Saccharomyces cerevisiae MutLα Is a Mismatch Repair Endonuclease
2007; Elsevier BV; Volume: 282; Issue: 51 Linguagem: Inglês
10.1074/jbc.m707617200
ISSN1083-351X
AutoresFarid A. Kadyrov, Shannon F. Holmes, Mercedes E. Arana, O.A. Lukianova, Mike O’Donnell, Thomas A. Kunkel, Paul Modrich,
Tópico(s)RNA Research and Splicing
ResumoMutL homologs are crucial for mismatch repair and genetic stability, but their function is not well understood. Human MutLα (MLH1-PMS2 heterodimer) harbors a latent endonuclease that is dependent on the integrity of a PMS2 DQHA(X)2E(X)4E motif (Kadyrov, F. A., Dzantiev, L., Constantin, N., and Modrich, P. (2006) Cell 126, 297-308). This sequence element is conserved in many MutL homologs, including the PMS1 subunit of Saccharomyces cerevisiae MutLα, but is absent in MutL proteins from bacteria like Escherichia coli that rely on d(GATC) methylation for strand directionality. We show that yeast MutLα is a strand-directed endonuclease that incises DNA in a reaction that depends on a mismatch, yMutSα, yRFC, yPCNA, ATP, and a pre-existing strand break, whereas E. coli MutL is not. Amino acid substitution within the PMS1 DQHA(X)2E(X)4E motif abolishes yMutLα endonuclease activity in vitro and confers strong genetic instability in vivo, but does not affect yMutLα ATPase activity or the ability of the protein to support assembly of the yMutLα·yMutSα·heteroduplex ternary complex. The loaded form of yPCNA may play an important effector role in directing yMutLα incision to the discontinuous strand of a nicked heteroduplex. MutL homologs are crucial for mismatch repair and genetic stability, but their function is not well understood. Human MutLα (MLH1-PMS2 heterodimer) harbors a latent endonuclease that is dependent on the integrity of a PMS2 DQHA(X)2E(X)4E motif (Kadyrov, F. A., Dzantiev, L., Constantin, N., and Modrich, P. (2006) Cell 126, 297-308). This sequence element is conserved in many MutL homologs, including the PMS1 subunit of Saccharomyces cerevisiae MutLα, but is absent in MutL proteins from bacteria like Escherichia coli that rely on d(GATC) methylation for strand directionality. We show that yeast MutLα is a strand-directed endonuclease that incises DNA in a reaction that depends on a mismatch, yMutSα, yRFC, yPCNA, ATP, and a pre-existing strand break, whereas E. coli MutL is not. Amino acid substitution within the PMS1 DQHA(X)2E(X)4E motif abolishes yMutLα endonuclease activity in vitro and confers strong genetic instability in vivo, but does not affect yMutLα ATPase activity or the ability of the protein to support assembly of the yMutLα·yMutSα·heteroduplex ternary complex. The loaded form of yPCNA may play an important effector role in directing yMutLα incision to the discontinuous strand of a nicked heteroduplex. Mismatch repair is a conserved process that guards genome stability (reviewed in Refs. 1Kunkel T.A. Erie D.A. Annu. Rev. Biochem. 2005; 74: 681-710Crossref PubMed Scopus (994) Google Scholar, 2Iyer R.R. Pluciennik A. Burdett V. Modrich P.L. Chem. Rev. 2006; 106: 302-323Crossref PubMed Scopus (672) Google Scholar, 3Jiricny J. Nat. Rev. Mol. Cell Biol. 2006; 7: 335-346Crossref PubMed Scopus (927) Google Scholar, 4Modrich P. J. Biol. Chem. 2006; 281: 30305-30309Abstract Full Text Full Text PDF PubMed Scopus (324) Google Scholar). A major function of mismatch repair is the correction of DNA replication errors, a reaction that has been most thoroughly studied in Escherichia coli, where replication error correction is directed to the daughter strand by virtue of the transient absence of d(GATC) methylation on newly synthesized DNA (reviewed in Refs. 1Kunkel T.A. Erie D.A. Annu. Rev. Biochem. 2005; 74: 681-710Crossref PubMed Scopus (994) Google Scholar, 2Iyer R.R. Pluciennik A. Burdett V. Modrich P.L. Chem. Rev. 2006; 106: 302-323Crossref PubMed Scopus (672) Google Scholar, 5Modrich P. Lahue R. Annu. Rev. Biochem. 1996; 65: 101-133Crossref PubMed Scopus (1318) Google Scholar). Eleven activities have been implicated in methyl-directed mismatch repair, which has been reconstituted in a purified system (6Lahue R.S. Au K.G. Modrich P. Science. 1989; 245: 160-164Crossref PubMed Scopus (444) Google Scholar, 7Cooper D.L. Lahue R.S. Modrich P. J. Biol. Chem. 1993; 268: 11823-11829Abstract Full Text PDF PubMed Google Scholar, 8Burdett V. Baitinger C. Viswanathan M. Lovett S.T. Modrich P. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6765-6770Crossref PubMed Scopus (175) Google Scholar, 9Viswanathan M. Burdett V. Baitinger C. Modrich P. Lovett S.T. J. Biol. Chem. 2001; 276: 31053-31058Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). The reaction is initiated via mismatch recognition by MutS, which recruits MutL to the heteroduplex. Assembly of MutS-MutL-heteroduplex complex activates MutH endonuclease, which cleaves the unmethylated strand at a hemimethylated d(GATC) site (10Au K.G. Welsh K. Modrich P. J. Biol. Chem. 1992; 267: 12142-12148Abstract Full Text PDF PubMed Google Scholar). This strand break, which may reside 3′ or 5′ to the mismatch, serves as the entry site for the appropriate 3′ to 5′ or 5′ to 3′ excision system, which removes that portion of the incised strand spanning the two DNA sites (7Cooper D.L. Lahue R.S. Modrich P. J. Biol. Chem. 1993; 268: 11823-11829Abstract Full Text PDF PubMed Google Scholar, 8Burdett V. Baitinger C. Viswanathan M. Lovett S.T. Modrich P. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 6765-6770Crossref PubMed Scopus (175) Google Scholar, 9Viswanathan M. Burdett V. Baitinger C. Modrich P. Lovett S.T. J. Biol. Chem. 2001; 276: 31053-31058Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). DNA polymerase III holoenzyme is sufficient to support repair of the ensuing gap, and ligase restores the covalent integrity to the product (6Lahue R.S. Au K.G. Modrich P. Science. 1989; 245: 160-164Crossref PubMed Scopus (444) Google Scholar).Whereas the E. coli methyl-directed system has served as the paradigm for studies of mismatch repair, several lines of evidence suggest that this reaction may differ significantly from that in other organisms in which mismatch repair has been studied. For example, Streptococcus pneumoniae does not encode a MutH homolog, and MutH and d(GATC) methylase homologs have not been identified in humans, Drosophila melanogaster, or Saccharomyces cerevisiae genomes (NCBI BLAST search of protein databases, not shown). Furthermore, we have recently found that human MutLα (MLH1-PMS2 heterodimer) is a latent endonuclease that incises the discontinuous strand of a nicked heteroduplex in a mismatch-MutSα-, RFC-, PCNA-, and ATP-dependent manner (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). Activity of this endonuclease is dependent on the integrity of a DQHA(X)2E(X)4E metal-binding motif located within the C-terminal portion of PMS2 (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). This motif is highly conserved in eukaryotic PMS2 homologs and is also common in archaebacterial and eubacterial MutL proteins, but is lacking in MutL proteins from bacteria like E. coli that rely on d(GATC) methylation for strand discrimination during mismatch repair (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). Although E. coli MutH and human MutLα are both latent endonucleases, these activities play functionally distinct roles in the two repair systems. Whereas MutH incision provides a nick which serves as the actual strand signal that directs repair (6Lahue R.S. Au K.G. Modrich P. Science. 1989; 245: 160-164Crossref PubMed Scopus (444) Google Scholar, 12Längle-Rouault F. Maenhaut M.G. Radman M. EMBO J. 1987; 6: 1121-1127Crossref PubMed Scopus (69) Google Scholar), incision by MutLα depends on preexistence of a signaling strand break (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar).Yeast S. cerevisiae contains four MutL homologs: MLH1, MLH2, MLH3, and PMS1 (the homolog of human PMS2), which form three heterodimeric complexes with MLH1 the common subunit (1Kunkel T.A. Erie D.A. Annu. Rev. Biochem. 2005; 74: 681-710Crossref PubMed Scopus (994) Google Scholar, 2Iyer R.R. Pluciennik A. Burdett V. Modrich P.L. Chem. Rev. 2006; 106: 302-323Crossref PubMed Scopus (672) Google Scholar, 3Jiricny J. Nat. Rev. Mol. Cell Biol. 2006; 7: 335-346Crossref PubMed Scopus (927) Google Scholar). These complexes are referred to as MutLα (MLH1-PMS1 heterodimer), MutLβ (MLH1-MLH2 heterodimer), and MutLγ (MLH1-MLH3 heterodimer). Of these three complexes, MutLα and MutLγ contain the DQHA(X)2E(X)4E motif within their PMS1 and MLH3 subunits, respectively. The MLH2 subunit of MutLβ has an ENFV(X)2E(X)4D sequence that is partially homologous to the DQHA(X)2E(X)4E motif (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). Genetic studies have shown that yeast MutLα plays a major role in mismatch repair, whereas yeast MutLγ and MutLβ have more specialized roles (1Kunkel T.A. Erie D.A. Annu. Rev. Biochem. 2005; 74: 681-710Crossref PubMed Scopus (994) Google Scholar).We show here that yMutLα, like its human homolog, is a latent endonuclease, but E. coli MutL is not. As in the case of the human protein, yMutLα incises the discontinuous strand of 5′ or 3′ nicked heteroduplex DNA in a mismatch, yMutSα-yPCNA-, yRFC-, and ATP-dependent fashion. Amino acid substitution within the DQHA(X)2E(X)4E motif of yPMS1 inactivates endonuclease activity and confers high mutation rates in vivo. We also present evidence suggesting that yPCNA may play an important role in directing yMutLα endonuclease incision to the nicked heteroduplex strand.EXPERIMENTAL PROCEDURESBaculoviruses—Baculovirus constructs expressing yMLH1 and yPMS1 or yMLH1 and yPMS1-E707K were prepared using the pFastBac Dual vector (Invitrogen). The yMLH1 gene was PCR-amplified from an pCYB2-yMLH1 template (13Hall M.C. Kunkel T.A. Protein Exp. Purif. 2001; 21: 333-342Crossref PubMed Scopus (23) Google Scholar) using primers d(GTCCTCGAGGCCACCATGTCTCTCAGAATAAAAGCACTTG) and d(GTCGCATGCTCATTAACACCTCTCAAAAACTTTGTATAGATC). The PCR product was cleaved with XhoI and SphI and then cloned under p10 promoter control by insertion into XhoI- and SphI-cleaved pFastBac Dual to yield pyMLH1. yPMS1 and yPMS1E707K genes were PCR-amplified from pMH8 (13Hall M.C. Kunkel T.A. Protein Exp. Purif. 2001; 21: 333-342Crossref PubMed Scopus (23) Google Scholar) or an E707K mutant derivative of pMH8 prepared using the mutagenic oligonucleotides d(CGAAATTATACTTTTTATCACTTGCATGC) and its complement. PCR amplification primers were d(GTCGGATCCGCCACCATGACACAAATTCATCAGATAAACG) and d(GTCAGGCCTTATCATATTTCGTAATCCTTCGAAAATGAGC). The yPMS1 or yPMS1E707K PCR products were cleaved with BamHI and StuI and then inserted into BamHI- and StuI-cleaved pyMLH1 to place yPMS1 expression under control of polyhedrin promoter (plasmids pyMutLα and pyMutLαE707K). Sequences of yMLH1 and yPMS1 genes in these transfer vectors were confirmed by DNA sequencing. The Bac-to-Bac baculovirus expression system (Invitrogen) was used to produce recombinant viruses.Protein Preparations—E. coli MutS (14Blackwell L.J. Bjornson K.P. Allen D.J. Modrich P.L. J. Biol. Chem. 2001; 276: 34339-34347Abstract Full Text Full Text PDF PubMed Scopus (84) Google Scholar), MutL (15Spampinato C. Modrich P. J. Biol. Chem. 2000; 275: 9863-9869Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar), and DNA helicase II (16Runyon G.T. Wong I. Lohman T.M. Biochemistry. 1993; 32: 602-612Crossref PubMed Scopus (83) Google Scholar) were prepared by published methods. Exonuclease VII and SSB were obtained from USB. E. coli β-clamp, the γ clamp-loader complex, and DNA polymerase III core were isolated as described (17Kong X.P. Onrust R. O'Donnell M. Kuriyan J. Cell. 1992; 69: 425-437Abstract Full Text PDF PubMed Scopus (631) Google Scholar, 18Onrust R. Finkelstein J. Turner J. Naktinis V. O'Donnell M. J. Biol. Chem. 1995; 270: 13366-13377Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 19Turner J. Hingorani M.M. Kelman Z. O'Donnell M. EMBO J. 1999; 18: 771-783Crossref PubMed Scopus (156) Google Scholar). yRFC (95% pure) and yMutSα (95% pure) were isolated by minor modifications of the published procedures (20Finkelstein J. Antony E. Hingorani M.M. O'Donnell M. Anal. Biochem. 2003; 319: 78-87Crossref PubMed Scopus (61) Google Scholar). Purification of yMutLα, yMutLαE707K, and yPCNA were carried out at 0-4 °C. During isolation of the latter three activities as detailed below, all buffers contained 1 mm dithiothreitol (DTT) 4The abbreviations used are:DTTdithiothreitolBSAbovine serum albumin. and 0.2 mm phenylmethylsulfonyl fluoride, and fractions were collected into tubes containing a set of protease inhibitors to yield final concentrations of aprotinin, leupeptin, E64 and pepstatin of 1 μg/ml, 2 μg/ml, 0.5 μg/ml and 0.7 μg/ml, respectively. Proteins were identified in column fractions by SDS-PAGE followed by Coomassie R-250 staining.yMutLα and yMutLαE707K were purified from baculovirus-infected SF9 cells (MOI of 3-6, 52-h infection), which were collected by centrifugation (1160 × g, 10 min) and frozen in liquid N2. Cell pellets from 1-liter cultures were thawed and suspended in 20 ml of buffer A (20 mm HEPES, pH 7.4, 0.5 mm EDTA, 0.01% Nonidet P-40, 5% glycerol (w/v)) containing 200 mm NaCl. The suspension was clarified by centrifugation at 40,000 × g for 25 min. Ionic strength of the supernatant was adjusted to that of 150 mm NaCl, and the supernatant loaded onto a 5-ml heparin HiTrap column (GE HealthCare), equilibrated with the buffer A containing 150 mm NaCl at flow rate of 1.5 ml/min. After a 15-ml wash with equilibration buffer, the column was eluted with a 60-ml linear gradient of NaCl (150-1000 mm) in buffer A. yMutLα and yMutLαE707K fractions, which eluted at 470 mm NaCl, were diluted to 180 mm NaCl with buffer A and loaded at 1 ml/min onto a 1-ml Mono Q column (GE HealthCare) equilibrated with buffer A containing 180 mm NaCl. After a 5-ml wash with starting buffer, the column was eluted with a 20-ml gradient of NaCl (180-500 mm) in buffer A. yMutLα and yMutLαE707K fractions, which eluted at 240 mm NaCl, were diluted to 120 mm NaCl with buffer A and loaded at 1 ml/min onto a 1-ml Mono S column (GE HealthCare), equilibrated with buffer A containing 120 mm NaCl. After a 5-ml wash with starting buffer, the column was eluted with a 20-ml NaCl gradient (120-500 mm) in buffer A. yMutLα and yMutLαE707K peak fractions, which eluted at ∼260 mm NaCl and were 99% pure, were pooled, quick-frozen in liquid N2 in small aliquots, and stored at -80 °C.Yeast PCNA was expressed in E. coli according to Ayyagari et al. (21Ayyagari R. Impellizzeri K.J. Yoder B.L. Gary S.L. Burgers P.M. Mol. Cell Biol. 1995; 15: 4420-4429Crossref PubMed Scopus (186) Google Scholar), and cells collected and frozen in liquid N2. Cells obtained from a 1.2-liter culture were thawed and suspended in 40 ml of buffer B (25 mm HEPES, pH 7.4, 5% glycerol (w/v), 0.02% Nonidet P-40, 0.5 mm EDTA) containing 50 mm KCl. After disruption by sonication, the lysate was clarified by centrifugation at 40,000 × g for 20 min. The supernatant was adjusted to 150 mm KCl and loaded at 5 ml/min onto a 10-ml HiTrap Q column (GE HealthCare) equilibrated with buffer B containing 150 mm KCl. After a 20-ml wash with starting buffer, the column was eluted with a 100-ml linear gradient of KCl (150-1000 mm) in buffer B. Fractions containing yPCNA, which eluted at 400 mm KCl, were pooled, supplemented with (NH4)2SO4 to 2 m, and loaded at 0.5 ml/min onto a 1-ml Resource Phe column (GE HealthCare) equilibrated with buffer B containing 2 m (NH4)2SO4. After a 10-ml wash with equilibration buffer, the column was eluted with buffer B. yPCNA fractions were pooled and dialyzed against buffer B containing 30 mm KCl for 2.5 h. The dialysate was adjusted with KCl to a conductivity equivalent to that of 40 mm KCl and loaded at 1 ml/min onto a 5-ml heparin HiTrap column (GE HealthCare), equilibrated with buffer B containing 40 mm KCl, followed by 15-ml wash with the equilibration buffer. yPCNA does not bind to the heparin column under these conditions. After adjustment of the KCl concentration of the heparin column pass through to 250 mm, the fraction was loaded at 1.5 ml/min onto a 1-ml MonoQ column (GE HealthCare) equilibrated with buffer B containing 250 mm KCl. The column was washed with 5-ml of equilibration buffer and eluted with a 10-ml linear gradient of KCl (250-600 mm) in buffer B at a flow rate of 0.5 ml/min. yPCNA eluted at 0.42 m KCl. Peak fractions (99% pure) were pooled, and aliquots were quick-frozen in liquid N2 and stored at -80 °C. Protein concentrations were estimated using the Bio-Rad protein assay with bovine serum albumin (BSA, Pierce) as standard and are expressed as mol of heterodimer for yMutSα and yMutLα, homotrimer for yPCNA, and heteropentamer for yRFC.Mismatch-provoked DNA Incision Assay—3′-G-T heteroduplex, 3′-A·T homoduplex, relaxed covalently closed G-T DNA, and relaxed covalently closed A·T homoduplex were prepared from f1MR phages as described (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar, 22Fang W-h. Modrich P. J. Biol. Chem. 1993; 268: 11838-11844Abstract Full Text PDF PubMed Google Scholar, 23Dzantiev L. Constantin N. Genschel J. Iyer R.R. Burgers P.M. Modrich P. Mol. Cell. 2004; 15: 31-41Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). 3′-Substrates contained a single-strand break 141 base pairs 3′ to the location of the mismatch (or A·T base pair in homoduplex controls; shorter path in the circular molecule). In 5′ substrates, the separation distance between the two sites was 128 base pairs. Mismatch-provoked incision reactions (40 μl) contained 20 mm HEPES-KOH (pH 7.6), 140 mm KCl, 5 mm MgCl2, 2 mm ATP, 1 mm DTT, 0.2 mg/ml BSA, 1.2% (w/vol) glycerol, and 1.2 nm nicked 5′- or 3′-DNA. yMutSα (25 nm), yMutLα (2 nm or as indicated), yRFC (12.5 nm), and yPCNA (30 nm) were present as indicated. After incubation at 30 °C for 10 min, reactions were terminated by the addition of 30 μl of 0.35% SDS, 0.3 mg/ml proteinase K, 0.4 m NaCl, 0.3 mg/ml glycogen, and 13 mm EDTA, followed by incubation of the samples at 55 °C for 15 min. After extraction with phenol/chloroform and isopropyl alcohol precipitation, recovered DNA was analyzed by Southern analysis as described previously (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar).E. coli Mismatch Repair Reactions—The possibility that E. coli MutL might harbor endonuclease activity was tested in reactions (20 μl) containing 50 mm HEPES-KOH (pH 8.0), 50 mm KCl, 6 mm MgCl2, 1.4 mm DTT, 0.1 mm EDTA, 50 μg/ml BSA, 2 mm ATP, 1.2 nm nicked 5′-G-T heteroduplex or homoduplex DNA, and as indicated: 18.4 nm MutS (as monomer), 12 nm MutL (as monomer), 11.6 nm β-clamp (as dimer), and 4 nm γ clamp-loader complex. After incubation at 37 °C for 20 min, reactions were quenched by addition of 90 μl of 10 mm Tris-HCl (pH 8.0), 20 mm EDTA, extracted with phenol/chloroform, and precipitated with isopropyl alcohol. Recovered DNA was subjected to electrophoresis through alkaline agarose and Southern analysis as above. Mismatch repair was scored under similar conditions except that reactions were supplemented with 0.1 mm each of the four dNTPs, 265 nm SSB (single-stranded DNA-binding protein), 7 nm DNA helicase II, 16.5 nm exonuclease VII, and 75 nm DNA polymerase III core, consisting of α, ϵ, and θ subunits. Repair was scored by cleavage of reaction products with ClaI and HindIII as described (24Su S.-S. Lahue R.S. Au K.G. Modrich P. J. Biol. Chem. 1988; 263: 6829-6835Abstract Full Text PDF PubMed Google Scholar).ATP-Mn2+-dependent Endonuclease Assays—Reactions (40 μl) contained 20 mm HEPES-NaOH (pH 7.6), 20 mm NaCl, 1 mm MnSO4, 0.5 mm ATP, 1 mm DTT, 0.2 mg/ml bovine serum albumin, 1% (w/vol) glycerol, 1.2 nm f1MR59 supercoiled DNA, and yMutLα or yMutLαE707K as indicated. Incubation was at 30 °C for 20 min. Reactions with E. coli MutL (80 nm) were performed in a similar manner, except that 23 mm KCl was substituted for NaCl, BSA was present at 0.5 mg/ml, and incubation was at 37 °C. Reactions were terminated, and DNA products analyzed as previously described (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar).Other Biochemical Methods—Surface plasmon resonance spectroscopy was performed as described (25Blackwell L.J. Wang S. Modrich P. J. Biol. Chem. 2001; 276: 33233-33240Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar) in 20 mm Tris-HCl, pH 7.5, 140 mm KCl, 1 mm DTT, 0.005% Surfactant P-40, 5 mm MgCl2, and 1 mm ATP. The SA sensor chip (GE HealthCare) was derivatized with 149 resonance units of a 201-bp G-T heteroduplex and with 150 resonance units of an otherwise identical A·T homoduplex.Initial rates of ATP hydrolysis by yMutLα were determined under buffer conditions used for mismatch-provoked DNA incision assays except that 111 mm KCl and 29 mm NaCl were substituted for 140 mm KCl, wild type or mutant yMutLα was present at 1 μm, ATP concentration was varied between 0.005 and 2 mm, and reactions contained 16.7 μCi/ml [γ-32P]ATP (6000 Ci/mmol, GE Healthcare). Reactions were terminated, and ATP hydrolysis quantitated as previously described (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). Km and kcat values were determined by non-linear least squares fit to a hyperbola.Yeast Strains and Plasmids—S. cerevisiae haploid strain E134 (MATa ade5 lys2::InsEA14 trp1-289 his7-2 leu2-3,112 ura3-52) has been described previously (26Hall M.C. Shcherbakova P.V. Kunkel T.A. J. Biol. Chem. 2002; 277: 3673-3679Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 27Shcherbakova P.V. Kunkel T.A. Mol. Cell Biol. 1999; 19: 3177-3183Crossref PubMed Scopus (155) Google Scholar). Haploid strains DAG634 and DAG629 are isogenic to E134 but MATa.Plasmids pAG32, pCORE, and the URA3-based yeast integrative plasmid YIpPMS1 have been described previously (26Hall M.C. Shcherbakova P.V. Kunkel T.A. J. Biol. Chem. 2002; 277: 3673-3679Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar, 28Goldstein A.L. Pan X. McCusker J.H. Yeast (Chichester, England). 1999; 15: 507-511Crossref PubMed Scopus (105) Google Scholar, 29Storici F. Lewis L.K. Resnick M.A. Nat. Biotechnol. 2001; 19: 773-776Crossref PubMed Scopus (274) Google Scholar, 30Storici F. Resnick M.A. Methods Enzymol. 2006; 409: 329-345Crossref PubMed Scopus (221) Google Scholar). E707K and D706N-E707Q substitution mutations for genetic studies were introduced into the yPMS1 gene using the yeast integrative plasmid YIpPMS1 and the QuikChange Site-directed Mutagenesis kit (Stratagene). Oligonucleotide d(CGAAATTATACTTTTTATCACTTGCATGC) with its complement and oligonucleotide d(GTTTATTGTCGATCAGCATGCAAGTAATCAAAAGTATAATTTCGAAACACTGCAG) with its complement were used to introduce E707K and D706N-E707Q mutations, respectively.Construction of Haploid Strains with Mutations in S. cerevisiae PMS1—The chromosomal PMS1 gene in strain E134 was replaced with the mutant pms1-E707K and pms1-D706N-E707Q alleles using the mutant derivatives of plasmid YIpPMS1 cut with HpaI as described previously (26Hall M.C. Shcherbakova P.V. Kunkel T.A. J. Biol. Chem. 2002; 277: 3673-3679Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). The pms1Δ derivatives of E134, DAG634, and DAG629 were created by disrupting the PMS1 gene with an open reading frame conferring resistance to hygromycin B (hphMX4). The hphMX4 cassette was PCR-amplified from the pAG32 plasmid (28Goldstein A.L. Pan X. McCusker J.H. Yeast (Chichester, England). 1999; 15: 507-511Crossref PubMed Scopus (105) Google Scholar) using primers d(ATGACACAAATTCATCAGATAAACGATATAGATGTTCATCGAATTACATCTGGATCGATGAATTCGAGCTCG) and d(TCATATTTCGTAATCCTTCGAAAATGAGCTCCAATCACGTAATTCCATTAAATGTCTCGTACGCTGCAGGTCGAC) that are complementary to PMS1 gene flanking region sequences. The resulting PCR product was then transformed into E134, DAG634, and DAG629 using the lithium acetate method, and pms1Δ derivatives were selected for by resistance to hygromycin B and verified by PCR using primers d(CGATAAAATGTTTCACCACA) and d(TATCCATCAAGCATCTTCAA).Creating Diploid Strains with Mutations in S. cerevisiae PMS1—To create diploid strains, the MET2 gene was deleted in the haploid strains DAG629 and DAG634, and the MET6 gene was deleted in the haploid strain E134, using the delitto perfetto method. Briefly, the KanMX4-URA3 cassette was PCR-amplified from the pCORE plasmid (29Storici F. Lewis L.K. Resnick M.A. Nat. Biotechnol. 2001; 19: 773-776Crossref PubMed Scopus (274) Google Scholar, 30Storici F. Resnick M.A. Methods Enzymol. 2006; 409: 329-345Crossref PubMed Scopus (221) Google Scholar) using the following sets of primers specific to MET2 gene (d(ATGTCGCATACTTTAAAATCGAAAACGCTCCAAGAGCTGGACATTGAGGAGATTAAGGAAGAGCTCGTTTTCGACACTGG) and d(CTACCAGTTGGTAACTTCTTCGGCCTCACCAAAGACAGACGTCTTCGTTTCATCGTTACCTCCTTACCATTAAGTTGATC)) or MET6 gene (d(ATGGTTCAATCTGCTGTCTTAGGGTTCCCAAGAATCGGTCCAAACAGAGAATTAAAGAAGGCGAGCTCGTTTTCGACACTGG) and d(TTAATTCTTGTATTGTTCACGGAAGTACTTGGCGGCTTCGACCATATGAGTCAAAGACAATCTCCTTACCATTAAGTTGATC)). The PCR products were then transformed as described (29Storici F. Lewis L.K. Resnick M.A. Nat. Biotechnol. 2001; 19: 773-776Crossref PubMed Scopus (274) Google Scholar, 30Storici F. Resnick M.A. Methods Enzymol. 2006; 409: 329-345Crossref PubMed Scopus (221) Google Scholar), and disruption of MET2 or MET6 was verified. The haploid strains were then mated and diploids containing at least one genetic copy of either MET2 or MET6 were selected on media lacking methionine. Strains E134, DAG629, and DAG634 containing wild-type PMS1, pms1E707K, pms1D706N/E707Q, or pms1Δ were mated with each other to obtain the desired homozygous and heterozygous strains.S. cerevisiae Mutation Rates—Mutation rates were measured by fluctuation analysis (27Shcherbakova P.V. Kunkel T.A. Mol. Cell Biol. 1999; 19: 3177-3183Crossref PubMed Scopus (155) Google Scholar, 31Drotschmann K. Clark A.B. Tran H.T. Resnick M.A. Gordenin D.A. Kunkel T.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 2970-2975Crossref PubMed Scopus (76) Google Scholar). At least twelve yeast cultures per strain were started from single colonies and grown to stationary phase in YPDA. Cells were plated after appropriate dilutions onto selective medium lacking either lysine or histidine for revertant count, complete medium containing canavanine and lacking arginine for Canr mutant count, and complete medium for viable count. Mutation rates and 95% confidence intervals were then calculated as previously described (27Shcherbakova P.V. Kunkel T.A. Mol. Cell Biol. 1999; 19: 3177-3183Crossref PubMed Scopus (155) Google Scholar, 32Tran H.T. Keen J.D. Kricker M. Resnick M.A. Gordenin D.A. Mol. Cell Biol. 1997; 17: 2859-2865Crossref PubMed Scopus (274) Google Scholar).RESULTSS. cerevisiae MutLα Is an Endonuclease, but E. coli MutL Is Not—Integrity of a hPMS2 DQHA(X)2E(X)4E metal-binding motif is required for hMutLα endonuclease activity (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). This motif is also present in the S. cerevisiae PMS1 subunit (the homolog of hPMS2) of yMutLα, but is absent in E. coli MutL (Fig. 1A). Activation of hMutLα endonuclease at physiological ionic strength is dependent on a mismatch, a strand break, hMutSα, hRFC, hPCNA, and ATP·Mg2+; however, an ATP-stimulated mismatch-independent activity that does not require other protein cofactors is readily detectable at low ionic strength in the presence of Mn2+ (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). Near homogeneous yMutLα displays a similar ATP-stimulated, Mn2+-dependent endonuclease that nicks mismatch-free supercoiled DNA at low ionic strength (Fig. 1B). This Mn2+-dependent activity is further stimulated by yeast RFC and PCNA, an effect that requires the presence of both proteins (supplemental Fig. S1). By contrast, we have been unable to detect Mn2+-dependent endonuclease activity associated with E. coli MutL (Fig. 1C).As observed with the corresponding human proteins at physiological ionic strength, yMutSα, yMutLα, yRFC, and yPCNA support a mismatch- and ATP·Mg2+-dependent nucleolytic reaction that degrades the incised strand of 5′- or 3′-nicked heteroduplex DNA, an effect that requires all 4 proteins and ATP (Fig. 2, A-D and Table 1). This reaction depends on a pre-existing DNA break because no detectable hydrolysis was observed under these conditions when the nicked substrate was replaced by a relaxed, covalently closed circular heteroduplex (supplemental Fig. S2A). Furthermore, because the reaction products remain fully sensitive to several restriction endonucleases that cleave near the mismatch or the original heteroduplex strand break (supplemental Fig. S2B), we conclude that hydrolysis in this system does not produce single-stranded gaps and hence that it occurs by an endonucleolytic mechanism. As shown previously with the corresponding human activities (11Kadyrov F.A. Dzantiev L. Constantin N. Modrich P. Cell. 2006; 126: 297-308Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar), incision by yMutLα in the presence of yMutSα, yRFC, and yPCNA can occur throughout the nicked heteroduplex strand (supplemental Fig. S3), although there is a clear preference
Referência(s)