Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

A Novel EID-1 Family Member, EID-2, Associates with Histone Deacetylases and Inhibits Muscle Differentiation

2003; Elsevier BV; Volume: 278; Issue: 19 Linguagem: Inglês

10.1074/jbc.m212212200

ISSN

1083-351X

Autores

Satoshi Miyaké, Yuka Yanagisawa, Yasuhito Yuasa,

Tópico(s)

Genomics and Chromatin Dynamics

Resumo

An EID-1 (E1A-likeinhibitor of differentiation-1) inhibits differentiation by blocking the histone acetyltransferase activity of p300. Here we report a novel inhibitor of differentiation exhibiting homology to EID-1, termed EID-2 (EID-1-likeinhibitor of differentiation-2). EID-2 inhibited MyoD-dependent transcription and muscle differentiation. Unlike EID-1, EID-2 did not block p300 activity. Interestingly, EID-2 associated with class I histone deacetylases (HDACs). The N-terminal portion of EID-2 was required for the binding to HDACs. This region was also involved in the transcriptional repression and nuclear localization, suggesting the importance of the involvement of HDACs in the EID-2 function. These results indicate a new family of differentiation inhibitors, although there are several differences in the biochemical mechanisms between EID-2 and EID-1. An EID-1 (E1A-likeinhibitor of differentiation-1) inhibits differentiation by blocking the histone acetyltransferase activity of p300. Here we report a novel inhibitor of differentiation exhibiting homology to EID-1, termed EID-2 (EID-1-likeinhibitor of differentiation-2). EID-2 inhibited MyoD-dependent transcription and muscle differentiation. Unlike EID-1, EID-2 did not block p300 activity. Interestingly, EID-2 associated with class I histone deacetylases (HDACs). The N-terminal portion of EID-2 was required for the binding to HDACs. This region was also involved in the transcriptional repression and nuclear localization, suggesting the importance of the involvement of HDACs in the EID-2 function. These results indicate a new family of differentiation inhibitors, although there are several differences in the biochemical mechanisms between EID-2 and EID-1. basic helix-loop-helix myocyte enhancer factor histone deacetylase histone acetyltransferase trichostatin A growth medium differentiation media fetal bovine serum cytomegalovirus muscle creatine kinase tetracycline repressor CREB-binding protein cAMP-response element-binding protein The terminal differentiation program is regulated both positively and negatively. Among various tissues, skeletal muscle is one of the most well studied in terms of differentiation regulation (1Molkentin J.D. Olson E.N. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9366-9373Crossref PubMed Scopus (374) Google Scholar, 2Puri P.L. Sartorelli V. J. Cell. Physiol. 2000; 85: 155-157Crossref Scopus (253) Google Scholar). Several fate-determining transcription factors regulate the expression of tissue-specific proteins. As for skeletal muscle differentiation, ubiquitously expressed basic helix-loop-helix (bHLH)1 transcription factors such as E proteins heterodimerize with the MyoD family of myogenic bHLH transcription factors, consisting of MyoD, Myf5, myogenin, and MRF4 (2Puri P.L. Sartorelli V. J. Cell. Physiol. 2000; 85: 155-157Crossref Scopus (253) Google Scholar). These heterodimers bind to the canonical E-box (CANNTG) sequences of the promoter regions of muscle-specific genes and up-regulate transcription. Other factors that dimerize with MyoD family proteins are non-bHLH MCM1, agamous, deficiens serum response partner (MADS)-box proteins, myocyte enhancer factors (MEFs). This group consists of MEF2A, -B, -C, and -D (1Molkentin J.D. Olson E.N. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9366-9373Crossref PubMed Scopus (374) Google Scholar, 2Puri P.L. Sartorelli V. J. Cell. Physiol. 2000; 85: 155-157Crossref Scopus (253) Google Scholar, 3Rescan P.Y. Comp. Biochem. Physiol. B. Biochem. Mol. Biol. 2001; 130: 1-12Crossref PubMed Scopus (83) Google Scholar). These tissue-specific transcription factors recruit coactivators such as p300/cAMP-response element-binding protein (CBP)-binding protein and P300/CBP-associated factor (PCAF) and then activate transcription (2Puri P.L. Sartorelli V. J. Cell. Physiol. 2000; 85: 155-157Crossref Scopus (253) Google Scholar). In addition to the above-mentioned positive regulators, several negative regulators for muscle differentiation have been found to date (2Puri P.L. Sartorelli V. J. Cell. Physiol. 2000; 85: 155-157Crossref Scopus (253) Google Scholar). The Id family consists of four members, namely, Id1, -2, -3, and -4 (4Norton J.D. J. Cell Sci. 2000; 113: 3897-3905Crossref PubMed Google Scholar). Id proteins are HLH proteins that lack DNA-binding domains. Therefore, they can heterodimerize with bHLH proteins but are unable to bind to DNA (5Benezra R. Davis R.L. Lockshon D. Turner D.L. Weintraub H. Cell. 1990; 61: 49-59Abstract Full Text PDF PubMed Scopus (1800) Google Scholar); hence Id proteins act as dominant negative regulators of bHLH proteins. Histone deacetylases (HDACs) are known to maintain core histones in a hypoacetylated state, resulting in transcriptional repression. HDACs comprise three classes, namely RPD3-like HDACs (class I), HDA1-like HDACs (class II), and newly identified SIR2-like HDACs (class III) (6Gray S.G. Ekstrom T.J. Exp. Cell Res. 2001; 262: 75-83Crossref PubMed Scopus (494) Google Scholar). Both class I and class II HDACs exhibit histone deacetylase activities at the C-terminal portions, but class I HDACs lack an N-terminal extension. Class I HDACs bind to MyoD and repress transcription (7Mal A. Sturniolo M. Schiltz R.L. Ghosh M.K. Harter M.L. EMBO J. 2001; 20: 1739-1753Crossref PubMed Scopus (206) Google Scholar). Class II HDACs bind to MEF2 via its N-terminal MEF2-binding domain and repress transcription (8Miska E.A. Karlsson C. Langley E. Nielsen S.J. Pines J. Kouzarides T. EMBO J. 1999; 18: 5099-5107Crossref PubMed Scopus (465) Google Scholar, 9Wang A.H. Bertos N.R. Vezmar M. Pelletier N. Crosato M. Heng H.H. Th'ng J. Han J. Yang X.J. Mol. Cell. Biol. 1999; 19: 7816-7827Crossref PubMed Scopus (260) Google Scholar, 10Lemercier C. Verdel A. Galloo B. Curtet S. Brocard M.P. Khochbin S. J. Biol. Chem. 2000; 275: 15594-15599Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar, 11Lu J. McKinsey T.A. Zhang C.L. Olson E.N. Mol. Cell. 2000; 6: 233-244Abstract Full Text Full Text PDF PubMed Scopus (445) Google Scholar). Class II HDACs are localized to the nuclei of myoblasts and are exported to the cytoplasm with differentiation signals (12McKinsey T.A. Zhang C.L. Lu J. Olson E.N. Nature. 2000; 408: 106-111Crossref PubMed Scopus (874) Google Scholar, 13Dressel U. Bailey P.J. Wang S.C. Downes M. Evans R.M. Muscat G.E. J. Biol. Chem. 2001; 276: 17007-17013Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar). Recently, we and others (14MacLellan W.R. Xiao G. Abdellatif M. Schneider M.D. Mol. Cell. Biol. 2000; 20: 8903-8915Crossref PubMed Scopus (106) Google Scholar, 15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar) identified a novel negative regulator of differentiation, termed EID-1 (E1A-likeinhibitor of differentiation-1), as a pRB- and p300-binding protein (14MacLellan W.R. Xiao G. Abdellatif M. Schneider M.D. Mol. Cell. Biol. 2000; 20: 8903-8915Crossref PubMed Scopus (106) Google Scholar, 15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar). EID-1 inhibits myogenic differentiation by blocking the histone acetyltransferase (HAT) activity of p300/cAMP-response element-binding protein-binding protein (14MacLellan W.R. Xiao G. Abdellatif M. Schneider M.D. Mol. Cell. Biol. 2000; 20: 8903-8915Crossref PubMed Scopus (106) Google Scholar, 15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar). This molecule has also been reported as RBP21, which interacts with pRB (16Wen H. Ao S. Gene. 2001; 263: 85-92Crossref PubMed Scopus (8) Google Scholar). EID-1 exhibits no homology to known proteins including bHLH factors and HDACs. Functionally, EID-1 exhibits similarity with adenovirus E1A or twist in terms of inhibition of HAT activity (14MacLellan W.R. Xiao G. Abdellatif M. Schneider M.D. Mol. Cell. Biol. 2000; 20: 8903-8915Crossref PubMed Scopus (106) Google Scholar, 15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar, 17Hamamori Y. Sartorelli V. Ogryzko V. Puri P.L. Wu H.Y. Wang J.Y. Nakatani Y. Kedes L. Cell. 1999; 96: 405-413Abstract Full Text Full Text PDF PubMed Scopus (324) Google Scholar). In this study, we identified a new EID-1 family member, termed EID-2 (EID-1-like inhibitor ofdifferentiation-2). EID-2 was mainly expressed in heart, skeletal muscle, kidney, and liver. EID-2 inhibited MyoD-dependent transcription and blocked muscle differentiation in cultured cells like EID-1. However, EID-2 neither bound to p300 nor inhibited p300-dependent transcription. Interestingly, EID-2 associated with class I HDACs. This property was correlated with the ability to repress transcription and its nuclear localization. These results indicate that EID-2 and EID-1 exhibit homology and a similar phenotype but have distinct mechanisms in terms of inhibition of differentiation. U-2OS osteosarcoma cells and 10T1/2 murine fibroblasts were grown in Dulbecco's modified Eagle's medium (Sigma) supplemented with 107 heat-inactivated fetal bovine serum (FBS), 100 units/ml of penicillin, and 100 ॖg/ml of streptomycin (PSG; Invitrogen). C2C12 murine myoblasts were grown in Dulbecco's modified Eagle's medium supplemented with 207 FBS and PSG. To induce differentiation, C2C12 cells were grown in Dulbecco's modified Eagle's medium containing 27 horse serum for 3 days once they had become confluent. Transfection was performed with TransIT-LT1 (Mirus) according to the manufacturer's instructions. pCMV, pcDNA3, pcDNA3-T7-EID-1, pSG5, pSG5-TetR, pSG5-TetR-EID-1, pMCK-luciferase (15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar), pUHC13.3 (18Gossen M. Bujard H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 5547-5551Crossref PubMed Scopus (4245) Google Scholar), pCMV-MyoD (19Novitch B.G. Mulligan G.J. Jacks T. Lassar A.B. J. Cell Biol. 1996; 135: 441-456Crossref PubMed Scopus (268) Google Scholar), 3xGal4-luciferase (20Bhattacharya S. Eckner R. Grossman S. Oldread E. Arany Z. D'Andrea A. Livingston D.M. Nature. 1996; 383: 344-347Crossref PubMed Scopus (419) Google Scholar), pCMV-Gal4-p300 (21Yuan W. Condorelli G. Caruso M. Felsani A. Giordano A. J. Biol. Chem. 1996; 271: 9009-9013Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar), pcDNA-FLAG- HDAC1, and pME18S-FLAG-HDAC2 (22Juan L.J. Shia W.J. Chen M.H. Yang W.M. Seto E. Lin Y.S. Wu C.W. J. Biol. Chem. 2000; 275: 20436-20443Abstract Full Text Full Text PDF PubMed Scopus (362) Google Scholar) were described previously. pRL-SV40-luciferase and pGEM-T Easy were purchased fromPromega. EID-2 cDNA fragments were generated by the PCR reaction using a fetal brain cDNA library (Clontech) as a template. The 5′-primer (CTATTCGATGATGAAGATAC) was designed as a sense oligonucleotide of the pGAD10 vector, and the 3′-primer (AAGTAGTGTCACCACATAAC) was designed as an antisense oligonucleotide whose sequence was obtained from the EST data base of a putative EID-1-related gene. The PCR product was purified and subcloned into the pGEM-T Easy vector (Promega) and sequenced on both strands. The EID-2 cDNA sequence was deduced by comparing the DNA sequences of multiple overlapping clones.EID-2 cDNAs encoding the wild-type EID-2, or mutants thereof, were obtained by PCR using oligonucleotides that introduced a 5′-BamHI site and a 3′-EcoRI site. To obtain internal deletion mutants, a two-step PCR strategy was used, as described previously (23Higuchi R. Krummel B. Saiki R.K. Nucleic Acids Res. 1988; 16: 7351-7367Crossref PubMed Scopus (2098) Google Scholar). The PCR products were restricted withBamHI and EcoRI and then subcloned into pcDNA3-T7, pSG5-TetR (15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar), and DsRed2 (Clontech), which had been linearized with these two enzymes or BglII and EcoRI in case of DsRed2. All of the PCR products were confirmed by DNA sequencing. To determine the transcriptional start sites for the human EID-2 gene, we used the oligo-capping method described previously (24Maruyama K. Sugano S. Gene. 1994; 138: 171-174Crossref PubMed Scopus (532) Google Scholar). In brief, mRNA was purified from HepG2 human hepatocellular carcinoma cell lines followed by exchanging of the cap structure with the adaptor oligonucleotide and reverse transcription. The cDNA was amplified by nested PCR using a sense primer of the adaptor sequence and an antisense primer ofEID-2 open reading frame. The first primer set was as follows: 1st sense adaptor oligo, ATGAGCATCGAGTCGGCCTTG; 1st antisenseEID-2-F, TTCCCGTGTCTGGACCTGGG; 2nd sense adaptor oligo, AGCATCGAGTCGGCCTTGTTG; 2nd antisense EID-2-G, TGCCCTGGCCGCCGCCATCC. The PCR fragment was ligated into the pGEM-T Easy vector and then sequenced on both strands. Northern blotting was performed with a multiple tissue northern blot (Clontech) and detected with a digoxigenin-labeling system (Roche Molecular Biochemicals) according to the manufacturer's instructions. The EID-2 DNA probe was generated with the PCR DIG labeling mix (Roche Molecular Biochemicals) using a sense primer, GGTGCCGGCGGCCAGGGCAG, and an antisense primer, TTCCCGTGTCTGGACCTGGG. The PCR product was flanked by nucleotides 162 and 392 of EID-2. For the TetR-fusion protein transactivation assay, 507 confluent U-2OS cells were transiently transfected in 24-well plates in duplicate with 25 ng of pRL-SV40, 50 ng of pUHC-13–3 reporter plasmid, and increasing amounts of pSG5-TetR-EID-1 or pSG5-TetR-EID-2. Sufficient parental pSG5 was added so that each reaction mix contained the same amount of pSG5 backbone. Forty-eight h after transfection, the cells were lysed. Firefly luciferase activity and Renilla luciferase activity in the cell extracts were determined by the dual-luciferase reporter assay (Promega) according to the manufacturer's instructions. For Gal4-p300 transactivation experiments, 507 confluent U-2OS cells were transiently transfected in 24-well plates in duplicate with 25 ng of pRL-SV40, 50 ng of pGal4-luciferase reporter plasmid, 50 ng of pGal4-p300, and increasing amounts of pcDNA3-T7-EID-1 or pcDNA3-T7-EID-2. Sufficient parental pcDNA3 was added so that each reaction mix contained the same amount of pcDNA3 backbone. Cell extracts were prepared 48 h after transfection. For MyoD transactivation experiments, 507 confluent 10T1/2 cells were transiently transfected in 24-well plates, in duplicate, with 25 ng of pRL-SV40, 50 ng of pCMV-MyoD, 50 ng of pMCK-luciferase reporter, and increasing amounts of pcDNA3-T7-EID-2. Sufficient parental pcDNA3 was added so that each reaction mix contained the same amount of pcDNA3 backbone. Cell extracts were prepared 48 h after transfection. Trichostatin A (TSA; Sigma) was added to the medium 24 h after transfection at the indicated concentration. Cells were lysed in EBC buffer as described previously (25Kaelin Jr., W.G. Ewen M.E. Livingston D.M. Mol. Cell. Biol. 1990; 10: 3761-3769Crossref PubMed Scopus (163) Google Scholar). Protein concentrations were determined by the Bradford method (Bio-Rad). Immunoprecipitation assays of extracts prepared from transfected cells contained 2 mg of cell extract and 1 ॖg of anti-T7 (Novagen) antibody or 1 ॖg of anti-FLAG (M2; Sigma) antibody, in a final volume of 0.5 ml. Following 1 h of incubation at 4 °C with rocking, the Sepharose was washed five times with NETN. Bound proteins were eluted by boiling in SDS-containing sample buffer, resolved by SDS-polyacrylamide gel electrophoresis and then transferred to a nitrocellulose filter. Nitrocellulose filters were blocked in 57 powdered milk in Tris-buffered saline containing Tween 20 for 1 h at room temperature prior to incubation with the primary antibody. Anti-troponin T (JLT-12; Sigma) was used at 1:200 (v/v), anti-tubulin (B-5–1-2; Sigma) at 1:2000 (v/v), and anti-T7 (Novagen) at a concentration of 0.2 ॖg/ml. Following four washes with Tris-buffered saline containing Tween 20, the bound antibody was detected with alkaline phosphatase-conjugated secondary antibodies and with Immun-Star (Bio-Rad) according to the manufacturer's instructions. Flow cytometry was performed essentially as described (26Sellers W.R. Novitch B.G. Miyake S. Heith A. Otterson G.A. Kaye F.J. Lassar A.B. Kaelin Jr., W.G. Genes Dev. 1998; 12: 95-106Crossref PubMed Scopus (286) Google Scholar). C2C12 cells stably transfected with pcDNA3 or pcDNA3-T7-EID-2 were harvested when they were 50 or 1007 confluent or grown in differentiation medium for 3 days, respectively. Samples were analyzed with a FACSCalibur (BD Biosciences), and the data were analyzed with ModFit LT (BD Biosciences). According to EST sequences from a data base, it is suggested that anEID-1-related gene exists (National Center for Biotechnology Information BLAST Searches, accession numbers AA203157 andAA447078). To obtain a cDNA of the putativeEID-1-related gene, we performed PCR using a human fetal brain cDNA library (Clontech) as a template. The 5′-primer was designed as part of the sequence of the pGAD10 vector upstream of the multi-cloning site, and the 3′-primer was designed as a sequence corresponding to the putative end of the open reading frame of the EID-1-related gene obtained from the data base. The PCR product generated gave a relatively broad single band and was purified from the gel. The purified PCR product was ligated into the pGEM-T Easy vector (Promega) and then Escherichia coli was transformed with this construct. Six independent clones were obtained, which contained overlapping fragments of the same cDNA, hereafter called EID-2. All of them contain ATG in-frame with the stop codon. The deduced polypeptides consist of 236 amino acids, and homology to EID-1 was observed in both the N and C termini (Fig.1A). Neither of the six clones had an in-frame stop codon upstream of ATG. Then we used the oligo-capping method (24Maruyama K. Sugano S. Gene. 1994; 138: 171-174Crossref PubMed Scopus (532) Google Scholar) to determine the transcriptional start site, as described under “Experimental Procedures.” We obtained a cDNA containing 51 additional nucleotides upstream of ATG ofEID-2 (data not shown). There was no additional ATG in this portion, supporting that the EID-2 sequence contains the full-length open reading frame. The pRB-binding motif (LXCXE, where Xequals any amino acid residue), which exists in the C-terminal of EID-1, is replaced by LXCXK in EID-2 (Fig. 1,A and B), suggesting that EID-2 may not bind to pRB via this motif. EID-2 had an alanine-rich region in the middle instead of the acidic regions observed in EID-1 (Fig. 1B) (15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar). We then performed Northern blot analysis to determine the tissue distribution of EID-2 mRNA. An ∼5.0-kb transcript was detected abundantly in heart, skeletal muscle, kidney, and liver (Fig.1C, lanes 2, 3, 7, and8). The EID-2 gene has been mapped to chromosome 19q as an UniGene Cluster Hs.18949 (NCBI). We showed previously (14MacLellan W.R. Xiao G. Abdellatif M. Schneider M.D. Mol. Cell. Biol. 2000; 20: 8903-8915Crossref PubMed Scopus (106) Google Scholar, 15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar) that EID-1 had a potential transactivation domain because of its p300-binding property. To determine whether EID-2 has a similar property to EID-1 in terms of activation of transcription as a fusion protein with a heterologous DNA-binding domain, EID-2 was fused to the DNA-binding domain of the TetR, followed by scoring the ability to activate or repress transcription from the luciferase reporter plasmid. Surprisingly, although TetR-EID-1 caused an increase in reporter activity (Fig. 2A,left panel) (15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar), TetR-EID-2 caused a modest but reproducible decrease in reporter activity (Fig. 2A,right panel). In agreement with this result, EID-2 did not bind to p300 in vivo, as determined by means of a mammalian two-hybrid assay (data not shown). Previous reports showed that EID-1 blocked the HAT activity of p300, which caused inhibition of p300-mediated transcription (14MacLellan W.R. Xiao G. Abdellatif M. Schneider M.D. Mol. Cell. Biol. 2000; 20: 8903-8915Crossref PubMed Scopus (106) Google Scholar, 15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar). To determine whether EID-2 can block p300-mediated transcription like EID-1, U-2OS cells were transfected with a reporter plasmid containing Gal4-DNA-binding sites and a plasmid encoding Gal4 fused to the full-length p300 in the presence of a plasmid encoding EID-1 or EID-2. EID-1 inhibited transactivation by p300, whereas EID-2 had no effect on p300-mediated transcription (Fig. 2B). These results suggest that EID-1 and EID-2 have distinct mechanisms as to transcriptional repression. EID-1 inhibits transcription by certain fate-determining proteins such as MyoD (14MacLellan W.R. Xiao G. Abdellatif M. Schneider M.D. Mol. Cell. Biol. 2000; 20: 8903-8915Crossref PubMed Scopus (106) Google Scholar, 15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar). To determine whether EID-2 inhibits the activities of such proteins, 10T1/2 murine fibroblasts were transiently transfected with a plasmid encoding EID-1 or EID-2, along with a MyoD expression plasmid and a reporter plasmid containing the MCK promoter. This promoter is activated by MyoD during myogenic differentiation. As determined by a luciferase assay, both EID-1 and EID-2 inhibited the MyoD-dependent transactivation (Fig. 3B). We tried to determine which region is responsible for the transrepression activity. As shown in Fig. 1, EID-2 and EID-1 exhibit similarities in three distinct portions, namely, one N-terminal and two C-terminal regions. To this end we produced various truncation mutants lacking either the N terminus or C terminus, as well as an internal deletion mutant lacking the central alanine-rich region (Fig.3A). All of the EID-2 mutant proteins in these studies were produced at comparable levels, as determined by immunoblot analyses (data not shown). The wild-type EID-2 inhibited MyoD-dependent transcription, and the various C-terminal truncation mutants and the internal deletion mutant still retained the same inhibitory property. In contrast, all of the N-terminal deletion mutants in this assay showed impaired transrepression ability (Fig.3B). These results indicated that the N-terminal portion of EID-2 is involved in the inhibitory function as to MyoD-dependent transcription. As EID-1 inhibits muscle differentiation of cultured cells, C2C12 myoblasts were stably transfected with EID-2 DNA so as to produce the wild-type EID-2 protein in the next set of experiments. Totally, five clones with lower expression and three clones with higher expression were obtained. The protein levels of ectopically produced EID-2 in representative clones (clones 8 and 15 for lower and higher expression, respectively) were determined by immunoblotting (Fig.4A). It is noteworthy that the EID-2 protein levels were not changing during the course of differentiation. In contrast, the EID-1 protein level decreased with differentiation signal because of protein degradation via the ubiquitin-proteasome pathway (15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar). Both the low and high expressing clones were analyzed for myotube formation (Fig. 4B). There were almost no microscopic difference between the clones in both sparse and confluent cultures in growth medium (GM) (Fig. 4B, a, b,d, e, g, and h). However, the clones transfected with an empty vector formed myotubes (Fig.4B, c) upon a shift to differentiation medium (DM) and expressed markers of muscle differentiation (Fig.4A, lane 2), whereas the clones producing lower level of wild-type EID-2 did not (Fig. 4, A, lane 4 and B, f). The higher expression clones exhibited marked cell death upon a shift to DM (Fig. 4, B,i and C, l). These results indicated that EID-2 had a similar phenotype to EID-1, that is, inhibition of muscle differentiation, when it was ectopically expressed in myoblasts, even though EID-2 did not have the ability to inhibit p300-mediated transactivation (Fig. 2B). Terminal differentiation and cell cycle arrest are closely related. Therefore, we determined the cell cycle profiles of C2C12 myoblasts expressing different levels of EID-2. Both in sparse and confluent cultures in GM, there was almost no difference between the clones with empty vector and EID-2-expressing cells in terms of the cell cycle profiles (Fig. 4C, a, b,e, f, i, and j). After incubation in DM for 3 days, the G1/G0population of each clone exhibited no difference (Fig. 4C,c, g, and k). Note that only a few cells of both the vector transfectant and the lower expresser of EID-2 (clone 8) exhibited cell death (Fig. 4C, c,d, g, and h); however, for the higher expresser of EID-2 (clone 15), the number of dead cells increased dramatically (Fig. 4C, k and l). As transcriptional regulation occurs mainly in the nucleus, we next asked whether EID-2 was localized in the nucleus or the cytoplasm. We transfected U-2OS cells with plasmids encoding red fluorescent protein (DsRed2) or fusion proteins of EID-2 and its mutants (Fig. 5). DsRed2 itself was localized both in the nucleus and the cytoplasm (Fig. 5, a). The fusion protein of wild-type EID-2 to DsRed2 was localized exclusively in the nucleus; however, the fusion protein of the N-terminal deletion mutant, EID-2 (33–236), was localized exclusively in the cytoplasm (Fig. 5, b and c). On the other hand, the fusion proteins of C-terminal deletion mutants still remained in the nucleus (data not shown). Therefore, the N terminus of EID-2 was required for nuclear localization. Previous reports described that HDACs are involved in muscle differentiation (7Mal A. Sturniolo M. Schiltz R.L. Ghosh M.K. Harter M.L. EMBO J. 2001; 20: 1739-1753Crossref PubMed Scopus (206) Google Scholar, 8Miska E.A. Karlsson C. Langley E. Nielsen S.J. Pines J. Kouzarides T. EMBO J. 1999; 18: 5099-5107Crossref PubMed Scopus (465) Google Scholar, 9Wang A.H. Bertos N.R. Vezmar M. Pelletier N. Crosato M. Heng H.H. Th'ng J. Han J. Yang X.J. Mol. Cell. Biol. 1999; 19: 7816-7827Crossref PubMed Scopus (260) Google Scholar, 10Lemercier C. Verdel A. Galloo B. Curtet S. Brocard M.P. Khochbin S. J. Biol. Chem. 2000; 275: 15594-15599Abstract Full Text Full Text PDF PubMed Scopus (182) Google Scholar, 11Lu J. McKinsey T.A. Zhang C.L. Olson E.N. Mol. Cell. 2000; 6: 233-244Abstract Full Text Full Text PDF PubMed Scopus (445) Google Scholar). The data that EID-2 had a potential transrepression domain prompted us to examine a possible interaction between EID-2 and HDACs. To determine whether EID-2 can bind to class I HDACs, U-2OS cells were cotransfected with plasmids encoding T7 epitope-tagged EID-2, or mutants thereof, along with a plasmid encoding FLAG epitope-tagged HDAC1 or HDAC2. HDAC binding to EID-2 was scored by means of anti-T7 immunoblot analysis of anti-FLAG immunoprecipitates (Fig.6A). The wild-type and C-terminal deletion mutants of EID-2 interacted with both HDAC1 and HDAC2 in vivo, whereas the N-terminal deletion mutants of EID-2 (33–236, 47–236, 101–236) did not (Fig. 5A) (data not shown). Next we examined whether the transcriptional repression by EID-2 was recovered by treatment with an HDAC inhibitor, TSA. As shown in Fig. 6B, TSA treatment recovered the EID-2-mediated transcriptional repression in a dose-dependent manner. This result supported that HDAC activity may be involved in the transrepression activity of EID-2. In this study, we identified a novel inhibitor of differentiation, EID-2, which exhibited homology to EID-1. EID-1 and EID-2 showed no homology to any other known proteins. Neither of them exhibited the characteristic structures of the known negative regulators of muscle differentiation. Thus EID-1 and EID-2 comprise a novel family of inhibitors of differentiation with distinct functions from those of known negative regulators of differentiation. In terms of subcellular localization of proteins, the wild-type EID-2 was localized exclusively in the nucleus, whereas the EID-2 mutant lacking N-terminal 32 amino acids was localized in the cytoplasm. Because the cytoplasmic localization of the mutant protein was not affected by the treatment with leptomycin B, an inhibitor of nuclear export, 2S. Miyake and Y. Yuasa, unpublished observation. we speculated that the mutant protein was not able to enter the nucleus, suggesting the existence of the nuclear localization signal in the N-terminal portion of EID-2. In contrast, wild-type EID-1 was localized mainly in the cytoplasm (27Båvner A. Johansson L. Toresson G. Gustafsson J.A. Treuter E. EMBO Rep. 2002; 3: 478-484Crossref PubMed Scopus (56) Google Scholar).2 However, when the cells were treated with leptomycin B, EID-1 was found in the nucleus. These data suggested that EID-1 was originally localized in the nucleus and exported rapidly to the cytoplasm (27Båvner A. Johansson L. Toresson G. Gustafsson J.A. Treuter E. EMBO Rep. 2002; 3: 478-484Crossref PubMed Scopus (56) Google Scholar).2 Interestingly, the EID-1 mutant lacking C-terminal 30 amino acids was localized in the nucleus even without leptomycin B treatment.2 These data indicated the difference between EID-2 and EID-1 as to the subcellular localization. A fusion protein comprising EID-2 and a heterologous DNA-binding domain exhibited transcriptional repression instead of the activation in the case of EID-1, which reflects its p300-binding ability (15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar). EID-1 inhibited transcription caused by fate-determining transcription factors such as MyoD by blocking the HAT activity of p300. This inhibitory effect on HAT was mediated by both the C-terminal p300-binding domain and the middle acidic clusters of EID-1 (15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar). EID-2 also inhibited MyoD-dependent transactivation. However, EID-2 neither bound to p300 nor blocked p300-dependent transcription. Deletion analyses showed that the N-terminal region of EID-2 was involved in the inhibition of MyoD-mediated transcription. Interestingly, both the N-terminal portion of EID-1 and the C-terminal region of EID-2 were dispensable for the inhibitory function as to transcriptional repression. Thus the mechanisms of transrepression and differentiation inhibition of EID-2 may be distinct from those of EID-1. EID-2 interacted with HDACs, which have an opposite effect on transcription to p300. The N-terminal region of EID-2 was necessary for this interaction. EID-1 interacted with p300 via its C-terminal region but not with HDACs, and EID-2 interacted with HDACs via its N-terminal region but not with p300, despite these two putative family proteins exhibited homology in both the N and C termini. The data that the transrepression activity of EID-2 was alleviated by TSA treatment supported the physiological importance of the interaction between EID-2 and HDACs. Like EID-1, EID-2 blocked myogenic differentiation of cultured cells when stably introduced into murine C2C12 myoblasts (Fig. 4). A previous report (26Sellers W.R. Novitch B.G. Miyake S. Heith A. Otterson G.A. Kaye F.J. Lassar A.B. Kaelin Jr., W.G. Genes Dev. 1998; 12: 95-106Crossref PubMed Scopus (286) Google Scholar) indicated that cell cycle arrest and differentiation could be separated, although they are closely linked. Our results support this observation and suggest that EID-2 mainly causes inhibition of differentiation but not cell cycle progression, which was also observed in the case for EID-1 (15Miyake S. Sellers W.R. Safran M. Li X. Zhao W. Grossman S.R. Gan J. DeCaprio J.A. Adams P.D. Kaelin Jr., W.G. Mol. Cell. Biol. 2000; 20: 8889-8902Crossref PubMed Scopus (94) Google Scholar). In addition to inhibiting differentiation, EID-2 induced cell death when the protein level was high (Fig. 4). It remains to be clarified whether this phenomenon is physiologically relevant. As for the mechanism of the inhibition of differentiation by EID-2, the N-terminal 32 amino acids were important not only for the nuclear localization and the transcriptional repression but also HDAC binding. Because HDACs are the inhibitors of muscle differentiation (7Mal A. Sturniolo M. Schiltz R.L. Ghosh M.K. Harter M.L. EMBO J. 2001; 20: 1739-1753Crossref PubMed Scopus (206) Google Scholar), nuclear EID-2 may be associated with HDACs, and the resultant complex may inhibit transcription involved in muscle differentiation. Further biochemical and biological studies will elucidate the link between the role of EID-2 in muscle differentiation and the functions of HDACs. We thank Bill Kaelin, Bill Sellers, Shoumo Bhattacharya, Steve Grossman, and Takayuki Yamada for providing the plasmids. We also thank Sumio Sugano and Yutaka Suzuki for providing the cDNAs and Hidenori Ichijo for helpful suggestion.

Referência(s)