An Induced Proximity Model for NF-κB Activation in the Nod1/RICK and RIP Signaling Pathways
2000; Elsevier BV; Volume: 275; Issue: 36 Linguagem: Inglês
10.1074/jbc.m003415200
ISSN1083-351X
AutoresNaohiro Inohara, Takeyoshi Koseki, Jingmei Lin, Luis del Peso, Peter C. Lucas, Felicia F. Chen, Yasunori Ogura, Gabriel Núñez,
Tópico(s)Cell death mechanisms and regulation
ResumoNod1 is an Apaf-1-like molecule composed of a caspase-recruitment domain (CARD), nucleotide-binding domain, and leucine-rich repeats that associates with the CARD-containing kinase RICK and activates nuclear factor κB (NF-κB). We show that self-association of Nod1 mediates proximity of RICK and the interaction of RICK with the γ subunit of the IκB kinase (IKKγ). Similarly, the RICK-related kinase RIP associated via its intermediate region with IKKγ. A mutant form of IKKγ deficient in binding to IKKα and IKKβ inhibited NF-κB activation induced by RICK or RIP. Enforced oligomerization of RICK or RIP as well as of IKKγ, IKKα, or IKKβ was sufficient for induction of NF-κB activation. Thus, the proximity of RICK, RIP, and IKK complexes may play an important role for NF-κB activation during Nod1 oligomerization or trimerization of the tumor necrosis factor α receptor. Nod1 is an Apaf-1-like molecule composed of a caspase-recruitment domain (CARD), nucleotide-binding domain, and leucine-rich repeats that associates with the CARD-containing kinase RICK and activates nuclear factor κB (NF-κB). We show that self-association of Nod1 mediates proximity of RICK and the interaction of RICK with the γ subunit of the IκB kinase (IKKγ). Similarly, the RICK-related kinase RIP associated via its intermediate region with IKKγ. A mutant form of IKKγ deficient in binding to IKKα and IKKβ inhibited NF-κB activation induced by RICK or RIP. Enforced oligomerization of RICK or RIP as well as of IKKγ, IKKα, or IKKβ was sufficient for induction of NF-κB activation. Thus, the proximity of RICK, RIP, and IKK complexes may play an important role for NF-κB activation during Nod1 oligomerization or trimerization of the tumor necrosis factor α receptor. nuclear factor κB caspase recruitment domain IκB, inhibitor of NF-κB IκB kinase κ chain B site leucine-rich repeat mouse embryonic fibroblasts nucleotide-binding domain tumor necrosis factor α TNFα receptor 1 TNFα receptor 2, WDR, WD40 repeats antibody death domain helix loop helix Nod1, also called CARD4, is an Apaf-1 like molecule which induces both apoptosis and nuclear factor κB (NF-κB)1 activation (1Bertin J. Nir W.J. Fischer C.M. Tayber O.V. Errada P.R. Grant J.R. Keilty J.J. Gosselin M.L. Robison K.E. Wong G.H. Glucksmann M.A. DiStefano P.S. J. Biol. Chem. 1999; 274: 12955-12958Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar, 2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). Both Apaf-1 and Nod1 contain N-terminal caspase-recruitment domains (CARDs) and nucleotide-binding domains (NBDs), but they differ in their C-terminal regulatory domains (1Bertin J. Nir W.J. Fischer C.M. Tayber O.V. Errada P.R. Grant J.R. Keilty J.J. Gosselin M.L. Robison K.E. Wong G.H. Glucksmann M.A. DiStefano P.S. J. Biol. Chem. 1999; 274: 12955-12958Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar, 2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). While Apaf-1 possesses WD40 repeats (WDR), Nod1 contains leucine-rich repeats (LRRs) in its C terminus (1Bertin J. Nir W.J. Fischer C.M. Tayber O.V. Errada P.R. Grant J.R. Keilty J.J. Gosselin M.L. Robison K.E. Wong G.H. Glucksmann M.A. DiStefano P.S. J. Biol. Chem. 1999; 274: 12955-12958Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar, 2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). The CARD of Nod1 is required for binding to two downstream CARD-containing factors, procaspase-9 and RICK (also called RIP2 and CARDIAK) (1Bertin J. Nir W.J. Fischer C.M. Tayber O.V. Errada P.R. Grant J.R. Keilty J.J. Gosselin M.L. Robison K.E. Wong G.H. Glucksmann M.A. DiStefano P.S. J. Biol. Chem. 1999; 274: 12955-12958Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar, 2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar, 3Inohara N. del Peso L. Koseki T. Chen S. Núñez G. J. Biol. Chem. 1998; 273: 12296-12300Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar, 4McCarthy J.V. Ni J. Dixit V.M. J. Biol. Chem. 1998; 273: 16968-16975Abstract Full Text Full Text PDF PubMed Scopus (349) Google Scholar, 5Thome M. Hofmann K. Burns K. Martinon F. Bodmer J.L. Mattmann C. Tschopp J. Curr. Biol. 1998; 8: 885-888Abstract Full Text Full Text PDF PubMed Google Scholar). Nod1 induces NF-κB activation in a synergistic manner with RICK (2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). Functional analyses with truncation mutants of both Nod1 and RICK have suggested that Nod1 and RICK act in the same pathway of NF-κB activation (1Bertin J. Nir W.J. Fischer C.M. Tayber O.V. Errada P.R. Grant J.R. Keilty J.J. Gosselin M.L. Robison K.E. Wong G.H. Glucksmann M.A. DiStefano P.S. J. Biol. Chem. 1999; 274: 12955-12958Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar, 2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). The NBD of Apaf-1 is required for enhancement of procaspase-9 activation (6Srinivasula S.M. Ahmad M. Fernandes-Alnemri T. Alnemri E.S. Mol. Cell. 1998; 1: 949-957Abstract Full Text Full Text PDF PubMed Scopus (952) Google Scholar, 7Hu Y. Ding L. Spencer D.M. Núñez G. J. Biol. Chem. 1998; 273: 33489-34494Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar), whereas that of Nod1 is necessary for both induction of NF-κB activity and enhancement of procaspase-9 activation (2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). The functional and structural similarities between Apaf-1 and Nod1 suggest that these proteins are members of a protein family that regulates downstream factors by a common molecular mechanism. WDR, the unique domain of Apaf-1, plays an essential role in allowing Apaf-1 to respond to cytochrome c released from mitochondria, a triggering signal for apoptosis (8Zou H. Henzel W.J. Liu X. Lutschg A. Wang X. Cell. 1997; 90: 405-413Abstract Full Text Full Text PDF PubMed Scopus (2678) Google Scholar, 9Li P. Nijhawan D. Budihardjo I. Srinivasula S. Ahmad M. Alnemri E.S. Wang X. Cell. 1997; 91: 479-489Abstract Full Text Full Text PDF PubMed Scopus (6053) Google Scholar), whereas the binding partner for the LRR of Nod1 still remains unknown. Proteins with LRR-containing domains linked with NBDs are also found in plants and are thought to be involved in a defensive response against specific pathogens such as bacteria and fungi (10Parniske M. Hammond-Kosack K.E. Golstein C. Thomas C.M. Jones D.A. Harrison K. Wulff B.B. Jones J.D. Cell. 1997; 91: 821-832Abstract Full Text Full Text PDF PubMed Scopus (460) Google Scholar). In animal cells, Toll-like receptor family members have extracellular LRRs and upon binding to microbial components activate a signaling pathway that includes NF-κB activation leading to a defensive reaction in the animal (11Kopp E.B. Medzhitov R. Curr. Opin. Immunol. 1999; 11: 13-18Crossref PubMed Scopus (581) Google Scholar). Tumor necrosis factor α (TNFα) also plays an important role in the inflammatory response against pathogenic stimuli and induces both apoptosis and NF-κB activation (12Tracey K.J. Cerami A. Annu. Rev. Cell Biol. 1993; 9: 317-343Crossref PubMed Scopus (753) Google Scholar). The mammalian cell has two TNF receptors, TNFR1 and TNFR2, but TNFR1 plays the major role in TNFα signaling (12Tracey K.J. Cerami A. Annu. Rev. Cell Biol. 1993; 9: 317-343Crossref PubMed Scopus (753) Google Scholar, 13Pfeffer K. Matsuyama T. Kundig T.M. Wakeham A. Kishihara K. Shahinian A. Wiegmann K. Ohashi P.S. Kronke M. Mak T.W. Cell. 1993; 73: 457-467Abstract Full Text PDF PubMed Scopus (1514) Google Scholar, 14Rothe J. Lesslauer W. Lotscher H. Lang Y. Koebel P. Kontgen F. Althage A. Zinkernagel R. Steinmetz M. Bluethmann H. Nature. 1993; 364: 798-802Crossref PubMed Scopus (1134) Google Scholar). Apoptosis induced by TNFα is dependent on caspase-8, whereas RIP, a RICK-like adaptor molecule, plays a central role in TNFα-dependent NF-κB activation (15Hsu H. Huang J. Shu H.B. Baichwal V. Goeddel D.V. Immunity. 1996; 4: 387-396Abstract Full Text Full Text PDF PubMed Scopus (940) Google Scholar, 16Kelliher M.A. Grimm S. Ishida Y. Kuo F. Stanger B.Z. Leder P. Immunity. 1998; 8: 297-303Abstract Full Text Full Text PDF PubMed Scopus (896) Google Scholar, 17Pimentel-Muinos F.X. Seed B. Immunity. 1999; 11: 783-793Abstract Full Text Full Text PDF PubMed Scopus (242) Google Scholar). Binding of trimeric TNFα to TNFR1 induces recruitment of procaspase-8 and RIP to the TNFR1 complex through FADD and TRADD, respectively (15Hsu H. Huang J. Shu H.B. Baichwal V. Goeddel D.V. Immunity. 1996; 4: 387-396Abstract Full Text Full Text PDF PubMed Scopus (940) Google Scholar,18Ashkenazi A. Dixit V.M. Science. 1998; 281: 1305-1308Crossref PubMed Scopus (5025) Google Scholar). Recent studies suggest that zymogen forms of apical caspases, such as caspase-8 and caspase-9, are activated by oligomerization of their upstream factors, the TNFR1 complex and Apaf-1, respectively (for review, Ref. 19Salvesen G.S. Dixit V.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 10964-10967Crossref PubMed Scopus (748) Google Scholar). Oligomerization of these caspase activators is thought to bring their interacting procaspase molecules in close proximity, allowing these immature proteases to self-activate through their intrinsic low enzymatic activity (19Salvesen G.S. Dixit V.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 10964-10967Crossref PubMed Scopus (748) Google Scholar). On the other hand, the mechanism of NF-κB activation induced by Nod1 and TNFR1 is still unclear although, in both cases, NF-κB activation is mediated by IκB kinases (IKKs) (for review, Ref. 20Karin M. J. Biol. Chem. 1999; 274: 27339-27342Abstract Full Text Full Text PDF PubMed Scopus (608) Google Scholar). IKK is a ≈700-kDa complex containing two catalytic subunits, IKKα and IKKβ (also called as IKK1 and IKK2, respectively), and the regulatory subunit IKKγ (also called as NEMO, FIP3, and IKKAP1) (20Karin M. J. Biol. Chem. 1999; 274: 27339-27342Abstract Full Text Full Text PDF PubMed Scopus (608) Google Scholar, 21Yamaoka S. Courtois G. Bessia C. Whiteside S.T. Weil R. Agou F. Kirk H.E. Kay R.J. Israel A. Cell. 1998; 93: 1231-1240Abstract Full Text Full Text PDF PubMed Scopus (936) Google Scholar, 22Rothwarf D.M. Zandi E. Natoli G. Karin M. Nature. 1998; 395: 297-300Crossref PubMed Scopus (827) Google Scholar, 23Mercurio F. Murray B.W. Shevchenko A. Bennett B.L. Young D.B. Li J.W. Pascual G. Motiwala A. Zhu H. Mann M. Manning A.M. Mol. Cell. Biol. 1999; 19: 1526-1538Crossref PubMed Google Scholar, 24Li Y. Kang J. Friedman J. Tarassishin L. Ye J. Kovalenko A. Wallach D. Horwitz M.S. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1042-1047Crossref PubMed Scopus (154) Google Scholar). TNFα induces recruitment of IKKs to the TNFR1 complex and activates IKK (25Zhang S.Q. Kovalenko A. Cantarella G. Wallach D. Immunity. 2000; 12: 301-311Abstract Full Text Full Text PDF PubMed Scopus (390) Google Scholar). IKKα and IKKβ phosphorylate IκB in a signal-dependent manner, an event leading to degradation of phosphorylated IκB, nuclear translocation of NF-κB, and transcriptional activation of κB site-containing target genes (20Karin M. J. Biol. Chem. 1999; 274: 27339-27342Abstract Full Text Full Text PDF PubMed Scopus (608) Google Scholar). The structural and functional similarity between Nod1 and Apaf-1 as well as that of RICK and RIP suggest that NF-κB activation induced by Nod1 and the TNFR1 complex may also be mediated by the proximity of RICK and RIP, respectively, through oligomerization of upstream regulators. In this study, we demonstrate that oligomerization of Nod1 induces the proximity of RICK, an event that is sufficient for induction of NF-κB. Like RICK, the enforced oligomerization of RIP also induced NF-κB activation. Both RICK and RIP interacted with IKKγ and subsequent enforced oligomerization of IKK proteins induced NF-κB activation. Thus, we propose a general "induced proximity" model for the induction of NF-κB activation mediated by RIP and RICK which is similar to the mechanism previously suggested for activation of apical caspases during apoptosis. pcDNA3-Myc, pcDNA3-HA, pcDNA3-Fpk3- Myc, pcDNA3-FLAG-RICK, pcDNA3-FLAG-RICK K47M, pcDNA3- FLAG-RIP, RSVMad-3MSS-(IκBα-S32A/S36A), pRK7-FLAG-IKKα, pRK7-FLAG-IKKβ-K44A, pcDNA3-p35, pcDNA3-TRAF2-FLAG, pcDNA3-Caspase-9(C287S)-HA, pEF-BOS-β-gal, and the expression plasmids of tagged wild type (WT) and mutant Nod1, RICK, and RIP proteins have been described (2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar, 7Hu Y. Ding L. Spencer D.M. Núñez G. J. Biol. Chem. 1998; 273: 33489-34494Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar, 26Koike T. Inohara N. Sato I. Tamada T. Kagawa Y. Ohta S. Biochem. Biophys. Res. Commun. 1994; 202: 225-233Crossref PubMed Scopus (6) Google Scholar). The entire open reading frames of IKKβ, IKKγ, RICK, Nod1(K208R), and IKKα including the N-terminal FLAG tag, the regions between residues 1–575 and 1–396 of FLAG-IKKα, 1–577 and 1–402 of IKKβ; 1–200, 1–300, 201–419, and 134–419 of IKKγ; 1–292 and 1–425 of RICK; 1–287, 1–580, and 288–580 of RIP were amplified by polymerase chain reaction from pRK7-FLAG-IKKα, pRK7-FLAG-IKKβ, human IKKγ (FIP3) cDNA (24Li Y. Kang J. Friedman J. Tarassishin L. Ye J. Kovalenko A. Wallach D. Horwitz M.S. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1042-1047Crossref PubMed Scopus (154) Google Scholar), pcDNA3-FLAG-RICK, pcDNA3- FLAG-RICK-K47M, pcDNA3-FLAG-RIP, and pKR7-Myc-RIP K44A, and cloned into pcDNA3-Myc, pcDNA3-Fpk3-Myc, or pcDNA3-HA to generate pcDNA3-Nod1(K208R)-Fpk3-Myc, pcDNA3-FLAG-IKKα-Myc, pcDNA3- FLAG-IKKα-Fpk3-Myc, pcDNA3-FLAG-IKKα-(1–575)-Fpk3-Myc, pcDNA3-FLAG-IKKα-(1–396)-Fpk3-Myc, pcDNA3-IKKβ-Myc, pcDNA3- IKKβ-(1–577)-Fpk3-Myc, pcDNA3-IKKβ-(1–402)-Fpk3-Myc, pcDNA3- HA-IKKγ, pcDNA3-Fpk3-Myc-IKKγ, pcDNA3-HA-IKKγ-(134–419), pcDNA3-HA-IKKγ-(1–300), pcDNA3-Fpk3-Myc-IKKγ-(1–200), pcDNA3- Fpk3-Myc-IKKγ-(201–419), pcDNA3-Myc-RICK, pcDNA3-RICK-(1–292)- Myc, pcDNA3-RICK-(1–292)-Fpk3-Myc, pcDNA3-RICK-(1–425)-Myc, pcDNA3-RICK-(1–425)-Fpk3-Myc, pcDNA3-RICK-(1–425)K47M-Myc, pcDNA3-RICK-(1–425)K47M-Fpk3-Myc, pcDNA3-RIP-(1–287)-Myc, pcDNA3-RIP-(1–287)-Fpk3-Myc, pcDNA3-RIP-(1–580)-Myc, pcDNA3-RIP- ()-Fpk3-Myc, pcDNA3-RIP-(288–580)-Myc, and pcDNA3-RIP- ()-Fpk3-Myc. The DNA fragments of Nod1, RICK, RIP, IKKα and IKKβ were cloned into KpnI andXhoI sites of the vectors to produce Myc-tagged proteins, with and without Fpk3 fusion in their C termini, whereas those of IKKγ were cloned into XbaI and EcoRI sites of the vectors to produce Myc-tagged proteins, with and without Fpk3 fusion, in the N terminus. The authenticity of all constructs was confirmed by sequencing. WT and RelA-deficient mouse embryonic fibroblasts (MEFs), a gift of Dr. Amer A. Beg, were transfected with expression plasmids using LipofectAMINE (Life Technologies, Inc.), and human embryonic kidney 293T cells were transfected as described (2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). The total amount of transfected plasmid DNA was adjusted with pcDNA3 to be always the same within individual experiments. 24 h post-transfection, proteins co-immunoprecipitated with anti-FLAG, anti-Myc, or anti-HA polyclonal antibody (Ab) (Santa Cruz) were detected with anti-HA 12CA5 (Roche Molecular Biochemicals), anti-FLAG M2 (Sigma), and/or anti-Myc 9E10 (Santa Cruz) monoclonal Ab as described (2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). For direct visualization of RIP/IKKγ/IKKα and RIP/IKKγ/IKKα interaction, proteins blotted on a nitrocellulose filter were stained with 0.008% (w/v) Ponceau S with Tris-buffered saline for 3 min. NF-κB activation assays were performed as described (2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar) except that pBVIx-luc, a luciferase reporter plasmid carrying 6 tandem κB sites, and pEF-BOS-β-gal were used. The dimerization drug AP1510 was a kind gift of Ariad Pharmaceuticals. Preparation of nuclear extracts and electromobility shift assays were performed as described previously (26Koike T. Inohara N. Sato I. Tamada T. Kagawa Y. Ohta S. Biochem. Biophys. Res. Commun. 1994; 202: 225-233Crossref PubMed Scopus (6) Google Scholar), using the radioactive double strand oligonucleotide containing a single κB site (CTAGAGTTGAGGGGACTTTCCCAGGC) as a probe (Santa Cruz). For competition experiments, the indicated amounts of double strand oligonucleotides containing WT and mutant κB sites CTAGAGTTGAGGAACTTTCCCAGGC were added to the binding reaction mixtures. The indicated amounts of anti-RelA Ab (Santa Cruz) were added to the binding reaction mixture to demonstrate a supershifted protein-DNA complex. Cell death assays were performed as described (27del Peso L. Gonzalez V.M. Núñez G. J. Biol. Chem. 1998; 273: 33495-33500Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). Previous studies have shown that NF-κB activation induced by Nod1 can be blocked by dominant negative forms of IKKα, IKKβ, and IκBα (1Bertin J. Nir W.J. Fischer C.M. Tayber O.V. Errada P.R. Grant J.R. Keilty J.J. Gosselin M.L. Robison K.E. Wong G.H. Glucksmann M.A. DiStefano P.S. J. Biol. Chem. 1999; 274: 12955-12958Abstract Full Text Full Text PDF PubMed Scopus (305) Google Scholar, 2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). However, there is no direct evidence that RelA (p65) mediates κB-dependent transcription induced by Nod1 and RICK. Therefore, we tested if expression of Nod1 in MEFs lacking RelA induces κB site-dependent transcription. Wild type (WT) and RelA-deficient MEFs were co-transfected with expression plasmids producing RICK, Nod1, or Apaf-1-(1–559) as a control, and κB-dependent or control reporter constructs in the presence of baculoviral p35, a general caspase inhibitor. Expression of RICK or Nod1 induced NF-κB activation in WT MEFs but not in RelA-deficient MEFs (Fig. 1 A). This indicates that κB-dependent transcription induced by RICK and Nod1 requires RelA. To test if RICK induces nuclear translocation of NF-κB, including RelA, we assessed the level of nuclear κB site binding activity by the electromobility shift assay. Expression of RICK in 293T cells induced accumulation of κB site binding activity (Fig. 2 B). The DNA-protein complex was abolished in the presence of cold oligonucleotide containing WT but not mutant κB site, suggesting that the DNA-binding protein(s) are NF-κB. Furthermore, the induced DNA-protein complex was shifted by incubation of nuclear extracts with anti-RelA antibody, indicating that the accumulated NF-κB contains RelA. Together these results indicate that NF-κB activation induced by RICK is mediated by RelA. Previous studies showed that NF-κB activation induced by Nod1 could not be blocked by a catalytically inactive mutant of caspase-9 that blocks apoptosis, suggesting that the ability of Nod1 to activate NF-κB is not caused by activation of caspase-9 (2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). To further assess the role of NF-κB activation in Nod1-mediated apoptosis, we tested whether Nod1 induces apoptosis in RelA-deficient MEFs. Expression of Nod1 and control FADD induced cell death in both WT- and RelA-deficient MEFs (Fig. 1 C). Expression of RICK in RelA-deficient MEFs caused no or little cell death, whereas NF-κB activation induced by RICK was dependent on RelA (Fig. 1 A). These results indicate that the proapoptotic activity of Nod1 is independent from NF-κB activation. Previous studies suggested that the NBD of Apaf-1 mediates its cytochrome c-dependent oligomerization leading to proximity of procaspase-9 molecules and caspase-9 self-activation, a process that is inhibited by the C-terminal WDR of Apaf-1 (6Srinivasula S.M. Ahmad M. Fernandes-Alnemri T. Alnemri E.S. Mol. Cell. 1998; 1: 949-957Abstract Full Text Full Text PDF PubMed Scopus (952) Google Scholar, 7Hu Y. Ding L. Spencer D.M. Núñez G. J. Biol. Chem. 1998; 273: 33489-34494Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar). Nod1 also self-associates and deletion of its C-terminal LRR region, a putative binding domain for an unknown trigger molecule, results in enhanced NF-κB activation (2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). These observations suggest that Apaf-1 and Nod1 may share a common mechanism for activation of downstream effectors. To begin to test this model, we determined whether the NBD of Nod1 mediates its self-association by an immunoprecipitation assay. FLAG-tagged Nod1 lacking the C-terminal LRRs, Nod1-(1–648), was co-expressed in human embryonic kidney 293T cells and co-immunoprecipitated with HA-tagged WT and mutant Nod1 proteins. FLAG-Nod1 was co-immunoprecipitated with WT and mutant Nod1 proteins containing the NBD but lacking the CARD and/or LRRs (Fig.2 B). Furthermore, Nod1 containing only the NBD (residues 126–648) associated with Nod1-(1–648), whereas a point mutation in the P-loop of the NBD, K208R, showed reduced ability to associate with Nod1 when compared with WT protein (Fig. 2 B), suggesting that the NBD mediates Nod1 oligomerization. Notably, Nod1-(1–648) exhibited greater ability to self-associate than WT Nod1, suggesting that the LRRs play a negative regulatory role in Nod1 self-association, as it was shown for the WDR of Apaf-1 (7Hu Y. Ding L. Spencer D.M. Núñez G. J. Biol. Chem. 1998; 273: 33489-34494Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar). This is consistent with the observation that Nod1-(1–648) exhibits greater ability to induce NF-κB than WTNod1 (2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar). To determine if Nod1 self-association induces the proximity of RICK molecules, we tested whether Nod1 enhances the interaction between RICK proteins. FLAG-tagged RICK proteins was co-expressed and co-immunoprecipitated with HA-tagged RICK in the absence and presence of Nod1-(1–648) or Apaf-1-(1–559) as a control. The association between HA-RICK and FLAG-RICK was enhanced by co-expression of Nod1-(1–648) but not by Apaf-1-(1–559) (Fig. 2 C). This suggests that Nod1 induces the proximity of RICK. To determine if Nod1 self-association is sufficient to induce NF-κB activation, we tested whether enforced oligomerization of Nod1 could induce NF-κB activation. A point mutant of Nod1, K208R, which has reduced ability to induce NF-κB activation and self-associate (Ref.2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar, Fig. 2 A), was fused to three tandem repeated dimerization domains of Fpk (Fpk3), which can be oligomerized by the cell-permeable artificial ligand AP1510 (28MacCorkle R.A. Freeman K.W. Spencer D.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3655-3660Crossref PubMed Scopus (171) Google Scholar). Expression of the resulting fusion protein, Nod1(K208R)-Fpk3-Myc, induced NF-κB activation in a ligand dependent manner, whereas control Nod1(K208R) did not (Fig.2 D). As expected, WT Nod1 induced NF-κB activation in the presence or absence of the oligomerizer (Fig. 2 D). These results cannot be explained by increased protein expression, as similar levels of Nod1 proteins were detected in the absence and presence of AP1510 (Fig. 2 D). These results suggest that self-association of Nod1 is necessary and sufficient to induce NF-κB activation. We next tested if the proximity of RICK molecules could activate NF-κB. Nod1 associates with RICK through a homophilic CARD interaction (2Inohara N. Koseki T. del Peso L. Hu Y. Yee C. Chen S. Carrio R. Merino Liu D. Ni J. Núñez G. J. Biol. Chem. 1999; 274: 14560-14568Abstract Full Text Full Text PDF PubMed Scopus (603) Google Scholar), suggesting that regions of RICK other than its CARD might mediate NF-κB activation. To test if oligomerization of RICK can induce NF-κB activation independently of its association with Nod1, we generated RICK mutant constructs to express its kinase domain and intermediate region but lacking its CARD (RICK-(1–425)), with or without Fpk3, and tested if the mutant RICK proteins could induce NF-κB activation. RICK-(1–425) and RICK-(1–425)-Fpk3-Myc, each lacking the CARD, failed to induce NF-κB activation (Fig.3 B). However, RICK-(1–425)-Fpk3-Myc induced NF-κB activation in the presence of AP1510 (Fig. 3 B), indicating that RICK oligomerization is sufficient for NF-κB activation independently of the Nod1 interaction. To further map the region of RICK that mediates NF-κB activation, we constructed RICK expression plasmids producing its kinase domain (residues 1–292) or the point mutation K47M, which eliminates its kinase activity (3Inohara N. del Peso L. Koseki T. Chen S. Núñez G. J. Biol. Chem. 1998; 273: 12296-12300Abstract Full Text Full Text PDF PubMed Scopus (212) Google Scholar), fused with Fpk3. In contrast to RICK-(1–425)-Fpk3-Myc, RICK-(1–292), and RICK-(1–292)-Fpk3-Myc failed to induce NF-κB activation in the presence of the oligomerizer (Fig. 3 B). These results suggest that the intermediate region of RICK (residues 293–425) is required for NF-κB activation. On the other hand, the kinase-deficient mutant RICK-(1–425)-Fpk3-Myc-K47M, induced a greatly reduced but significant level of NF-κB activation (Fig. 3 B), indicating that the kinase activity of RICK is important but not essential for NF-κB activation. TNFα is a trimer that induces TNFR1 trimerization and recruitment of RIP to the TNFR1 complex through a homophilic death domain (DD) interaction (18Ashkenazi A. Dixit V.M. Science. 1998; 281: 1305-1308Crossref PubMed Scopus (5025) Google Scholar). RIP, a RICK-like kinase, requires its intermediate region but not its kinase domain to induce NF-κB activation (Ref. 15Hsu H. Huang J. Shu H.B. Baichwal V. Goeddel D.V. Immunity. 1996; 4: 387-396Abstract Full Text Full Text PDF PubMed Scopus (940) Google Scholarand see below). Therefore, we tested whether oligomerization of RIP, like that of RICK, was sufficient for NF-κB activation. As shown in Fig. 3 C, a mutant form of RIP lacking the DD (RIP-(1–580)) induced NF-κB activation, but it was about 25-fold less active than WT RIP. Expression of the same RIP mutant fused to Fpk3 exhibited enhanced NF-κB activity in the presence of the oligomerizer (Fig.3 C). Significantly, a RIP mutant lacking the intermediate region and DD, RIP-(1–287), with and without Fpk3, did not induce NF-κB activation in the absence and presence of AP1510 (Fig.3 C). These findings, which are comparable to those shown for RICK, indicate that the enforced oligomerization of the intermediate region, but not the kinase domain is essential for NF-κB activation. To determine if the intermediate region of RIP is sufficient to induce NF-κB activation, expression plasmids of RIP containing the intermediate region alone (residues 288–580), with and without Fpk3 were constructed and their abilities to induce NF-κB activation were tested. The equivalent construct of RICK, residues 293–425, did not express detectable protein when expresssed in cells probably due to instability of the protein and could not be tested. 2I. Inohara and G. Núñez, unpublished results. Expression of RIP-(288–580)-Fpk3-Myc containing the intermediate region fused with Fpk3 induced NF-κB activation in an AP1510-dependent manner, whereas the intermediate region of RIP alone did not (Fig.3 D). Therefore, the intermediate region of RIP is necessary and sufficient to induce NF-κB activation in an oligomerization-dependent manner. Previous studies have shown that RIP binds to IKKγ, a regulatory subunit of the IKK complex which is essential for induction of NF-κB activation by TNFα and interleukin-1 (21Yamaoka S. Courtois G. Bessia C. Whiteside S.T. Weil R. Agou F. Kirk H.E. Kay R.J. Israel A. Cell. 1998; 93: 1231-1240Abstract Full Text Full Text PDF PubMed Scopus (936) Google Sch
Referência(s)