Tissue-specific and Ubiquitous Promoters Direct the Expression of Alternatively Spliced Transcripts from the Calcitonin Receptor Gene
2001; Elsevier BV; Volume: 276; Issue: 25 Linguagem: Inglês
10.1074/jbc.m007104200
ISSN1083-351X
AutoresOrasa Anusaksathien, Catherine Laplace, Xin Li, Yan Ren, Peng Lan, Steven R. Goldring, Deborah L. Galson,
Tópico(s)Signaling Pathways in Disease
ResumoThe gene encoding the murine calcitonin receptor (mCTR) was isolated, and the exon/intron structure was determined. Analysis of transcripts revealed novel cDNA sequences, new alternative exon splicing in the 5′-untranslated region, and three putative promoters (P1, P2, and P3). The longest transcription unit is greater than 67 kilobase pairs, and the location of introns within the coding region of the mCTR gene (exons E3–E14) are identical to those of the porcine and human CTR genes. We have identified novel cDNA sequences that form three new exons as well as others that add 512 base pairs to the 5′ side of the previously published cDNA, thereby extending exon E1 to 682 base pairs. Two of these novel exons are upstream of exon E2 and form a tripartite exon E2 (E2a, E2b, and E2c) in which E2a is utilized by promoter P2 with variable splicing of E2b. The third new exon (E3b′) lies between E3a and E3b and is utilized by promoter P3. Analysis of mCTR mRNAs has revealed that the three alternative promoters give rise to at least seven mCTR isoforms in the 5′ region of the gene and generate 5′-untranslated regions of very different lengths. Analysis by reverse transcription-polymerase chain reaction shows that promoters P1 and P2 are utilized in osteoclasts, brain, and kidney, whereas promoter P3 appears to be osteoclast-specific. Using transiently transfected reporter constructs, promoter P2 has activity in both a murine kidney cell line (MDCT209) and a chicken osteoclast-like cell line (HD-11EM), whereas promoter P3 is active only in the osteoclast-like cell line. These transfection data confirm the osteoclast specificity of promoter P3 and provide the first evidence that the CTR gene is regulated in a tissue-specific manner by alternative promoter utilization. AF333473 AF333474 AF333475 AF333476 AF333477 AF333478 AF333479 AF333480 AF333481 AF333482 AF333483 AF333484 AF333485 The gene encoding the murine calcitonin receptor (mCTR) was isolated, and the exon/intron structure was determined. Analysis of transcripts revealed novel cDNA sequences, new alternative exon splicing in the 5′-untranslated region, and three putative promoters (P1, P2, and P3). The longest transcription unit is greater than 67 kilobase pairs, and the location of introns within the coding region of the mCTR gene (exons E3–E14) are identical to those of the porcine and human CTR genes. We have identified novel cDNA sequences that form three new exons as well as others that add 512 base pairs to the 5′ side of the previously published cDNA, thereby extending exon E1 to 682 base pairs. Two of these novel exons are upstream of exon E2 and form a tripartite exon E2 (E2a, E2b, and E2c) in which E2a is utilized by promoter P2 with variable splicing of E2b. The third new exon (E3b′) lies between E3a and E3b and is utilized by promoter P3. Analysis of mCTR mRNAs has revealed that the three alternative promoters give rise to at least seven mCTR isoforms in the 5′ region of the gene and generate 5′-untranslated regions of very different lengths. Analysis by reverse transcription-polymerase chain reaction shows that promoters P1 and P2 are utilized in osteoclasts, brain, and kidney, whereas promoter P3 appears to be osteoclast-specific. Using transiently transfected reporter constructs, promoter P2 has activity in both a murine kidney cell line (MDCT209) and a chicken osteoclast-like cell line (HD-11EM), whereas promoter P3 is active only in the osteoclast-like cell line. These transfection data confirm the osteoclast specificity of promoter P3 and provide the first evidence that the CTR gene is regulated in a tissue-specific manner by alternative promoter utilization. AF333473 AF333474 AF333475 AF333476 AF333477 AF333478 AF333479 AF333480 AF333481 AF333482 AF333483 AF333484 AF333485 calcitonin receptor human CTR porcine CTR murine CTR untranslated region signal transducer and activator of transcription kilobases(s) base pair(s) nucleotide(s) glyceraldehyde-3-phosphate dehydrogenase RNase protection assay polymerase chain reaction rapid amplification of cDNA ends reverse transcription adapter primer 1 and 2, respectively bacterial artificial clone The calcitonin receptor (CTR),1 which contains seven transmembrane domains, is a member of the class II G protein-coupled receptor family (1Segre G.V. Goldring S.R. Trends Endocrinol. Metab. 1993; 4: 309-314Abstract Full Text PDF PubMed Scopus (303) Google Scholar, 2Strader C.D. Fong T.M. Graziano M.P. Tota M.R. FASEB J. 1995; 9: 745-754Crossref PubMed Scopus (330) Google Scholar). The class II family, while structurally related, has little similarity at the amino acid level to the class I family (e.g. rhodopsin and β-adrenergic receptor). The CTR is coupled to multiple signal transduction pathways. Binding of the 32-amino acid peptide hormone calcitonin can stimulate activation of the following: the adenylate cyclase/cAMP/protein kinase A pathway (3Force T. Bonventre J.V. Flannery M.R. Gorn A.H. Yamin M. Goldring S.R. Am. J. Physiol. 1992; 262: F1110-F1115PubMed Google Scholar); the phosphoinositide-dependent phospholipase C pathway (which results in Ca2+ mobilization (4Teti A. Paniccia R. Goldring S.R. J. Biol. Chem. 1995; 270: 16666-16670Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar) and protein kinase C activation (5Chakraborty M. Chatterjee D. Kellokumpu S. Rasmussen H. Baron R. Science. 1991; 251: 1078-1082Crossref PubMed Scopus (131) Google Scholar)); and the phosphatidylcholine-dependent phospholipase D pathway (which also results in protein kinase C activation) (6Naro F. Perez M. Migliaccio S. Galson D.L. Orcel P. Teti A. Goldring S.R. Endocrinology. 1998; 139: 3241-3248Crossref PubMed Scopus (32) Google Scholar). Calcitonin directly inhibits bone resorption by osteoclasts and enhances renal calcium excretion (7Friedman J. Raisz L.G. Science. 1965; 150: 1465-1467Crossref PubMed Scopus (238) Google Scholar, 8Raisz L.G. Au W.Y.W. Friedman J. Niemann I. Am. J. Med. 1967; 43: 684-690Abstract Full Text PDF PubMed Scopus (53) Google Scholar, 9Warshawsky H. Goltzman D. Rouleau M.F. Bergeron J.J.M. J. Cell Biol. 1980; 85: 682-694Crossref PubMed Scopus (182) Google Scholar). It also has effects on the central nervous, cardiovascular, gastrointestinal, and reproductive systems, and CTRs have been identified on osteoclasts, certain kidney cells, some regions of the brain, testis, ovary, and spermatoza (for a review, see Ref. 10Deftos L. Favos M. Primer on the Metabolic Bone Diseases and Disorders of Mineral Metabolism. Lipincott-Raven Press, Philadelphia1996: 82-87Google Scholar). Recently, it has been demonstrated that the human CTR (hCTR), when coexpressed with receptor activity-modifying proteins, is also a receptor for the 37-amino acid peptide hormone amylin (11Christopoulos G. Perry K.J. Morfis M. Tilakaratne N. Gao Y. Fraser N.J. Main M.J. Foord S.M. Sexton P.M. Mol. Pharmacol. 1999; 56: 235-242Crossref PubMed Scopus (421) Google Scholar, 12Foord S.M. Marshall F.H. Trends Pharmacol. Sci. 1999; 20: 184-187Abstract Full Text Full Text PDF PubMed Scopus (149) Google Scholar, 13Muff R. Buhlmann N. Fischer J.A. Born W. Endocrinology. 1999; 140: 2924-2927Crossref PubMed Scopus (218) Google Scholar). This peptide has effects on insulin release, glucose uptake, and glycogen synthesis in skeletal musculature (14Wimalawansa S.J. Crit. Rev. Neurobiol. 1997; 11: 167-239Crossref PubMed Scopus (393) Google Scholar). The CTR gene has a complex structural organization with several CTR protein isoforms derived from alternative splicing of transcripts from a single gene (15Goldring S. Bilezikian J. Raisz L. Rodan G. Principles of Bone Biology. Academic Press, Inc., New York1996: 462-470Google Scholar). These isoforms, which are functionally distinct in terms of ligand binding specificity and/or signal transduction pathway utilization, are distributed both in a tissue-specific and species-specific pattern (16–27). Furthermore, spliced mRNA products have been identified in hCTR that generate translation terminations shortly after transmembrane domain 1 (28Moore E.E. Kuestner R.E. Stroop S.D. Grant F.J. Matthewes S.L. Brady C.L. Sexton P.M. Findlay D.M. Mol. Endocrinol. 1995; 9: 959-968Crossref PubMed Google Scholar, 29Galson D.L. Bloch D.B. Doppalapudi V.A. Owen C. Anusaksathien O. Goldring S.R. J. Bone Miner. Res. 1996; 11 Suppl. 1: S203Google Scholar), resulting in the expression of truncated CTR proteins. Although some of the human (23Albrandt K. Brady E.M.G. Moore C.X. Mull E. Sierzega M.E. Beaumont K. Endocrinol. 1995; 136: 5377-5384Crossref PubMed Google Scholar) and porcine CTR (pCTR) (22Zolnierowicz S. Cron P. Solinas-Toldo S. Fries R. Lin H.Y. Hemmings B.A. J. Biol. Chem. 1994; 269: 19530-19538Abstract Full Text PDF PubMed Google Scholar) genomic sequences have been cloned, little is known about the mechanism of transcriptional regulation for the CTR gene in osteoclasts or in other tissues in which it is expressed. A 657-bp fragment of the pCTR promoter was demonstrated to drive expression of a luciferase reporter gene when transfected into the CTR-expressing porcine kidney epithelial cell line LLC-PK1 (22Zolnierowicz S. Cron P. Solinas-Toldo S. Fries R. Lin H.Y. Hemmings B.A. J. Biol. Chem. 1994; 269: 19530-19538Abstract Full Text PDF PubMed Google Scholar). Recently, the function of a 2.1-kb fragment of the pCTR promoter has been assessed in a transgenic mouse by Jagger et al. (30Jagger C. Gallagher A. Chambers T. Pondel M. Endocrinology. 1999; 140: 492-499Crossref PubMed Scopus (29) Google Scholar). They found that although this region directed expression of the lacZ reporter in several embryonic and fetal tissues that express endogenous mCTR, it was not sufficient to direct transcription in the adult kidney or bone of the transgenic mice. In this report, the gene encoding the murine CTR (mCTR) was isolated, and the exon/intron structure was determined. We have identified novel cDNA sequences that extend the beginning of the previously published mCTR cDNA (21Yamin M. Gorn A.H. Flannery M.R. Jenkins N.A. Gilbert D.J. Copeland N.G. Tapp D.R. Krane S.M. Goldring S.R. Endocrinology. 1994; 135: 2635-2643Crossref PubMed Scopus (60) Google Scholar) by 512 bp, thereby enlarging exon E1 to 682 bp. Further analysis of mCTR cDNAs has also revealed three new exons within the 5′-UTR, new alternative exon splicing in the 5′-UTR, and the presence of three putative promoters (P1, P2, and P3). Two of these novel exons are upstream of the original cDNA exon E2 and form a tripartite exon E2 (E2a, E2b, and E2c) in which E2a is utilized by promoter P2 with variable splicing of E2b. The third new exon (E3b′) lies between E3a and E3b and is utilized by promoter P3. Analysis of mCTR mRNAs reveals that the transcripts from the three promoters are spliced to yield seven different 5′-UTR structures. Analysis by both RT-PCR and transient transfection of promoter-luciferase reporter constructs shows that the P1 promoter (located upstream of an expanded exon E1) and the P2 promoter (located upstream of exon E2a) are utilized in osteoclasts, brain, and kidney, whereas the P3 promoter (located upstream of the novel exon E3b′) appears to be exclusively utilized in osteoclasts. The P2 promoter of mCTR is highly homologous to the promoter region previously defined for pCTR in kidney cells. These studies provide the first evidence that CTR is regulated in a tissue-specific manner by alternative promoter utilization and that there is a unique promoter (P3) that regulates CTR expression only in osteoclasts. A murine genomic library made from the 129 mouse strain in Lambda FIX II (provided by Dr. Chuxia Deng, Bethesda, MD) was screened using probes from the murine CTR cDNA clone isolated by Yamin et al.(21Yamin M. Gorn A.H. Flannery M.R. Jenkins N.A. Gilbert D.J. Copeland N.G. Tapp D.R. Krane S.M. Goldring S.R. Endocrinology. 1994; 135: 2635-2643Crossref PubMed Scopus (60) Google Scholar). The probes were labeled with 32P by random priming. The 13 positive phage clones were plaque-purified, and DNA was prepared utilizing standard procedures. NotI fragments containing the mCTR genomic DNA from these phage were subcloned into pBluescript KS (Stratagene) and analyzed by restriction enzyme site mapping and hybridization with region-specific CTR probes. In some cases, PCR between exons was used to determine the intron size. Note that the originally published cDNA (21Yamin M. Gorn A.H. Flannery M.R. Jenkins N.A. Gilbert D.J. Copeland N.G. Tapp D.R. Krane S.M. Goldring S.R. Endocrinology. 1994; 135: 2635-2643Crossref PubMed Scopus (60) Google Scholar) included 14 bp of adapter and the mCTR sequence actually starts at position 15 (GenBankTMaccession number U18542). 2The following sequences deposited into GenBankTM are referred to in this paper: the original mCTR cDNA sequence under GenBankTM accession number U18542 (21Yamin M. Gorn A.H. Flannery M.R. Jenkins N.A. Gilbert D.J. Copeland N.G. Tapp D.R. Krane S.M. Goldring S.R. Endocrinology. 1994; 135: 2635-2643Crossref PubMed Scopus (60) Google Scholar); human BAC GS1-438P6 under GenBankTM accession number AC005024; human BAC GS1-117O10 under GenBankTMaccession number AC003078; hCTR E2ac cDNA under GenBankTM accession number AB022177 (59Nishikawa T. Ishikawa H. Yamamoto S. Koshihara Y. FEBS Lett. 1999; 458: 409-414Crossref PubMed Scopus (20) Google Scholar); and pCTR genomic under GenBankTM accession number Z31356 (22Zolnierowicz S. Cron P. Solinas-Toldo S. Fries R. Lin H.Y. Hemmings B.A. J. Biol. Chem. 1994; 269: 19530-19538Abstract Full Text PDF PubMed Google Scholar).Genomic regions of interest, such as exon/intron junctions, were sequenced using the dideoxy chain termination method (31Sanger F. Nicklen S. Coulson A.R. Proc. Natl. Acad. Sci. U. S. A. 1977; 74: 5463-5467Crossref PubMed Scopus (52766) Google Scholar) with Sequenase polymerase version 2 (U.S. Biochemical Corp.) and primers based on previously known or novel mCTR sequence as necessary. The exon/intron junctions were established by comparison of genomic sequence with the cDNA sequence. Comparison with other CTR genomic sequences was done using both BLAST (32Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (60220) Google Scholar) and the GCG sequence analysis package (33Devereux J. Haeberli P. Smithies O. Nucleic Acids Res. 1984; 12: 387-395Crossref PubMed Scopus (11531) Google Scholar). Total RNA was isolated from either mouse organs (brain, liver, kidney), osteoclast cocultures, or cell lines by using Trizol Reagent (Life Technologies, Inc.) according to the manufacturer's instructions. Osteoclasts were generated by coculture of hematopoietic progenitors with the stromal cell line ST2 essentially as previously described (34Turner C.W. Archer D.R. Wong J. Yeager A.M. Fleming W.H. Br. J. Haematol. 1998; 103: 326-334Crossref PubMed Scopus (20) Google Scholar). Bone marrow cells were collected by flushing the femurs and tibiae of 5-week-old male C57/Bl6 mice with α-minimal essential medium. The cells were cultured for 24 h in α-minimal essential medium containing 10% fetal calf serum, and then the nonadherent population was collected and erythrocytes were removed using a density gradient centrifugation on Ficoll-Hypaque (Sigma). The remaining hematopoietic progenitors were cocultured with ST2 cells at a 1:10 ratio in medium containing 1,25-(OH)2D3 (10−8m) and dexamethasone (10−7m). After 9 days of coculture, the ST2 stromal cells were removed by incubation with collagenase, and then the remaining osteoclasts were harvested for RNA as previously described (35Lee S.K. Goldring S.R. Lorenzo J. Endocrinol. 1995; 136: 4572-4581Crossref PubMed Scopus (0) Google Scholar). mRNA was prepared using the poly(A) quick mRNA isolation kit (Stratagene). RNA samples (5–20 μg) from various tissues or cell lines were reverse transcribed to generate primer extension products using the Ready-To-Go You-Prime First-Strand Beads kit (Amersham Pharmacia Biotech) and an mCTR-specific antisense primer located in exon E1 end-labeled with [γ-32P]ATP using T4 polynucleotide kinase. The primer extension products were separated in a 7% polyacrylamide sequencing gel together with a sequencing reaction of the mCTR genomic clone 18.26 using the same primer used in the primer extension reaction. To determine the 5′-end of exon E1, an RPA was performed. A 532-bp mCTR genomic DNA fragment spanning from a BsaBI site to a BamHI site encompassing the 5′-end region and part of exon E1 was blunted with Klenow and subcloned into the SmaI site of pBKS vector, linearized with BamHI, and used as a template for synthesizing a 635-bp riboprobe with [α-32P]CTP utilizing T3 RNA polymerase. Total RNA from mouse brain (200 μg) and mRNA from MDCT209 cells (20 μg) were used as templates for RPA using 2 × 105 cpm of the riboprobe following the manufacturer's protocol (Ambion). In addition, mCTR cRNA sense strand derived from the same RPA construct was used as a positive control that would yield a 376-bp protected fragment. The RPA protected products were separated in a 5% sequencing gel and analyzed using a PhosphorImager (Molecular Dynamics, Inc., Sunnyvale, CA). To identify and verify the sequence of the 5′-ends of mCTR transcripts, mouse brain, kidney, and osteoclast RNA samples were used to generate adapter-ligated double-stranded cDNA using the Marathon cDNA amplification kit (CLONTECH). For each PCR reaction, 2 μl of the double-stranded cDNA adapter ligation solution diluted to 1:10 was added into a total volume of 50 μl of PCR buffer solution containing 10 mm Tris-HCl, pH 8.3, 50 mm KCl, 2.5 mm MgCl2, 1 μm each of the 5′ and 3′ primers, 2 mm dNTPs, and 2.5 units of Taq DNA polymerase (Fisher). Several 5′-RACE experiments were performed using different primer sets with two rounds of PCR. The first round PCR was performed using the sense adapter primer AP1 and two different mCTR antisense primers, either mPE1 or E6-R (see Table I). The AP1 + mPE1 PCR products were used for a second nested round of PCR using the sense adapter primer AP2 and the mCTR primer mPE3. The AP1 + E6-R PCR products were used for several nested PCRs using sense primer AP2 and either mCTR antisense primer E4-R, E5-R, or E6-R. The PCR conditions for both PCR rounds were 94 °C for 15 s, 60 °C for 15 s, and 68 °C for 15 s for 30 cycles using the Gene Amp PCR system 9600 (PerkinElmer Life Sciences). Southern blot analysis was performed using [γ-32P]ATP-end-labeled oligonucleotide probes located internal to the expected PCR products for each experiment, such as mPE4 and E3b-R. The mCTR positive 5′-RACE products were subcloned into the TA 2.1 vector (Invitrogen). The resultant cDNAs were characterized by sequencing from both orientations using T7 and M13-reverse primers.Table IPrimersNameLocation (F/R) 1-aR, reverse; F, forward.Length5′ → 3′ sequenceE1-FmCTR E1 (F)22AGCCCGTCCTTGGAAGCAACTTmPE1mCTR E1 (R)26AGGCGGGCGCAGTCTGGGCTGGCAGGmPE3mCTR E1 (R)22GCAAGTTGCTTCCAAGGACGGGmPE4mCTR E1 (R)42GCAAGTTGCTTCCAAGGACGGGCTATCCTCCACCTCCTATCCmPE6mCTR E1 (R)30GAGGTTGAGTTTGGGTAGTTCTGGGTGACAE2a-F1mCTR E2a (F)12GGCACTGCTAAGE2a-F2mCTR E2a (F)18GCGGCAGGCACTGCTAAGE2b-RmCTR E2b (R)31AATAGGCTCCAGGCAAGGTCCTTTTCCCGGTE2c-FmCTR E2c (F)23CTTCTGCGCCTCACGCTGCCGTTE2c-RmCTR E2c (R)21CTGGGCACAGCTCAGGTGTTCE3a-FmCTR E3a (F)23CATCCACCTAAGGTAAGTGCCATE3a-RmCTR E3a (R)21TAGCCCTGCTCCCTCGGTTTCE3b′-FmCTR E3b′ (F)24CCCTGAAGCCCAAAGGAAACTGTGE3b′-RmCTR E3b′ (R)25AGACTGAATAGCCTGAATGCACTCGE3b-RmCTR E3b (R)23GGAGCAGGAGCAGCAGGGTGAACE4-RmCTR E4 (R)24CGGAGTCAGTGAGATTGGTAGGAGE5-RmCTR E5 (R)21CAAAGTCCGGGAAGTAGTCAGE6-RmCTR E6 (R)20GGTCGGTTGCTGTCAGGGTGmTM5-FmCTR E11/12 (F)24GTCATGGTGGCTCTGGTGGTCAACmTM7-RmCTR E13 (R)24GCAGAAGCAGTAGATAGTCGCCACAP1Adapter primer 127CCATCCTAATACGACTCACTATAGGGCAP2Adapter primer 223ACTCACTATAGGGCTCGAGCGGCGAPDH-SGAPDH24TTCGACAGTCAGCCGCATCTTCTTGAPDH-ASGAPDH23CAGGCGCCCAATACGACCAAATC1-a R, reverse; F, forward. Open table in a new tab For reverse transcription reactions, 2 μg of total RNA samples from mouse liver, brain, kidney, and osteoclasts derived from bone marrow cocultures were used to generate cDNAs with 0.5 μg of oligo(dT) using the reverse transcription Ready-To-Go You-Prime First-Strand Beads kit (Amersham Pharmacia Biotech). Different sets of mCTR-specific primer pairs were used to analyze the variable structure of the mCTR mRNAs, and a pair of primers specific for GAPDH was used to assess the quality of the RNA samples. Additionally, a pair of primers (mTM5-F and mTM7-R) from a mCTR region without variable splicing was used to establish the presence or absence of mCTR mRNA in each sample. For all PCRs except GAPDH and plasmid controls, equal amounts of each cDNA (2 μl of a 30-μl RT reaction) were added to a total volume of 50 μl of PCR solution similar to that previously described in the 5′-RACE method. For the GAPDH PCR, only 1 μl of the RT reaction was added to the PCR. PCR of relevant mCTR cDNA plasmids (1 ng) generated by the 5′-RACE (P1.1, P2.1, P2.3, and P3.1) were used to prepare control PCR products. Also, for all PCR reactions, a negative control containing H2O instead of cDNA was run. The PCR conditions for the 110-bp GAPDH PCR product were 95 °C for 2 min and then 30 cycles of 95 °C for 30 s and 60 °C for 30 s, ending with 72 °C for 7 min. To analyze the mCTR mRNA splice isoforms generated from the P1, P2, and P3 transcripts, either sense primer E1-F, E2a-F, or E3b′-F was used, respectively, together with antisense primer E4-R. PCR conditions were 94 °C for 15 s, 60 °C for 15 s, and 72 °C for 30 s for 35 cycles, except for E2a-F2 + E4-R, for which 50 °C was used instead of 60 °C. Southern blot analysis was performed sequentially or on parallel blots with [γ-32P]ATP end-labeled oligonucleotide probes E2a-F2, E2b-R, E2c-F, E3a-R, E3b′-F, and E3b-R. To test the putative P2 and P3 mCTR promoter activities, the blunt-ended mCTR DNA genomic fragments containing appropriate P2 and P3 regions were subcloned in both orientations into theSmaI site of the pGL3 basic luciferase vector (Promega), which does not contain a promoter or an enhancer. The initial P2 genomic region used spanned from the BamHI site in E1 (−1253 relative to E2a) to the EcoRI site at the end of E2c (+398) (−1253P2Bam-F and −1253P2Bam-R). The initial 859-bp P3 genomic region (starting at −797 relative to E3b′) was synthesized by PCR using primers E3a-F and E3b′-R (−797P3ab′-F and −797P3ab′-R). The identity and orientation of each construct was verified by sequencing. In addition, three P2 deletion constructs were generated using theKpnI, SacI, and NheI sites in the 5′ polylinker region and in the P2 promoter DNA (−806P2Kpn-F, −285P2Sac-F, −179P2Nhe-F, respectively) to drop successively larger fragments after recircularizing the construct. Further P2 deletions were derived from the −179P2Nhe-F plasmid as follows. The −30P2Afl-F and the −179/−27P2NAf-F plasmids were generated by dropping the 148-bp NheI/AflII and the 453-bpAflII/HindIII fragments, respectively, blunting, and recircularizing, while the −178/+16P2NNs-F was generated by subcloning the 194-bp NheI/NspBII fragment intoSmaI-cut pGL3basic. The −797P3ab′-F construct was used to generate P3 deletions to −319 and −94 by digesting the plasmid withNheI plus XhoI, which cut in the polylinker, isolating the mCTR fragment, and redigesting it withBsrI or MslI. The BsrI/XhoI and MslI/XhoI mCTR fragments were then blunted and cloned back into the SmaI site of pGL3basic to make −319P3Bsr-F and −94P3Msl-F, respectively. The promoter activity of the various P2- and P3-pGL3basic constructs were tested in two different cell lines, a murine distal convoluted tubule cell line (MDCT209) (36Gesek F.A. Friedman P.A. J. Clin. Invest. 1992; 90: 429-438Crossref PubMed Scopus (177) Google Scholar) (a generous gift from Dr. P. Friedman, Dartmouth, Hanover, NH) and the chicken osteoclast-like cell line HD-11EM (37Hsia Y.-J. Kim J.-K. Damoulis P.D. Hauschka P.V. J. Bone Miner. Res. 1995; 10 Suppl 1: S424Google Scholar, 38Steinbeck M. Kim J. Trudeau M. Hauschka P. Karnovsky M. J. Cell. Physiol. 1998; 176: 574-587Crossref PubMed Scopus (57) Google Scholar) (kindly provided by Dr. P. Hauschka, Boston, MA). The cell lines were maintained in Dulbecco's modified Eagle's medium/Ham's F-12 medium supplemented with 5% (MDCT209) or 10% (HD-11EM) fetal calf serum. Briefly, 2 × 105 cells/well (MDCT) or 1 × 106cells/well (HD-11EM) in a six-well plate were incubated at 37 °C overnight. The P2-pGL3 and P3-pGL3 plasmids (1.5–3 μg/well) were transiently transfected (in triplicate) into each cell line in serum-free medium using 5–12 μl LipofectAMINE (Life Technologies, Inc.) and incubated 4–5 h before an appropriate amount of serum was added, and the cells were further incubated at 37 °C for 24–48 h. The transfected cells were harvested by washing twice with phosphate-buffered saline (pH 7.4) followed by incubation with 300 μl of lysis buffer (25 mm glycyl glycine buffer (pH 7.8), 15 mm MgSO4, 4 mm EGTA, 1% Triton X-100, and 1 mm dithiothreitol) for 30 min at 4 °C. Luciferase activities were determined in luciferase buffer (25 mm glycyl glycine buffer (pH 7.8), 15 mmKPO4 (pH 7.8), 15 mm MgSO4, 4 mm EGTA, 2 mm ATP, and 1 mmdithiothreitol) using an AutoLumat (EGΣG Berthold) luminometer. The results represent at least three repeats of each experiment. Luciferase activity was normalized by total protein concentration determined using Coomassie protein assay reagent from Pierce. A murine genomic library was screened using probes derived from a previously isolated mCTR cDNA clone (21Yamin M. Gorn A.H. Flannery M.R. Jenkins N.A. Gilbert D.J. Copeland N.G. Tapp D.R. Krane S.M. Goldring S.R. Endocrinology. 1994; 135: 2635-2643Crossref PubMed Scopus (60) Google Scholar). We obtained 13 positive phage clones (Fig.1 A) encompassing most of the transcription unit (>67 kb) with the exception of part of one very long intron (IVS3b′) that is greater than 13.9 kb. In addition, the genomic DNA corresponding to a gap between the sequences contained in phages 3 and 15 was isolated by using PCR between exons E6 and E7 employing mouse strain 129 genomic DNA as template (CD-PCRin Fig. 1 A). The identified phage clones include 15 kb of the putative 5′-flank and 8 kb of the 3′-flanking regions. Characterization of all the exon/intron junctions, determination of intron sizes, and mapping of sites for multiple restriction enzymes is shown in Fig. 1 A. Sequence analysis confirms the presence of appropriate donor-acceptor consensus sequences (GT-AG) (39Padgett R.A. Grabowski P.J. Konarska M.M. Seiler S. Sharp P.A. Annu. Rev. Biochem. 1986; 55: 1119-1150Crossref PubMed Google Scholar, 40Krainer A.R. Maniatis T. Hames B. Glover D. Transcription and Splicing. IRL Press, Oxford1988: 131-206Google Scholar) at the ends of each intron (Table II). A schematic of the relationship between the exon borders and the protein regions is depicted in Fig.1 B. Of interest, the location of the exon/intron junctions of the coding exons in the mCTR gene are exactly the same as in the porcine and human CTR genes (22Zolnierowicz S. Cron P. Solinas-Toldo S. Fries R. Lin H.Y. Hemmings B.A. J. Biol. Chem. 1994; 269: 19530-19538Abstract Full Text PDF PubMed Google Scholar, 23Albrandt K. Brady E.M.G. Moore C.X. Mull E. Sierzega M.E. Beaumont K. Endocrinol. 1995; 136: 5377-5384Crossref PubMed Google Scholar). This includes the two putative translation start sites (Fig. 1 A, labeled aa) that are split between two exons in the murine (E3a and E3b) and human (71-bp insert and E3) CTR genes. Use of the upstream translational start would add 17 amino acids to the mCTR protein (Fig. 1 B,shaded box at the N terminus of the protein). Exon E8b is a rodent-specific 111-bp coding exon that adds 37 amino acids to the extracellular domain 2 of mCTR and is alternatively spliced in mCTR mRNAs (18Sexton P.M. Houssami S. Hilton J.M. O'Keeffe L.M. Center R.J. Gillespie M.T. Darcy P. Findlay D.M. Mol. Endocrinol. 1993; 7: 815-821Crossref PubMed Google Scholar, 21Yamin M. Gorn A.H. Flannery M.R. Jenkins N.A. Gilbert D.J. Copeland N.G. Tapp D.R. Krane S.M. Goldring S.R. Endocrinology. 1994; 135: 2635-2643Crossref PubMed Scopus (60) Google Scholar, 41Albrandt K. Mull E. Brady E.M.G. Herich J. Moore C.X. Beaumont K. FEBS Lett. 1993; 325: 225-232Crossref PubMed Scopus (103) Google Scholar, 42Inoue D. Shih C. Galson D.L. Goldring S.R. Horne W.C. Baron R. Endocrinology. 1999; 140: 1060-1068Crossref PubMed Google Scholar). A number of sequence conflicts were found between our genomic sequence and our originally published mCTR cDNA (21Yamin M. Gorn A.H. Flannery M.R. Jenkins N.A. Gilbert D.J. Copeland N.G. Tapp D.R. Krane S.M. Goldring S.R. Endocrinology. 1994; 135: 2635-2643Crossref PubMed Scopus (60) Google Scholar) in exons E1, E2c, and E8b. The newly isolated cDNAs described below contain the same E1, E2c, and E8b sequences as the genomic sequence.Table IIExon/intron junction sequences of the mCTR geneTable IIExon/intron junction sequences of the mCTR gene● The numbering scheme for the exons was adopted from that of the pCTR.*IVS2a is equivalent to E2b. ● The numbering scheme for the exons was adopted from that of the pCTR. *IVS2a is equivalent to E2b. In order to determine the transcription start site of the mCTR gene, primer extension and 5′-RACE analyses were performed using RNA from mouse tissues known to express CTR and in which CT exhibits biological activities (murine brain, kidney, and osteoclasts). The primer extension analysis was first carried out with a 32P-end-labeled mCTR-specific antisense primer (mPE1; see Fig.2 A) with its 3′-end located 75 nt downstream from the reported 5′-end of mCTR (21Yamin M. Gorn A.H. Flannery M.R. Jenkins N.A. Gilbert D.J. Copeland
Referência(s)