Portal de Periódicos da CAPES

DEC1, a Basic Helix-Loop-Helix Transcription Factor and a Novel Target Gene of the p53 Family, Mediates p53-dependent Premature Senescence

2007; Elsevier BV; Volume: 283; Issue: 5 Linguagem: Inglês

10.1074/jbc.m708624200

1083-351X

Yingjuan Qian, Jin Zhang, Bingfang Yan, Xinbin Chen,

DNA Repair Mechanisms

Cellular senescence plays an important role in tumor suppression. p53 tumor suppressor has been reported to be crucial in cellular senescence. However, the underlying mechanism is poorly understood. In this regard, a cDNA microarray assay was performed to identify p53 targets involved in senescence. Among the many candidates is DEC1, a basic helix-loop-helix transcription factor that has been recently shown to be up-regulated in K-ras-induced premature senescence. However, it is not clear whether DEC1 is capable of inducing senescence. Here, we found that DEC1 is a novel target gene of the p53 family and mediates p53-dependent premature senescence. Specifically, we showed that DEC1 is induced by the p53 family and DNA damage in a p53-dependent manner. We also found that the p53 family proteins bind to, and activate, the promoter of the DEC1 gene. In addition, we showed that overexpression of DEC1 induces G1 arrest and promotes senescence. Moreover, we found that targeting endogenous DEC1 attenuates p53-mediated premature senescence in response to DNA damage. Furthermore, overexpression of DEC1 induces cellular senescence in p53-knockdown cells, albeit to a lesser extent. Finally, we showed that DEC1-induced senescence is p21-independent. Taken together, our data provided strong evidence that DEC1 is one of the effectors downstream of p53 to promote premature senescence. Cellular senescence plays an important role in tumor suppression. p53 tumor suppressor has been reported to be crucial in cellular senescence. However, the underlying mechanism is poorly understood. In this regard, a cDNA microarray assay was performed to identify p53 targets involved in senescence. Among the many candidates is DEC1, a basic helix-loop-helix transcription factor that has been recently shown to be up-regulated in K-ras-induced premature senescence. However, it is not clear whether DEC1 is capable of inducing senescence. Here, we found that DEC1 is a novel target gene of the p53 family and mediates p53-dependent premature senescence. Specifically, we showed that DEC1 is induced by the p53 family and DNA damage in a p53-dependent manner. We also found that the p53 family proteins bind to, and activate, the promoter of the DEC1 gene. In addition, we showed that overexpression of DEC1 induces G1 arrest and promotes senescence. Moreover, we found that targeting endogenous DEC1 attenuates p53-mediated premature senescence in response to DNA damage. Furthermore, overexpression of DEC1 induces cellular senescence in p53-knockdown cells, albeit to a lesser extent. Finally, we showed that DEC1-induced senescence is p21-independent. Taken together, our data provided strong evidence that DEC1 is one of the effectors downstream of p53 to promote premature senescence. The p53 protein has emerged as a key tumor suppressor at the crossroads of cellular stress-response pathways. In response to a stress signal, such as DNA damage, hypoxia, or activated oncogenes, p53 is activated and functions as a sequence-specific transcription factor regulating a plethora of downstream target genes, which mediate various p53 functions, such as cell cycle arrest, apoptosis, and senescence (1Prives C. Hall P.A. J. Pathol. 1999; 187: 112-126Crossref PubMed Scopus (1234) Google Scholar, 2Ko L.J. Prives C. Genes Dev. 1996; 10: 1054-1072Crossref PubMed Scopus (2294) Google Scholar). However, although many target genes have been identified, those involved in p53-dependent cellular senescence are still poorly understood (3Levine A.J. Hu W. Feng Z. Cell Death Differ. 2006; 13: 1027-1036Crossref PubMed Scopus (538) Google Scholar). Thus, identification of novel p53 targets involved in senescence is of great interest because cellular senescence may be as important as apoptosis in mediating p53-dependent tumor suppression (4Smith J.R. Pereira-Smith O.M. Science. 1996; 273: 63-67Crossref PubMed Scopus (471) Google Scholar). Cellular senescence was first described as “replicative senescence” because of a limited life span of human diploid fibroblasts in vitro (5Hayflick L. Exp. Cell Res. 1965; 37: 614-636Crossref PubMed Scopus (4330) Google Scholar), which is triggered by DNA damage signals originating from progressive telomere shortening during cell divisions (6d'Adda di Fagagna F. Teo S.H. Jackson S.P. Genes Dev. 2004; 18: 1781-1799Crossref PubMed Scopus (227) Google Scholar). Senescent cells are characterized by enlarged cell size, flattened morphology, inability to synthesize DNA, and expression of the biomarker, senescence-associated (SA) 2The abbreviations used are: SAsenescence-associatedHAhemagglutininsiRNAsmall interfering RNAntnucleotideChIPchromatin immunoprecipitationp53-REp53-responsive elementbHLHbasic helix-loop-helixBrdUrdbromodeoxyuridinePIpropidium iodideGAPDHglyceraldehyde-3-phosphate dehydrogenaseKDknockdownpRbretinoblastom protein. β-galactosidase (7Dimri G.P. Lee X. Basile G. Acosta M. Scott G. Roskelley C. Medrano E.E. Linskens M. Rubelj I. Pereira-Smith O. Peacocke M. Campisi J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9363-9367Crossref PubMed Scopus (5788) Google Scholar). Recent studies have shown that various stress signals, such as aberrant oncogene activity (8Serrano M. Lin A.W. McCurrach M.E. Beach D. Lowe S.W. Cell. 1997; 88: 593-602Abstract Full Text Full Text PDF PubMed Scopus (3994) Google Scholar) and cancer chemotherapeutic drugs (9Chang B.D. Broude E.V. Dokmanovic M. Zhu H. Ruth A. Xuan Y. Kandel E.S. Lausch E. Christov K. Roninson I.B. Cancer Res. 1999; 59: 3761-3767PubMed Google Scholar, 10te Poele R.H. Okorokov A.L. Jardine L. Cummings J. Joel S.P. Cancer Res. 2002; 62: 1876-1883PubMed Google Scholar), are able to initiate senescence-like phenotypes (“premature senescence”). It has been shown that cellular senescence utilizes both p53 and p16 pathways in human cells (8Serrano M. Lin A.W. McCurrach M.E. Beach D. Lowe S.W. Cell. 1997; 88: 593-602Abstract Full Text Full Text PDF PubMed Scopus (3994) Google Scholar, 11Campisi J. Science. 2005; 309: 886-887Crossref PubMed Scopus (220) Google Scholar). p53 up-regulates p21, a pleiotropic inhibitor of cyclin/cyclin-dependent kinases, which initiates growth arrest by preventing pRb phosphorylation by cyclin-dependent kinases. In contrast, p16 specifically inhibits cyclin-dependent kinase 4/6 to prevent pRb phosphorylation (12Ben-Porath I. Weinberg R.A. Int. J. Biochem. Cell Biol. 2005; 37: 961-976Crossref PubMed Scopus (808) Google Scholar). In addition, a recent report showed that p53 selectively cooperates with p130, a member of the pRb family, to induce premature senescence when the p16/pRb pathway is disrupted (13Kapic A. Helmbold H. Reimer R. Klotzsche O. Deppert W. Bohn W. Cell Death Differ. 2006; 13: 324-334Crossref PubMed Scopus (40) Google Scholar). Moreover, DNA damage promotes cancer cell senescence primarily through p130 (14Jackson J.G. Pereira-Smith O.M. Mol. Cell. Biol. 2006; 26: 2501-2510Crossref PubMed Scopus (90) Google Scholar). Interestingly, lack of p53 or p21 diminishes but does not abrogate DNA damage-induced premature senescence in tumor cells (15Schmitt C.A. Biochim. Biophys. Acta. 2007; 1775: 5-20PubMed Google Scholar), which suggests that senescence can occur through a p53-independent mechanism or an unknown p53 target gene. senescence-associated hemagglutinin small interfering RNA nucleotide chromatin immunoprecipitation p53-responsive element basic helix-loop-helix bromodeoxyuridine propidium iodide glyceraldehyde-3-phosphate dehydrogenase knockdown retinoblastom protein. DEC1 (differentiated embryo-chondrocyte expressed gene 1), also called STRA13 (stimulated with retinoic acid 13) in mouse and SHARP2 (enhancer of split and hairy related protein 2) in rat, along with DEC2, belongs to a new subfamily of basic helix-loop-helix (bHLH) transcription factors (16Yamada K. Miyamoto K. Front. Biosci. 2005; 10: 3151-3171Crossref PubMed Scopus (72) Google Scholar). DEC1 functions as a transcription repressor by directly binding to class B E-boxes (17Li Y. Xie M. Song X. Gragen S. Sachdeva K. Wan Y. Yan B. J. Biol. Chem. 2003; 278: 16899-16907Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar) by interacting with components of the basal transcription machinery, such as TFIIB, TBP, and TFIID (18Zawel L. Yu J. Torrance C.J. Markowitz S. Kinzler K.W. Vogelstein B. Zhou S. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 2848-2853Crossref PubMed Scopus (80) Google Scholar, 19Shen M. Yoshida E. Yan W. Kawamoto T. Suardita K. Koyano Y. Fujimoto K. Noshiro M. Kato Y. J. Biol. Chem. 2002; 277: 50112-50120Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar), or by recruiting a histone deacetylase corepressor complex (20Sun H. Taneja R. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4058-4063Crossref PubMed Scopus (160) Google Scholar). Interestingly, DEC1 is implicated in cell cycle regulation, differentiation, and apoptosis in response to various extracellular stimuli, including hypoxia, serum starvation, and retinoid acid (16Yamada K. Miyamoto K. Front. Biosci. 2005; 10: 3151-3171Crossref PubMed Scopus (72) Google Scholar). Indeed, overexpression of DEC1 inhibits cell proliferation in multiple cell types, such as NIH3T3 (20Sun H. Taneja R. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4058-4063Crossref PubMed Scopus (160) Google Scholar), HEK-293T (21Li Y. Zhang H. Xie M. Hu M. Ge S. Yang D. Wan Y. Yan B. Biochem. J. 2002; 367: 413-422Crossref PubMed Google Scholar), and HaCat cells (18Zawel L. Yu J. Torrance C.J. Markowitz S. Kinzler K.W. Vogelstein B. Zhou S. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 2848-2853Crossref PubMed Scopus (80) Google Scholar). However, the mechanism by which DEC1 regulates cell proliferation is not clear. Furthermore, a recent report shows that premature senescence induced by oncogene K-rasV12 correlates with DEC1 up-regulation (22Collado M. Gil J. Efeyan A. Guerra C. Schuhmacher A.J. Barradas M. Benguria A. Zaballos A. Flores J.M. Barbacid M. Beach D. Serrano M. Nature. 2005; 436: 642Crossref PubMed Scopus (1197) Google Scholar), but it is not clear whether DEC1 is capable of inducing senescence. In this study, we identified DEC1 as a direct target of the p53 family. We found that DEC1 is induced by p53 family proteins and DNA damage in a p53-dependent manner. In addition, we identified a potential p53-binding site in the promoter of the DEC1 gene. Moreover, we found that overexpression of DEC1 alone elicits premature senescence, and knockdown of DEC1 attenuates DNA damage-induced premature senescence. Furthermore, we found that overexpression of DEC1 is able to initiate cellular senescence in p53-knockdown cells albeit to a lesser extent, and DEC1-induced senescence is p21-independent. Taken together, our data strongly indicate that DEC1 is one of the mediators downstream of p53 to promote premature senescence. Plasmids—FLAG-tagged wild-type DEC1 and untagged mutant DEC1 cDNAs in pCMV and pcDNA4 expression vectors were described previously (17Li Y. Xie M. Song X. Gragen S. Sachdeva K. Wan Y. Yan B. J. Biol. Chem. 2003; 278: 16899-16907Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 21Li Y. Zhang H. Xie M. Hu M. Ge S. Yang D. Wan Y. Yan B. Biochem. J. 2002; 367: 413-422Crossref PubMed Google Scholar). To generate untagged wild-type DEC1 in pcDNA4 for tetracycline-inducible expression (Invitrogen), the cDNA fragment was amplified from FLAG-tagged wild-type DEC1 cDNA (17Li Y. Xie M. Song X. Gragen S. Sachdeva K. Wan Y. Yan B. J. Biol. Chem. 2003; 278: 16899-16907Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar) with forward primer, 5′-AGGAATTCACCATGGAGCGGATCCCCAGCG-3′, and reverse primer, 5′-AGTCTAGAAGGAAGGAAAGCAAAGCAG-3′. To generate a construct for the inducible expression of DEC1 siRNA, two oligonucleotides, 5′-GATCCCCGCACTAACAAACCTAATTGTTCAAGAGACAATTAGGTTTGTTAGTGCTTTTTGGAAA-3′ and 5′-AGCTTTTCCAAAAAGCACTAACAAACCTAATTGTCTCTTGAACAATTAGGTTTGTTAGTGCGGG-3′, were designed to target the DEC1 fourth exon (in boldface). The oligonucleotides were annealed and cloned into pBabe-H1, a pol III promoter-driven short hairpin RNA expression vector with a tetracycline operator sequence inserted before the transcriptional starting site (23van de Wetering M. Oving I. Muncan V. Pon Fong M.T. Brantjes H. van Leenen D. Holstege F.C. Brummelkamp T.R. Agami R. Clevers H. EMBO Rep. 2003; 4: 609-615Crossref PubMed Scopus (463) Google Scholar). The resulting vector was designated pBabe-H1-siDEC1. To generate a construct that stably expresses p21 siRNA, one pair of oligonucleotides with the siRNA targeting region as shown in boldface, sense, 5′-TCGAGGTCCGCCTCCTCATCCCGTGTTCTTCAAGAGAGAACACGGGATGAGGAGGCTTTTTG-3′, and antisense, 5′-GATCCAAAAAGCCTCCTCATCCCGTGTTCTCTCTTGAAGAACACGGGATGAGGAGGCGGACC-3′, were annealed and cloned into pBabe-U6 at BamHI and XhoI sites, a pol III promoter-driven vector as described previously (24Liu G. Xia T. Chen X. J. Biol. Chem. 2003; 278: 17557-17565Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). The resulting vector was named pBabe-U6-sip21. The construct expressing p53 siRNA was described previously (25Yan W. Chen X. J. Biol. Chem. 2006; 281: 7856-7862Abstract Full Text Full Text PDF PubMed Scopus (132) Google Scholar). To generate a luciferase reporter under the control of the DEC1 promoter (nt -4468 to +170), two genomic DNA fragments were amplified from MCF7 cells and ligated together through a common EcoRV site. The first pair of primers are as follows: forward primer, DEC1-KpnI-4468 (5′-ATGGTACCCAGGCTGGAGTACAGTGGCATGATC-3′), and reverse primer, DEC1-EcoRV-As (5′-ACGCCCACAACTTGCTTGCTCAGATATCAC-3′). The second pair of primers are as follows: forward primer, DEC1-EcoRV-S (5′-AGTGATATCTGAGCAAGCAAGTTGTGGGCATG-3′), and reverse primer, DEC1-XhoI (5′-AACTCGAGCCGCAGATGTTCCTCTGAGTCTGAG-3′). To generate a DEC1 promoter lacking the potential p53-RE, a fragment from nt -2343 to +170 was amplified with forward primer, DEC1-KpnI-2343 (5′-TTGGTACCCACACAATGAAGCAGGTCGCCC-3′), and reverse primer, DEC1-XhoI as shown above. Cell Lines—MCF7, RKO, MCF7-p53-KD, and RKO-p53-KD were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum at 37 °C with 5% CO2. H1299 cell lines that inducibly express p53 family proteins were described previously (26Zhu J. Zhang S. Jiang J. Chen X. J. Biol. Chem. 2000; 275: 39927-39934Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 27Dohn M. Zhang S. Chen X. Oncogene. 2001; 20: 3193-3205Crossref PubMed Scopus (257) Google Scholar, 28Nozell S. Wu Y. McNaughton K. Liu G. Willis A. Paik J.C. Chen X. Oncogene. 2003; 22: 4333-4347Crossref PubMed Scopus (30) Google Scholar). MCF7-p53-KD and RKO-p53-KD are derivatives of MCF7 and RKO, respectively, in which p53 was stably knocked down by RNA interference. MCF7-TR-7, which expresses the tetracycline repressor, was generated in our laboratory. To generate cell lines that inducibly express wild-type or various mutant DEC1 proteins, MCF7-TR-7 cells were transfected with pcDNA4-DEC1, pcDNA4-DEC1-M, or pcDNA4-DEC1-R58P and selected with medium containing 200 μg/ml Zeocin. To generate cell lines in which DEC1 is inducibly knocked down, MCF7-TR-7 cells were transfected with pBabe-H1-siDEC1 and selected with 0.5 μg/ml puromycin. MCF7 cell lines, in which p53 or p21 was stably knocked down and DEC1 is inducibly expressed, were generated by transfecting pBabe-U6-sip53 or pBabe-U6-sip21 into M7-DEC1-16 as generated above, and cells were selected with 0.5 μg/ml puromycin. Affymetrix GeneChip Assay and Northern Blot Analysis—Total RNAs were isolated by using TRIzol reagent (Invitrogen). The U133-plus GeneChip was purchased from Affymetrix. GeneChip analysis was performed according to the manufacturer's instruction. Northern blot analysis and preparation of p21 and GAPDH probes were described previously (29Chen X. Bargonetti J. Prives C. Cancer Res. 1995; 55: 4257-4263PubMed Google Scholar). Wild-type DEC1 cDNA was used as probe and amplified as described above. Luciferase Reporter Assay—The dual luciferase assay was performed in triplicate according to the manufacturer's instruction (Promega). Briefly, 0.25 μg of a luciferase reporter, 0.25 μg of empty pcDNA3, or pcDNA3 that expresses p53 or p53(R249S) and 9 ng of an internal control Renilla luciferase assay vector pRL-CMV (Promega) were transfected into p53-null H1299 cells by using the ESCORT V transfection reagent according to the manufacturer's instruction (Sigma). Cells were seeded at 2 × 104 per well in 24-well plates 24 h before transfection. 18 h post-transfection, luciferase activity was measured with the dual luciferase kit and Turner Designs luminometer. The fold change in relative luciferase activity is a product of the luciferase activity induced by a p53 family protein divided by that induced by an empty pcDNA3 vector. Chromatin Immunoprecipitation (ChIP) Assay—ChIP assay was performed as described previously (24Liu G. Xia T. Chen X. J. Biol. Chem. 2003; 278: 17557-17565Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). The binding of a p53 family protein to the DEC1 promoter was detected with forward primer, 5′-GGTTCAAGCGATTCTCCTGCCTC-3′, and reverse primer, 5′-CAGTGGCTCACGCCTGTAATCCT-3′. Primers that were used to amplify the p53-responsive element 1 within the p21 promoter were described previously (24Liu G. Xia T. Chen X. J. Biol. Chem. 2003; 278: 17557-17565Abstract Full Text Full Text PDF PubMed Scopus (95) Google Scholar). Primers for the amplification of the GAPDH promoter were used as described previously (30Liu G. Chen X. J. Biol. Chem. 2005; 280: 20111-20119Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar). Growth Rate and Colony Formation Assay—For growth rate analysis, cells were seeded at 1 × 104 per well in 6-well plates with or without doxycycline (an analog of tetracycline) in triplicate. Attached cells were counted at the indicated times. For colony formation assay, cells were seeded at 500 per well in 6-well plates with or without doxycycline in triplicate. Colonies were fixed with methanol:glacial acetic acid (7:1), washed in H2O, and stained with 0.02% crystal violet. DNA Histogram Analysis—Cells were seeded at 5 × 104 per 100-mm plate with or without doxycycline in triplicate. Cells were incubated with 20 μm BrdUrd (Sigma) at 37 °C, 5% CO2 for 15 min. The harvested living cells were fixed in precooled (-20 °C) ethanol (70%) overnight followed by BrdUrd/PI staining. Briefly, after centrifugation, the cells were treated with 1 ml of 2 n HCl/Triton X-100 for 30 min at room temperature, centrifuged, resuspended in 1 ml of 0.1 m Na2B4O7 (pH 8.5) to neutralize the sample, and incubated with fluorescein isothiocyanate-labeled anti-BrdUrd antibody (BD Biosciences) for 30 min at room temperature followed by addition of 300 μl of phosphate-buffered saline/PI (50 μg/ml). Samples were analyzed by fluorescence-activated cell sorting (BD Biosciences). Western Blot Analysis—Whole cell extracts were prepared with 2× SDS sample buffer and boiled for 5 min at 95 °C. The antibody against DEC1 was generated in rabbit (21Li Y. Zhang H. Xie M. Hu M. Ge S. Yang D. Wan Y. Yan B. Biochem. J. 2002; 367: 413-422Crossref PubMed Google Scholar). Antibodies against p53, p21, p130, and HA epitope were purchased from Santa Cruz Biotechnology. Anti-actin, and mouse IgG, and rabbit IgG were purchased from Sigma. Anti-Myc epitope was purchased from Abcam. Anti-Rb (clone XZ-77) was used as described (31Hu Q.J. Bautista C. Edwards G.M. Defeo-Jones D. Jones R.E. Harlow E. Mol. Cell. Biol. 1991; 11: 5792-5799Crossref PubMed Scopus (109) Google Scholar). SA-β-Galactosidase Staining Assay—This assay was performed as described previously (7Dimri G.P. Lee X. Basile G. Acosta M. Scott G. Roskelley C. Medrano E.E. Linskens M. Rubelj I. Pereira-Smith O. Peacocke M. Campisi J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 9363-9367Crossref PubMed Scopus (5788) Google Scholar). Cells were washed with 1× phosphate-buffered saline and fixed with 2% formaldehyde, 0.2% glutaraldehyde for 10-15 min at room temperature. Cells were then washed twice with 1× phosphate-buffered saline and stained with fresh SA-β-galactosidase staining solution at 37 °C without CO2. The SA-β-galactosidase staining solution contains 1 mg/ml 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside, 40 mm citric acid/sodium phosphate (pH 6.0), 5 mm potassium ferrocyanide, 5 mm potassium ferricyanide, 150 mm NaCl, and 2 mm MgCl2. Identification of DEC1 as a Novel Target Gene of the p53 Family—To identify novel genes regulated by p53, an Affymetrix GeneChip assay was performed with U133 plus Chips and RNAs purified from MCF7 cells uninduced or induced to express p53. Many known p53 target genes, such as MDM2, p21, and PIG3, and several novel targets, such as DNA polymerase η (pol H) (32Liu G. Chen X. Mol. Cell. Biol. 2006; 26: 1398-1413Crossref PubMed Scopus (79) Google Scholar) and myosin VI (33Jung E.J. Liu G. Zhou W. Chen X. Mol. Cell. Biol. 2006; 26: 2175-2186Crossref PubMed Scopus (61) Google Scholar), were found to be highly induced by p53. We also found that DEC1 was induced by p53. To confirm this, Northern blot analysis was performed. We showed that DEC1 was induced by p53 but not mutant p53(R249S) in H1299 cells (Fig. 1A, DEC1 panel). Similarly, p21, a well characterized p53 target, was up-regulated by p53 but not mutant p53(R249S) (Fig. 1A, p21 panel). Because the p53 family proteins, p63 and p73, have been shown to activate some p53-responsive genes, including p21 (34Harms K. Nozell S. Chen X. Cell. Mol. Life Sci. 2004; 61: 822-842Crossref PubMed Scopus (258) Google Scholar), we examined whether DEC1 is induced by p63 and p73. We found that both DEC1 and p21 were induced in H1299 cells by p63β, p63γ, p73β, and ΔNp73β (Fig. 1A, DEC1 and p21 panels). DNA damage stabilizes and activates p53, leading to induction of p53 target genes (35Jin S. Levine A.J. J. Cell Sci. 2001; 114: 4139-4140Crossref PubMed Google Scholar). If DEC1 is a true p53 target, it would be induced by DNA damage in cells that contain an endogenous wild-type p53 gene. To this end, MCF7, MCF7-p53-KD, RKO, and RKO-p53-KD cells were untreated or treated with doxorubicin, an inhibitor of topoisomerase II that can induce DNA double strand breaks (36Nelson W.G. Kastan M.B. Mol. Cell. Biol. 1994; 14: 1815-1823Crossref PubMed Scopus (873) Google Scholar). We found that DEC1 was induced by doxorubicin in MCF7 and RKO cells (Fig. 1B, DEC1 panel). Similarly, p21 was induced (Fig. 1B, p21 panel). In contrast, little if any DEC1 or p21 was detected in p53-knockdown MCF7 and RKO cells (Fig. 1B, DEC1 and p21 panels). Next, we examined whether an increase in DEC1 transcript correlates with an increase in DEC1 protein. We found that DEC1 was up-regulated in H1299 cells by p53, p63α, p63β, ΔNp63β, p63γ, ΔNp63γ, p73α, ΔNp73α, p73β, and ΔNp73β but not mutant p53(R249S) and ΔNp63α (Fig. 1C, DEC1 panel). The expression of p21 was measured as a positive control and found to be induced by p53, p63α, p63β, ΔNp63β, p63γ, p73α, p73β, and ΔNp73β but not mutant p53(R249S), ΔNp63α, ΔNp63γ, and ΔNp73α (Fig. 1C, p21 panel). In addition, we showed that like p21, DEC1 was induced by DNA damage in p53-proficient (MCF7 and RKO) but not p53-knockdown (MCF7-p53-KD and RKO-p53-KD) cells (Fig. 1D, DEC1 and p21 panels). As a transcription factor, p53 regulates gene expression by directly binding to a p53-responsive element (p53-RE) in the target gene. The consensus p53-RE is composed of two half-sites (RRRC(A/T) (A/T)GYYY, where R represents purine and Y pyrimidine) separated by up to 13 nt (37el-Deiry W.S. Kern S.E. Pietenpol J.A. Kinzler K.W. Vogelstein B. Nat. Genet. 1992; 1: 45-49Crossref PubMed Scopus (1752) Google Scholar). Thus, if DEC1 is a direct p53 target, one or more p53-REs should exist in the DEC1 gene. To test this, we analyzed the genomic locus of the DEC1 gene and found one potential p53-binding site located between nucleotides -4211 to -4181, with the sequence of AGGCAAGTTTTTAAATTTCAGGTCATGATC (Fig. 2A). Upon alignment with the consensus sequence, this p53-RE contains two mismatches at noncritical positions (Fig. 2A, mismatches in lowercase and core sequences in boldface). To determine whether this p53-RE is responsive to a p53 family protein, two DNA fragments from the DEC1 promoter, in which the p53-RE is retained (-4468/+170) or deleted (-2343/+170), were cloned into pGL2-basic luciferase reporter. The resulting vectors were designated pGL2-DEC1-4468 and pGL2-DEC1-2343, respectively (Fig. 2A). Next, luciferase reporter assay was performed and showed that p53, p63β, and p73β were able to increase the luciferase activity for pGL2-DEC1-4468 but not pGL2-DEC1-2343 (Fig. 2B). In contrast, mutant p53(R249S) was inert (Fig. 2B). As a positive control, the p21 promoter was highly increased by p53 but not p53(R249S) (data not shown). These data suggest that the p53-RE in the DEC1 gene is responsive to p53. To further examine whether a p53 family protein can bind to the p53-RE in the DEC1 gene in vivo, ChIP assay was performed with primers shown in Fig. 2C (left panel). The binding of the p53 family proteins to the p53-RE in the p21 promoter was determined as a positive control (Fig. 2C, middle panel). Additionally, a region within the promoter of the GAPDH gene was amplified as a control for nonspecific binding (Fig. 2C, right panel). To test the binding of p53 to the DEC1 promoter, MCF7 cells were untreated or treated with doxorubicin to activate p53, and the p53-DNA complexes were immunoprecipitated with anti-p53 antibody or mouse IgG as a control. We found that the captured fragments containing the p53-RE were significantly increased upon induction of p53 by DNA damage (Fig. 2D, DEC1 panel). Similarly, p53 bound to the p53-RE1 in the p21 gene in response to DNA damage (Fig. 2E, p21 panel). However, no fragments were enriched by control IgG (Fig. 2D, DEC1 and p21 panels). Furthermore, the GAPDH promoter was not recognized by p53 (Fig. 2D, GAPDH panel). To analyze the binding of p63 or p73, H1299 cells were uninduced or induced to express Myc-tagged p63β or HA-tagged p73β and then used for ChIP assay. The p63-DNA complexes were immunoprecipitated with anti-Myc antibody or rabbit IgG as a control (Fig. 2E). The p73-DNA complexes were immunoprecipitated with anti-HA antibody or mouse IgG as a control (Fig. 2F). We found that both p63β and p73β bound to the p53-RE in the DEC1 gene as well as to the one in the p21 gene (Fig. 2, E and F, DEC1 and p21 panels). In contrast, the GAPDH promoter was not recognized by p63β and p73β (Fig. 2, E and F, GAPDH panels). In sum, these data indicate that DEC1 is a direct target gene of the p53 family. DEC1 Induces G1 Arrest and Initiates Cellular Senescence—To test whether DEC1 is a downstream effector of p53 to mediate senescence, MCF7 cell line was chosen because it has a functional p53 pathway but lacks p16 (38Parry D. Bates S. Mann D.J. Peters G. EMBO J. 1995; 14: 503-511Crossref PubMed Scopus (373) Google Scholar). In addition, MCF7 cells undergo premature senescence upon treatment with doxorubicin (9Chang B.D. Broude E.V. Dokmanovic M. Zhu H. Ruth A. Xuan Y. Kandel E.S. Lausch E. Christov K. Roninson I.B. Cancer Res. 1999; 59: 3761-3767PubMed Google Scholar, 10te Poele R.H. Okorokov A.L. Jardine L. Cummings J. Joel S.P. Cancer Res. 2002; 62: 1876-1883PubMed Google Scholar). Because p53 and p16 are the two major signaling pathways leading to cellular senescence (8Serrano M. Lin A.W. McCurrach M.E. Beach D. Lowe S.W. Cell. 1997; 88: 593-602Abstract Full Text Full Text PDF PubMed Scopus (3994) Google Scholar, 12Ben-Porath I. Weinberg R.A. Int. J. Biochem. Cell Biol. 2005; 37: 961-976Crossref PubMed Scopus (808) Google Scholar), the MCF7 cell line is an ideal system to address how p53 regulates senescence. To analyze the biological activity of DEC1, multiple MCF7 cell lines, which inducibly express DEC1 and mutant DEC1 proteins, DEC1-M and DEC1-R58P, under the control of a tetracycline-inducible promoter, were generated. DEC1-M lacks residues 53-65 in the DNA binding domain and thus is transcriptionally inactive (21Li Y. Zhang H. Xie M. Hu M. Ge S. Yang D. Wan Y. Yan B. Biochem. J. 2002; 367: 413-422Crossref PubMed Google Scholar). Because of the deletion, DEC1-M has a lower molecular mass than its wild-type counterpart. DEC1-R58P has a point mutation at codon 58 (arginine to proline) within the DNA binding domain, which diminishes its DNA binding activity (21Li Y. Zhang H. Xie M. Hu M. Ge S. Yang D. Wan Y. Yan B. Biochem. J. 2002; 367: 413-422Crossref PubMed Google Scholar). Four representative cell lines were selected for further studies (Fig. 3A, left and middle panels) as follows: M7-DEC1 (clone 6 and 16) in which wild-type DEC1 can be inducibly expressed, M7-DEC1-M (clone 11) in which DEC1-M can be inducibly expressed, and M7-DEC1-R58P (clone 2) in which DEC1-R58P can be inducibly expressed. To determine whether cellular senescence induced by overexpressed DEC1 is physiologically relevant, Western blot analysis was performed to compare the levels of DNA damage-induced DEC1 and ectopic-expressed DEC1 in MCF7 cells. We showed that the level of DNA damage-induced DEC1 was comparable with that of ectopic-expressed DEC1 (Fig. 3A, right panel). Because cells that end at senescence must initially undergo cell cycle arrest, growth rate analysis and colony formation assay were performed to examine whether overexpression of DEC1 affects cell proliferation. We found that overexpression of DEC1 inhibited the proliferation of MCF7 cells over a 9-day period in both DEC1-expressing cell lines (Fig. 3B). As controls, doxycycline, DEC1-M, or DEC1-R58P had no effect on cell proliferation (Fig. 3B). Consistently, overexpression of DEC1, but not doxycycline, DEC1-M, or DEC1-R58P, inhibited the si