Correlation Between the Single-Site CpG Methylation and Expression Silencing of the XAF1 Gene in Human Gastric and Colon Cancers
2006; Elsevier BV; Volume: 131; Issue: 6 Linguagem: Inglês
10.1053/j.gastro.2006.09.050
ISSN1528-0012
AutoresBing Zou, Chor Sang Chim, Hui Zeng, Suet Yi Leung, Yongqiang Yang, Shui Ping Tu, Marie C.M. Lin, Jide Wang, Hua He, Shi Hu Jiang, Yun Sun, Li Fen Yu, Siu Tsan Yuen, Hsiang Fu Kung, Benjamin C.Y. Wong,
Tópico(s)RNA Research and Splicing
ResumoBackground & Aims: X-linked inhibitor of apoptosis protein (XIAP)-associated factor 1 (XAF1) antagonizes the anti-caspase activity of XIAP. XAF1 messenger RNA is present in normal tissues but undetectable in various cancers and thus poses a potential tumor suppressor gene. The aim of this study was to examine the novel pattern of methylation of XAF1 in gastric and colon cancers and locate the important CpG sites for transcriptional regulation and tumor progression. Methods: XAF1 expression was detected by reverse-transcription polymerase chain reaction (PCR) and Western blot analysis. Four different fragments around the transcription start site of XAF1 were cloned and examined putative promoter activities by luciferase reporter assay. Each CpG site in fragment F291 was mutated by site-directed mutagenesis technique, and the change of promoter activity of this fragment was detected by luciferase reporter assay. Methylation status of XAF1 was determined by methylation-specific PCR (MSP) and bisulfite DNA sequencing PCR analysis. Results: Down-regulation of XAF1 in association with hypermethylation was detected in 3 of 4 human gastric cancer cell lines and 6 of 8 colon cancer cell lines. Of the 4 promoter fragments, F291 showed the highest promoter activity, which could be down-regulated obviously by the mutation of particular CpG sites. Moreover, aberrant hypermethylation of these important CpG sites was strongly associated with the development of gastric and colon cancers. Conclusions: A cluster of methylated CpG sites instead of CpG islands located in the promoter area resulted in gene silencing of XAF1, and CpGs at −2nd, −1st, and +3rd positions are functionally more important in its transcriptional regulation. Background & Aims: X-linked inhibitor of apoptosis protein (XIAP)-associated factor 1 (XAF1) antagonizes the anti-caspase activity of XIAP. XAF1 messenger RNA is present in normal tissues but undetectable in various cancers and thus poses a potential tumor suppressor gene. The aim of this study was to examine the novel pattern of methylation of XAF1 in gastric and colon cancers and locate the important CpG sites for transcriptional regulation and tumor progression. Methods: XAF1 expression was detected by reverse-transcription polymerase chain reaction (PCR) and Western blot analysis. Four different fragments around the transcription start site of XAF1 were cloned and examined putative promoter activities by luciferase reporter assay. Each CpG site in fragment F291 was mutated by site-directed mutagenesis technique, and the change of promoter activity of this fragment was detected by luciferase reporter assay. Methylation status of XAF1 was determined by methylation-specific PCR (MSP) and bisulfite DNA sequencing PCR analysis. Results: Down-regulation of XAF1 in association with hypermethylation was detected in 3 of 4 human gastric cancer cell lines and 6 of 8 colon cancer cell lines. Of the 4 promoter fragments, F291 showed the highest promoter activity, which could be down-regulated obviously by the mutation of particular CpG sites. Moreover, aberrant hypermethylation of these important CpG sites was strongly associated with the development of gastric and colon cancers. Conclusions: A cluster of methylated CpG sites instead of CpG islands located in the promoter area resulted in gene silencing of XAF1, and CpGs at −2nd, −1st, and +3rd positions are functionally more important in its transcriptional regulation. Inhibitor of apoptosis proteins (IAPs) are a new family of intrinsic regulators of cell death that are structurally defined by the presence of the evolutionary conserved baculovirus IAP repeat domain.1Salvesen G.S. Duckett C.S. IAP proteins: blocking the road to death's door.Nat Rev Mol Cell Biol. 2002; 3: 401-410Crossref PubMed Scopus (1595) Google Scholar The baculovirus IAP repeat domain is a characteristic cysteine- and histidine-rich protein-folding domain that chelates zinc and forms a compact globular structure consisting of different amounts of α-helices and β-pleated sheets. The characterization of IAP proteins suggests that they function as endogenous caspase inhibitors and participate in cell cycle regulation and in the modulation of receptor-mediated signal transduction.2Miller L.K. An exegesis of IAPs: salvation and surprises from BIR motifs.Trends Cell Biol. 1999; 9: 323-328Abstract Full Text Full Text PDF PubMed Scopus (320) Google Scholar, 3Deveraux Q.L. Reed J.C. IAP family proteins—suppressors of apoptosis.Genes Dev. 1999; 13: 239-252Crossref PubMed Scopus (2305) Google Scholar, 4Liston P. Fong W.G. Korneluk R.G. The inhibitors of apoptosis: there is more to life than Bcl2.Oncogene. 2003; 22: 8568-8580Crossref PubMed Scopus (391) Google Scholar, 5Shi Y. Mechanisms of caspase activation and inhibition during apoptosis.Mol Cell. 2002; 9: 459-470Abstract Full Text Full Text PDF PubMed Scopus (1515) Google Scholar, 6Yamaguchi K. Nagai S. Ninomiya-Tsuji J. Nishita M. Tamai K. Irie K. Ueno N. Nishida E. Shibuya H. Matsumoto K. XIAP, a cellular member of the inhibitor of apoptosis protein family, links the receptors to TAB1-TAK1 in the BMP signaling pathway.EMBO J. 1999; 18: 179-187Crossref PubMed Scopus (329) Google Scholar, 7Massague J. Blain S.W. Lo R.S. TGFbeta signaling in growth control, cancer, and heritable disorders.Cell. 2000; 103: 295-309Abstract Full Text Full Text PDF PubMed Scopus (2122) Google Scholar IAPs suppress apoptosis through the inhibition of the caspase cascade, especially for their trait of inhibiting the effector stage of the caspase cascade, and then function as key proteins in the control of cell death. Several lines of evidence suggest that IAPs may play a significant role in tumorigenesis and progress. Over expression of IAPs increases resistance of tumor cell lines to chemotherapeutic drugs or irradiation, and interfering with their synthesis renders resistant cell lines sensitive.8Bilim V. Kasahara T. Hara N. Takahashi K. Tomita Y. Role of XIAP in the malignant phenotype of transitional cell cancer (TCC) and therapeutic activity of XIAP antisense oligonucleotides against multidrug-resistant TCC in vitro.Int J Cancer. 2003; 103: 29-37Crossref PubMed Scopus (124) Google Scholar, 9Sasaki H. Sheng Y. Kotsuji F. Tsang B.K. Down-regulation of X-linked inhibitor of apoptosis protein induces apoptosis in chemoresistant human ovarian cancer cells.Cancer Res. 2000; 60: 5659-5666PubMed Google Scholar, 10Holcik M. Yeh C. Korneluk R.G. Chow T. Translational upregulation of X-linked inhibitor of apoptosis (XIAP) increases resistance to radiation induced cell death.Oncogene. 2000; 19: 4174-4177Crossref PubMed Scopus (235) Google Scholar Of the 8 IAP members, X-linked inhibitor of apoptosis protein (XIAP) is the most potent and versatile inhibitor of caspase and apoptosis. The level of XIAP messenger RNA (mRNA) is relatively high in many human cancers and is associated with refractory disease and poor prognosis.1Salvesen G.S. Duckett C.S. IAP proteins: blocking the road to death's door.Nat Rev Mol Cell Biol. 2002; 3: 401-410Crossref PubMed Scopus (1595) Google Scholar, 11Tamm I. Kornblau S.M. Segall H. Krajewski S. Welsh K. Kitada S. Scudiero D.A. Tudor G. Qui Y.H. Monks A. et al.Expression and prognostic significance of IAP-family genes in human cancers and myeloid leukemias.Clin Cancer Res. 2000; 6: 1796-1803PubMed Google Scholar Currently, there are 3 proteins that bind to XIAP and inhibit its activity, including Smac/Diablo, Omi/HtrA2, and XIAP-associated factor 1 (XAF1). Unlike Smac/Diablo and Omi/HtrA2, XAF1 can directly bind to XIAP and interfere with XIAP-mediated caspase-3/caspase-7 inhibition,12Liston P. Fong W.G. Kelly N.L. Toji S. Miyazaki T. Conte D. Tamai K. Craig C.G. McBurney M.W. Korneluk R.G. Identification of XAF1 as an antagonist of XIAP anti-caspase activity.Nat Cell Biol. 2001; 3: 128-133Crossref PubMed Scopus (401) Google Scholar as well as reverse XIAP-mediated protection against chemotherapeutic drugs. Moreover, XAF1 can trigger the relocalization of XIAP from the cytosol to the nucleus, potentially sequestering XIAP. Interestingly, XAF1 is ubiquitously expressed in normal tissues but is found at extremely low levels in the majority of the NCI 60 cell line panel of cancer cells,13Fong W.G. Liston P. Rajcan-Separovic E. St Jean M. Craig C. Korneluk R.G. Expression and genetic analysis of XIAP-associated factor 1 (XAF1) in cancer cell lines.Genomics. 2000; 70: 113-122Crossref PubMed Scopus (204) Google Scholar which suggest a potential tumor suppressor role. Byun et al reported a strong association between hypermethylation and gene silencing of the XAF1 gene.14Byun D.S. Cho K. Ryu B.K. Lee M.G. Kang M.J. Kim H.R. Chi S.G. Hypermethylation of XIAP-associated factor 1, a putative tumor suppressor gene from the 17p13.2 locus, in human gastric adenocarcinomas.Cancer Res. 2003; 63: 7068-7075PubMed Google Scholar Moreover, they identified the importance of transcriptional regulation by 7 CpG dinucleotides located in the 5′ proximal region from −23 to −234 nucleotides (nt) in both gastric cancer cell lines and tumor tissues. While they showed a correlation between aberrant methylation of XAF1 and transcription regulation and gastric cancer progression, the exact promoter region could not be confirmed. In particular, whether hypermethylation of a particular CpG dinucleotide is sufficient to result in gene silencing in XAF1 could not be confirmed, especially in human colon cancers. Here, we studied the relationship between XAF1 expression and the methylation status of the putative promoter area from −109 to 164 nt. We then examined the expression of XAF1 in 4 human gastric cancer cell lines and 8 human colon cancer cell lines as well as their methylation status. We demonstrated down-regulation of XAF1 in 3 of 4 human gastric cancer cell lines and 6 of 8 colon cancer cell lines, which was strongly associated with promoter hypermethylation. The methylation pattern was different in human gastric and colon cancer tissues compared with normal or adjacent uninvolved tissues, respectively, suggesting the correlation between aberrant methylation status of XAF1 and gastric and colon cancer development and progression. Moreover, site-directed mutagenesis showed that some CpG sites in this area were functionally more important than others, especially the −2nd , −1st, and +3rd CpG sites, which was a novel finding. We also confirmed that, in human colorectal adenoma and cancer tissue samples, the percentage of methylation on those 3 CpG sites was higher in cancer samples than in adenoma samples. Our data showed statistical significance, suggesting that those methylation CpG sites were strongly associated with colorectal cancer progression. Human gastric and colon cancer cell lines were obtained from the American Type Culture Collection (Manassas, VA), Beijing Institute of Cancer Research (Beijing, China), or RIKEN Cell Bank (Institute of Physical and Chemical Research, Ibaraki, Japan). All of the cancer cell lines with the exception of Colo205 and KATO III grow as adherent cells in RPMI 1640 supplemented with 10% fetal bovine serum, 2 mmol/L l-glutamine, 100 U/mL penicillin, and 100 μg/mL streptomycin. CpGnome universal methylated DNA as positive control of methylation was purchased from Invitrogen Corp (Carlsbad, CA). The DNA samples from peripheral blood cells as negative control were obtained from blood donors. DNA samples of 13 pairs of human gastric cancer tissue and their adjacent normal mucosa were obtained from the archives of the Department of Pathology, University of Hong Kong. Ten human gastric mucosal biopsy specimens obtained during upper endoscopy in dyspeptic patients without lesions were used as normal control in methylation-specific polymerase chain reaction (MSP) analysis. Paraffin-embedded specimens of 30 colonic adenoma tissues, 63 colorectal cancer samples, and 10 adjacent normal mucosa samples were obtained from the archives of the Department of Gastroenterology, The Third Affiliated Hospital of Guangzhou Medical College. Cancer, adenoma, and adjacent normal mucosa were documented histologically. Selected cell lines were treated with trichostatin A (TSA; Sigma Chemical Co, St. Louis, MO), 5′-AZA-2′-deoxycytidine (5′-AZA; Sigma Chemical Co, St. Louis, MO), or a combination for 24 and 48 hours. Cells were plated at a density of 2–3 × 105 per well in 6-well plates 18 hours before the treatment with different agents, with the final concentration as follows: (1) 500 nmol/L of TSA only, (2) 1 and 5 μmol/L of 5′-AZA only, and (3) a combination of TSA and 5′-AZA. Medium containing fresh agent was changed every 24 hours. Cells were harvested respectively after 24 and 48 hours. Three micrograms of total RNA was used for complementary DNA synthesis for each reaction. One microliter of 20 μL complementary DNA reaction mixture was used for amplification of the XAF1 and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Polymerase chain reaction (PCR) was run with a cycle at 95°C for 30 minutes (HotStarTaq; Qiagen, Hilden, Germany) and then 30 cycles at 94°C for 30 seconds, 57°C for 30 seconds, and 72°C for 30 seconds and a final extension at 72°C for 7 minutes. The following sense and antisense primers of XAF1 are shown in Table 1. The sizes of PCR products were 318 base pairs of XAF1 (including total exon 1 to exon 3 and part of exon 4) and 467 base pairs of GAPDH. Relative gel band intensities of the products were measured by densitometric analyses using Gene Tool (Syngene, Bangalore, India).Table 1Primary Primers Used in This StudyNameSequence (5′–3′)PositionSizeRT-PCRL: GGAATTCATGGAAGGAGACTTCTCGGTGTGC AGGA+1 ∼ +28318XAF1R: CCTCGAGGGCCACAGTAGGACTCGTGGAGCTCCAGCT+318 ∼ +289MSPL: TTTGTAAGAAACGAAATTTAATCGA−45 ∼ −21228R: CCTACCCTTAAAACCCACGAT+182 ∼ +161USPL: TTTGTAAGAAATGAAATTTAATTGA−45 ∼ −21230R: CTCCTACCCTTAAAACCCACAAT+184 ∼ +161BSPL: GTTTTGTTTTTTTGTTTGTAAGAAA−59 ∼ −35253R: ATTTAAACCCTCCTACCCTTAAAAC+194 ∼ +170WTL: GTTTTGTTTCCTTGCCTGCAAGAAA−59 ∼ −35253R: CAAATTTGGGAGGATGGGAACCCCG+194 ∼ +170F176L: GGGGTACCAAGGAGACTTCTCGGTGTGC+5 ∼ +164176PromotersR: TCCGCTCGAGGTCTCCAGCTGCTTGTCCTCF291L: GGGGTACCAGATCTCCTCCCTCCCTG AA−107 ∼ +164291R: TCCGCTCGAGGTCTCCAGCTGCTTGTCCTCF436L: GGGGTACCCAGCCTCAGGGAGGTAGAT G−254 ∼ +164436R: TCCGCTCGAGGTCTCCAGCTGCTTGTCCTCF257L: GGGGTACCCAGCCTCAGGGAGGTAGAT G−254 ∼ −14257R: TCCGCTCGAGCAGGCTTTCGGTTGAGT TTC Open table in a new tab Twenty micrograms of protein for each sample was loaded by 12.5% sodium dodecyl sulfate/polyacrylamide gel electrophoresis and incubated with the XAF1 antibody (Santa Cruz Biotechnology, Santa Cruz, CA) and corresponding secondary antibodies (Santa Cruz Biotechnology) after transfer and block. Immunoblots were developed by using the enhanced chemiluminescence detection system (Amersham, Piscataway, NJ) according to the manufacturer's protocol. Genomic DNAs were isolated from cells, biopsy specimens, or paraffin-embedded tissue samples by DNeasy Tissue Kit (Qiagen) according to the manufacturer's instructions. DNA samples were treated with sodium bisulfite to convert cytosine to uracil. Briefly, ∼2 μg of genomic DNA from each sample was denatured with 2 mol/L NaOH at 37°C for 10 minutes, followed by incubation with 3 mol/L sodium bisulfate (pH 5.0, Sigma Chemical Co.) at 50°C for 17 hours, and then purified and treated with 3 mol/L NaOH, 10 mol/L ammonium acetate, and 100% cold ethanol (we use 1 μL glycogen as carrier). Four microliters of 20 μL bisulfite-treated DNA was amplified at a cycle at 95°C for 30 minutes and then 40 cycles at 94°C for 45 seconds, 50°C for 45 seconds, and 72°C for 45 seconds and a final extension at 72°C for 7 minutes using the bisulfited DNA sequencing PCR (BSP) primers (see Table 1). For gastric and colon cancer cell lines, PCR products were purified and then inserted into pGEM-T (Promega, Madison, WI) vector, selected 8–10 white clones for each sample, and then sequenced to determine the methylation status of each CpG site; we used 10 gastric mucosa DNA samples from healthy individuals as normal controls. For colorectal cancer tissue, adenoma, and adjacent uninvolved tissue samples, we sequenced the purified BSP products directly. Methylation status of human gastric normal tissues (from patients with gastritis or duodenum ulcer but no gastric cancer), adjacent uninvolved tissues, and tumor samples was examined by MSP analysis. Isolation and treatment of genomic DNAs by sodium bisulfite were performed as described previously. Primers for MSP and unmethylated specific PCR were generated specifically for methylated and unmethylated DNA (see Table 1). PCRs were performed using 25 pmol/L primers, 25 μmol/L deoxynucleoside triphosphates, 4 μL of 20 μL bisulfate-treated DNA, 1 U of hot-start Taq polymerase, and the respective buffers, followed by a 30-minute hot start at 95°C and then 35 cycles at 94°C for 45 seconds, 50°C for 45 seconds, and 72°C for 45 seconds and a final extension at 72°C for 7 minutes. Reactions were analyzed on ethidium bromide–stained 2% agarose gels. We designed the primers according to the genomic sequence of the XAF1 gene from GenBank (accession no. NT010718 and X99699) and used the normal genomic DNA isolated from peripheral blood cells as template. Four insert DNA fragments of the 5′-flanking region (around first ATG and exon 1) of the XAF1 gene (F176, from +5 to +164 nt; F291, from −109 to +164 nt; F436, from −254 to +164 nt; and F257, from −254 to −14 nt) were amplified by a PCR method using the primers displayed in Table 1. Underlined capitals show the restriction sites for KpnI (GGGGTACC) and XhoI (TCCGCTCGAG) enzymes. DNA fragments were inserted into a firefly luciferase expression vector pGL3-basic plasmid (Promega). Each plasmid construct was subcloned into DH5α bacterial cells and confirmed by restriction enzyme digestion and sequence analysis using ABI PRISM Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Foster City, CA). We changed the cytosine within the CpG dinucleotide in F291 into adenine by the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) according to the manual and used the pGL-3-F291 recombinated plasmid as template. Those mutated plasmids were selected and confirmed by DNA sequencing. Cells were seeded at 5 × 104 per well into 24-well plates and grown to 90%–95% confluence. pGL3-F176, -F291, -F436, and -F257 plasmids (0.8 μg/well) were transfected, as well as pGL3-basic plasmid (0.8 μg/well) by Lipofectamine 2000 (Invitrogen). Cells were harvested 24 hours after transfection. Firefly luciferase activity in the cell lysates was measured using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer's instructions. Relative promoter activity units were expressed by comparing with the empty vector of pGL3-basic plasmid. Each experiment was performed in triplicate, and at least 3 sets of independent transfection experiments were performed. Luciferase activity units were expressed as the mean of at least 3 independent transfection experiments. Sss I methylase was used for the in vitro methylation of the putative promoter fragment of pGL3-F291 before transient transfection. In each case, 3 μg of plasmid DNA (triplicates for 3 wells in 24-well plate) and each of pGL3-basic and pGL3-F291 were incubated with Sss I methylase and S-adenosyl-methionine for 3 hours at 37°C and then at 60°C for 20 minutes to stop the reaction. The results of luciferase activities are expressed as mean ± SD. Student t test and χ2 test were used to determine the statistical significance between different groups. A P value of less than .05 was considered significant. We first screened the expression of the XAF1 gene in 4 gastric cancer cell lines and 8 colon cancer cell lines. We divided them into 3 groups according to the original mRNA level of XAF1: group 1, including MKN45, SW480, HCT1116, and HCT15, with almost no expression of XAF1; group 2, including AGS, BCG823, DLD1, SW1116, and LoVo, with low-level expression of XAF1; and group 3, including KATO III, HT29, and Colo205, with comparatively high-level expression of XAF1. Treatment with 5′-AZA up-regulated the expression of XAF1 in cell lines of group 1 and group 2 with no or very low levels of XAF1 (Figure 1A and B). Figure 1C showed that treatment with 5′-AZA (1 and 5 μmol/L) alone up-regulated the protein expression of XAF1 in LoVo cells, but TSA (500 nmol/L) failed to alter the expression of XAF1. The combination of 5′-AZA and TSA also increased the expression of XAF1, similar to the treatment with 5′-AZA alone. We scanned the whole genomic DNA sequence using the free software on the Methprimer Web site (http://www.ucsf.edu/urogene/methprimer) and found that the XAF1 gene is not enriched in CpG dinucleotides. There are some small clusters of CpG sites in whole genomic DNA that did not fulfill the criteria for CpG island, but the results showed the nearest cluster of CpG sites located around coding exon 1 and the translation start site encoded by the first ATG. We designed 3 different fragments based on the position of CpG sites around translation start sites (ie, the first ATG) (Figure 2A). F176 contained 6 CpG sites, all inside exon 1. In addition to the fragment encoded by F176, F291 extended to −109 nt and contained 3 additional CpG sites proximal to the translation start site. F436 contained a total of 13 CpG sites surrounding the translation start site and exon 1. Moreover, we designed fragment F257, which only contained 7 CpG sites in the region proximal to the translation start site (Figure 2A). These fragments were cloned into the pGL-3 Luciferase Report Assay vectors. Among these 4 fragments, F291 showed significant promoter activity in LoVo and DLD1 cell lines (Figure 2B). We chose these 2 cell lines based on the wild-type and mutant p53 gene; LoVo is wild type, and DLD1 is mutant. Putative promoter activities of relative luciferase units in LoVo and DLD1 cells were 17 times and 13 times more than that of pGL3-basic plasmid control. F257 and F436 also showed luciferase activity but significantly lower than that of F291. F176 had the lowest promoter activity and thus suggested that the CpG sites in exon 1 only were associated with the least influence in the transcription regulation of the XAF1 gene. Then, we detected the influence of demethylated and methylated F291 by 5′-AZA and Sss I methylase, respectively, which nonspecifically methylated all CpG dinucleotides within the DNA region we designed. At the same time, we used pGL3-basic vector with Sss I methylase treatment as control. Compared with the unmethylated F291, promoter activity of the methylated sequences was reduced to 27% in LoVo cells and 34% in DLD1 cells (P < .01 in both cases; Figure 2C). This confirmed that extensive methylation of CpG dinucleotides in this promoter region is correlated strongly with transcription repression. Moreover, upon treatment of LoVo cells with 5 μmol/L of 5′-AZA, luciferase activity was increased by 20% (P = .04) but reduced in DLD1 cells (P = .06; Figure 2C). This might be accounted for by the variable demethylation of different CpG sites in the 2 cell lines by 5′-AZA. In this study, we designed the MSP and BSP primers from the Web site of Methprimer (http://www.ucsf.edu/urogene/methprimer). First, we amplified the 253–base pair DNA fragments of the XAF1 gene, spanning from −59 to +194 nt, and analyzed the methylation status of the 8 CpG sites within this area in these gastric and colon cancer cell lines as well as their methylation status after treatment with 5′-AZA. BSP analysis revealed different DNA methylation status in these cell lines. Most of these cancer cell lines displayed hypermethylation (Figure 3, left) compared with normal gastric mucosa DNA, which displayed almost no methylation on these sites (data not shown). Moreover, the degree of methylation correlated inversely with XAF1 expression. Bisulfite genomic sequencing analysis showed that some were heavily methylated with almost no XAF1 expression, such as HCT15 and SW480; the others, such as KATO III, Colo205, and HT29, were almost unmethylated but displayed the higher level of gene expression. After treatment with 5′-AZA for 48 hours, demethylation of previously methylated CpG dinucleotides was confirmed by bisulfite genomic sequencing analysis, which correlated with re-expression of the XAF1 gene (Figure 3, right). It was reported that XAF1 expression was very low in human gastric cancers compared with normal tissues.14Byun D.S. Cho K. Ryu B.K. Lee M.G. Kang M.J. Kim H.R. Chi S.G. Hypermethylation of XIAP-associated factor 1, a putative tumor suppressor gene from the 17p13.2 locus, in human gastric adenocarcinomas.Cancer Res. 2003; 63: 7068-7075PubMed Google Scholar In this study, we examined the methylation status of XAF1 in gastric mucosa from patients with no cancer and paired specimens of cancer and adjacent normal mucosa using MSP analysis. As shown in Figure 4 and Table 2, the XAF1 promoter was methylated in 9 of 13 cancer tissues (69%) but less commonly in normal subjects (10%) and the cancer adjacent normal mucosa (15%), which confirmed the published report.Table 2Hypermethylation Status in Gastric Normal and Cancer TissuesNormalaThe biopsy specimens obtained from patients with no gastric cancer.AdjacentbThe adjacent normal mucosa to the cancers.TumorTotal101313Methylation129Unmethylation9114Percent101569a The biopsy specimens obtained from patients with no gastric cancer.b The adjacent normal mucosa to the cancers. Open table in a new tab Taken together, the putative promoter region encoded by the fragment of F291 (spanning −109 to +164 nt) encoded CpG sites important in transcriptional regulation of XAF1, which was silenced by gene hypermethylation, and may play an important role in development and progression of human gastric cancers. In this study, we also attempted to identify the most important CpG site for transcriptional regulation of XAF1, and we first used the site-directed mutagenesis technique combined with methylation techniques. We mutated each of the 9 cytosines within CpG dinucleotides into adenine, respectively. After transient transfection of the mutated fragment, we showed that mutation of CpG sites resulted in down-regulation of the promoter activity. Moreover, mutation of different sites resulted in different levels of reduced luciferase activities. After mutation of the −2nd and −1st CGs to AGs, 76% (P < .01; Figure 5) and 63% (P < .01; Figure 5) reduction of its putative promoter activity of F291 were demonstrated in the LoVo cell line. However, mutation of the −3rd CpG site did not result in significant change in promoter activity. Of the CpG sites distal to the translation start site, CpG dinucleotide at +3rd showed significant promoter activity, and mutation of this site was associated with 30% reduction in luciferase activity compared with the unmutated F291 fragment (P = .02; Figure 5). These results suggested that in all CpG sites of F291, some were functionally more important than the others. In those CpG dinucleotides lying in the proximal promoter region, −2nd and −1st CpG dinucleotides maybe served as the core sites in transcriptional inactivation of XAF1. In this study, we focused on detecting the methylation status of those CpG dinucleotides in human colon cancer progression. Sixty-three human colorectal cancer tissue samples, 30 adenoma samples, and 10 adjacent normal tissue samples were detected by direct BSP sequencing analysis. Eight CpG sites around ATG were detected. The samples were divided into 3 different groups, depending on percentage of methylation on methylated CpG sites of a total of 8 CpGs, as 70% by convention. The 63 patients with carcinoma were aged from 28 to 89 years, and the mean age was 66.33 ± 12.99 years. As shown in Table 3, both carcinoma and adenoma displayed methylation status in this area of the XAF1 gene. There was no obvious difference between tubular adenoma and villiform adenoma, the same as between colon and rectal tissues in carcinoma samples. Most of the carcinoma samples had a higher methylation percentage than did adenoma samples in the >70% group (P = .024), especially in low-differentiation carcinoma. Most of the adenoma samples showed a lower percentage of methylation in the 70%) than did patients with no metastasis; the latter were more frequently in the lower methylation group as <30%, but this was not statistically significant. There was no obvious difference between male and female patients in this study. Adjacent uninvolved tissue samples displayed low or no methylated percentage (data not shown).Table 3Hypermethylation Status in Colorectal Carcinoma and Adenoma SamplesMethylationGroup 70% n (%)AdenomaTypeTubular adenoma (n = 20)5 (25)7 (35)8 (40)Villiform adenoma (n = 10)4 (40)3 (30)3 (30)Total (n = 30)9 (30)10 (33.3)11 (36.7)CarcinomaTypeRectal (n = 16)2 (12.5)4 (25)10 (62.5)Colon (n = 47)5 (10.6)14 (29.8)28 (59.6)DifferentiationLow differentiation (n = 18)0 (0)7 (38.9)11 (61.1)Medium differentiation (n = 34)3 (8.8)7 (20.6)24 (70.6)High differentiation (n = 11)4 (36.4)4 (36.4)3 (27.3)Total (n = 63)7(11.1)aStatistically significant when compared with the same group of adenoma samples.18(28.6)38(60.3)aStatistically significant when compared with the same group of adenoma samples.MetastasisPositive (n = 31)2 (6.5)9 (29)20 (64.5)Negative (n = 32)5 (15.6)9 (28.1)18 (56.3)GenderMale (n = 30)2 (6.6)9 (30)19 (63.3)Female (n = 33)5 (15.2)9 (27.3)19 (5
Referência(s)