Shimadzu UV160A spectrophotometer with a thermostated cuvette holder at a wavelength of 340 nm). (i) Cleavage of fructose 6-phosphate (Fru-6-P, 50 mm) was followed using the auxiliary enzymes triose-phosphate isomerase and glycerol-3-phosphate dehydrogenase to detect formation ofd-glyceraldehyde 3-phosphate. The oxidation of NADH (0.5 mm) was monitored and 1 μmol of NADH oxidized was set equivalent to 1 μmol of Fru-6-P cleaved. Enzyme activities are given in units (μmol/min). The standard buffer was glycylglycine (50 mm, pH 8.5) including 1 mm dithiothreitol in a total volume of 1 ml. (ii) By using the same buffer system as in i, the formation of Fru-6-P from glyceraldehyde 3-phosphate and dihydroxyacetone (3 and 50 mm, respectively) was monitored by the combined enzymes phosphoglucose isomerase and glucose-6-phosphate dehydrogenase. The reduction of NADP (0.5 mm) was followed. A prereaction of glyceraldehyde 3-phosphate with the auxiliary enzymes and NADP was run until no further NADPH formation occurred. Influence of possible inhibitors of aldolase activity was measured by aldolase assays I and II. Glycerol was added at different concentrations up to 230 mm; inorganic phosphate was added up to 5 mm,and EDTA was added at 10 mm. Transaldolase activity was determined as described earlier (16Sprenger G.A. Schörken U. Sprenger G. Sahm H. J. Bacteriol. 1995; 177: 5930-5936Crossref PubMed Google Scholar). A dye-binding method (28Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (211983) Google Scholar) was used to estimate the concentration of protein in solution. During a data bank search for transaldolase-like proteins in the genome of E. coli K-12 strain MG1655 (Ref. 24Blattner F.R. Plunkett III, G. Bloch C.A. Perna N.T. Burland V. Riley M. Collado-Vides J. Glasner J.D. Rode C.K. Mayhew G.F. Gregor J. Davis N.W. Kirkpatrick H.A. Goeden M.A. Rose D.J. Mau B. Shao Y. Science. 1997; 277: 1453-1474Crossref PubMed Scopus (5935) Google Scholar; GenBankTM accession number U00096), we found two open reading frames (ORFs) that showed a degree of identical amino acid residues in the range of 25% to the derived peptide sequence of talB (TableII; see Ref. 16Sprenger G.A. Schörken U. Sprenger G. Sahm H. J. Bacteriol. 1995; 177: 5930-5936Crossref PubMed Google Scholar). One of the putative ORFs ("talC") had been classified earlier by Saier and co-workers (19Reizer J. Reizer A. Saier M.H. Microbiology. 1995; 141: 961-971Crossref PubMed Scopus (40) Google Scholar) as a transaldolase, albeit without experimental evidence. The other (mipB) was originally proposed as a transaldolase-like protein (29Thorell S. Gergely Jr., P. Banki K. Perl A. Schneider G. FEBS Lett. 2000; 475: 205-208Crossref PubMed Scopus (34) Google Scholar).2Table IISequence relationships of transaldolases and FSA-related proteinsProteinSizeSimilarity to FSA (identity)Similarity to TalB (identity)kDa%FSA2410046 (24)TalC2479 (68)50 (29)TM0295 (T. maritima)2455 (29)54 (34)YwjH (B. subtilis)2354 (30)41 (27)OrfX (Cl. beijerinckii)2458 (36)47 (26) Open table in a new tab In our efforts to understand the transaldolase activities of E. coli (16Sprenger G.A. Schörken U. Sprenger G. Sahm H. J. Bacteriol. 1995; 177: 5930-5936Crossref PubMed Google Scholar, 17Jia J. Huang W. Schörken U. Sahm H. Sprenger G.A. Lindqvist Y. Schneider G. Structure. 1996; 4: 715-724Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 30Schörken U. Jia J. Sahm H. Sprenger G.A. Schneider G. FEBS Lett. 1998; 441: 247-250Crossref PubMed Scopus (13) Google Scholar), we amplified the mipB-containing region with a PCR method (22Mullis K.B. Faloona F.A. Methods Enzymol. 1987; 155: 335-350Crossref PubMed Scopus (3797) Google Scholar) using chromosomal DNA of strain MC4100 as template and by using specific primers with engineered unique restriction sites (see Fig. 1 and "Experimental Procedures" for details). The amplification product (about 700 bp of DNA) was cloned into the expression vector pUC18. In crude extracts from strains carrying the gene on high copy number vectors, an extra protein band at 24,000 Da (± 1000) appeared on SDS-PAGE. This protein band could be further augmented by addition of the inducer IPTG to recombinant cells in the exponential phase and was estimated to constitute up to 10% of the total soluble protein content of the crude extract (Fig. 2); thus a rapid and high yield enzyme purification could be undertaken. The purification strategy using recombinant strain JM109/pUC18fsa is described under "Experimental Procedures." A total of about 40 mg of pure enzyme was obtained from 1 liter of culture, with an overall yield of 38% corresponding to a purification factor of 5.2 (Table III). The degree of purity was monitored with polyacrylamide gel electrophoresis (26Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (205531) Google Scholar).Figure 2SDS-PAGE analysis of the E. colialdolase purification. The gel was run as described under "Experimental Procedures" with the following reference marker proteins in lane D: phosphorylase b, 97,400 Da; bovine serum albumin, 66,200 Da; fructose-bisphosphate aldolase, 39,200 Da; triose-phosphate isomerase, 26,600 Da; and trypsin inhibitor, 21,500 Da. In the lanes A–C, samples of the purification steps were applied, and FSA appears in all lanes at a molecular mass of 24,000 Da. Lane C, crude extract after ultrasonication and centrifugation; in lane B, after chromatography on Q-Sepharose, HP. Lane A, after gel filtration on Superdex G-200 column.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table IIIPurification scheme for E. coli fructose-6-phosphate aldolaseSamplePurification factorYieldTotal activityTotal protein contentSpecific activity aldolizationunitsmgunits/mgCell-free extract1.010034005406.4Q-Sepharose HP2.449168011015.3Gel filtration5.23813204033.0 Open table in a new tab Contrary to our expectation that mipB encoded a new transaldolase species, no such activity was enriched concomitantly with the new protein species. Instead, we noticed that a fructose 6-phosphate cleaving activity was present and further enriched by subsequent steps of protein purification. In the homogeneous state, a fructose-6-phosphate aldolase activity (at 30 °C in glycylglycine buffer, pH 8.5) of 7 units per mg of protein was found (TableIV). No fructose-1,6-bisphosphate aldolase or transaldolase activity could be detected in the gel filtration fractions (data not shown). As a literature search did not reveal evidence for a previous description of a fructose-6-phosphate aldolase from any organism, we like to term the novel activity as fructose-6-phosphate aldolase. Furthermore, we propose to rename the corresponding gene (formerly mipB) as fsa(mnemonic for fructose-six phosphatealdolase); the enzyme is abbreviated as FSA.Table IVKinetics of fructose-6-P aldolase FSASubstrateKmVmaxmmunits/mgFructose 6-phosphate97Dihydroxyacetone3545Glyceraldehyde 3-phosphate0.845 Open table in a new tab To verify that the novel enzyme activity was the true product of thefsa (mipB) gene, the purified protein was subjected to SDS-PAGE, blotted onto a polyvinylidene difluoride membrane, and stained with Amido Black. The first 10 amino acid residues were determined by an automated Edman degradation and analyzed by reversed phase high performance liquid chromatography. The sequence was determined as H2N-(Met)-Glu-Leu-Tyr-Leu-Asp-Thr-Ser-Asp-Val. The formyl methionine was cleaved off in a portion of the sample. The N-terminal amino acid sequence was in full agreement with the sequence submitted by Isomura and co-workers2 (EMBL entry ECD188; SwissProt entry P78,055). Examination of the comparative SDS-gel electrophoretic mobility of the novelE. coli recombinant aldolase with a number of known reference proteins indicated a subunit mass for the purified protein of 24,000 ± 1,000 (Fig. 2). By using a Q-TOF electrospray tandem mass spectrometer, the molecular mass of FSA was determined to 22,998 (Fig. 3). This was in excellent agreement with the mass calculated from the deduced protein sequence (including the initial f-Met) of 22,997 Da (SwissProt entry P78,055). The molecular mass of native E. coli recombinant aldolase was judged by gel filtration with reference proteins of known molecular masses ranging from 12 to 400 kDa. Active aldolase was eluted at a volume of 152 ml of buffer. In a logarithmic plot of elution volumeversus molecular mass an average mass of 257,000 ± 20,000 Da was calculated. This points to either a decameric or dodecameric structure of E. coli Fru-6-P aldolase, consisting of 10 or 12 identical subunits, respectively. The influence of different buffer substances, pH values, and temperature on the activity of the enzyme as well as the storage stability were analyzed using enzyme assay I (see "Experimental Procedures"). The auxiliary enzymes were first checked for activity under the different reaction conditions and were added to the reaction mixture in excess. As buffer substances, Tris, glycylglycine, Hepes, imidazole, 3-(cyclohexylamino)-1-propanesulfonic acid, or phosphate were used. Of these, glycylglycine (50 mm) was the best buffer compound. Optimal activity was found around pH 8.5, with a broad range of activity in buffers from pH 6.0–12.0. FSA displayed a broad temperature optimum and was active in the range from 20 to 75 °C. Although no significant loss of activity was detected after 600 h of incubation at 45 °C (in glycylglycine buffer, pH 8.0), the respective half-lives of the enzyme were 200 h at 55 °C, 30 h at 65 °C, and 16 h at 75 °C. A significant loss in activity was found in Tris buffers at concentrations higher than 10 mm pointing to a reaction of Tris with the enzyme. The purified protein could be stored frozen at −20 °C in the presence of 1 mm dithiothreitol with a loss of activity of about 20–40%. At 4 °C in glycylglycine buffer, the loss of activity was 20% per month. Alternatively, the enzyme could be lyophilized and stored at −20 °C for several months. FSA was inhibited by glycerol, inorganic phosphate, and arabinose 5-phosphate but not by EDTA (at 10 mm). Rapid loss of activity was seen if kept in contact with glycerol (see Fig.4 a). After 10 min of incubation in the presence of 20% glycerol, a decrease of more than 70% of enzyme activity was found. This inhibition was fully reversible (by dilution or removal through ultrafiltration) and appeared to be of the uncompetitive type. Inorganic phosphate was a competitive inhibitor with an apparent Ki value of 0.22 mm(see Fig. 4 b). Arabinose 5-phosphate was a competitive inhibitor (Ki of 0.07 mm; data not shown). The kinetic constantsKm and Vmax were determined in 50 mm glycylglycine buffer, at pH 8.5 and 30 °C. The cleavage of fructose 6-phosphate was monitored by enzyme assay I (see "Experimental Procedures"). When aldolase activities with different donor and acceptor compounds were compared, theVmax values of the standard reaction with Fru-6-P were determined each time as a control and were set 100%. No cleavage products were obtained from fructose, fructose 1-phosphate, glucose 6-phosphate, sedoheptulose 1,7-bisphosphate, xylulose 5-phosphate, ribulose 5-phosphate, and fructose 1,6-bisphosphate (up to 100 mm final concentrations). Neither were these compounds inhibitors of the standard reactions at conc
Referência(s)