Distinct Properties of the Five UDP-d-glucose/UDP-d-galactose 4-Epimerase Isoforms of Arabidopsis thaliana
2006; Elsevier BV; Volume: 281; Issue: 25 Linguagem: Inglês
10.1074/jbc.m512727200
ISSN1083-351X
AutoresC. E. Barber, Johannes Rösti, Arun Rawat, Kim Findlay, Keith Roberts, Georg J. Seifert,
Tópico(s)Plant responses to water stress
ResumoPlant genomes contain genetically encoded isoforms of most nucleotide sugar interconversion enzymes. Here we show that Arabidopsis thaliana has five genes encoding functional UDP-d-glucose/UDP-d-galactose 4-epimerase (named UGE1 to UGE5). All A. thaliana UDP-d-glucose 4-epimerase isoforms are dimeric in solution, maximally active in vitro at 30-40 °C, and show good activity between pH 7 and pH 9. In vitro, UGE1, -3, and -5 act independently of externally added NAD+, whereas cofactor addition stimulates the activity of UGE2 and is particularly important for UGE4 activity. UGE1 and UGE3 are most efficiently inhibited by UDP. The five isoforms display kcatUDP-Gal values between 23 and 128 s- and KmUDP-Gal values between 0.1 and 0.3 mm. This results in enzymatic efficiencies ranging between 97 and 890 mm-1 s-1 for UGE4 = UGE1 < UGE3 < UGE5 < UGE2. The KmUDP-Glc values, derived from the Haldane relationship, were 0.76 mm for UGE1, 0.56 mm for UGE4, and between 0.13 and 0.23 mm for UGE2, -3, and -5. The expression of UGE isoforms is ubiquitous and displays developmental and cell type-dependent variations. UGE1 and -3 expression patterns globally resemble enzymes involved in carbohydrate catabolism, and UGE2, -4, and -5 expression is more related to carbohydrate biosynthesis. UGE1, -2, and -4 are present in the cytoplasm, whereasUGE4 is additionally enriched close to Golgi stacks. All UGE genes tested complement the UGE4rhd1 phenotype, confer increased galactose tolerance in planta, and complement the galactose metabolization deficiency in the Saccharomyces cerevisiae gal10 mutant. We suggest that plant UGE isoforms function in different metabolic situations and that enzymatic properties, gene expression pattern, and subcellular localization contribute to the differentiation of isoform function. Plant genomes contain genetically encoded isoforms of most nucleotide sugar interconversion enzymes. Here we show that Arabidopsis thaliana has five genes encoding functional UDP-d-glucose/UDP-d-galactose 4-epimerase (named UGE1 to UGE5). All A. thaliana UDP-d-glucose 4-epimerase isoforms are dimeric in solution, maximally active in vitro at 30-40 °C, and show good activity between pH 7 and pH 9. In vitro, UGE1, -3, and -5 act independently of externally added NAD+, whereas cofactor addition stimulates the activity of UGE2 and is particularly important for UGE4 activity. UGE1 and UGE3 are most efficiently inhibited by UDP. The five isoforms display kcatUDP-Gal values between 23 and 128 s- and KmUDP-Gal values between 0.1 and 0.3 mm. This results in enzymatic efficiencies ranging between 97 and 890 mm-1 s-1 for UGE4 = UGE1 < UGE3 < UGE5 < UGE2. The KmUDP-Glc values, derived from the Haldane relationship, were 0.76 mm for UGE1, 0.56 mm for UGE4, and between 0.13 and 0.23 mm for UGE2, -3, and -5. The expression of UGE isoforms is ubiquitous and displays developmental and cell type-dependent variations. UGE1 and -3 expression patterns globally resemble enzymes involved in carbohydrate catabolism, and UGE2, -4, and -5 expression is more related to carbohydrate biosynthesis. UGE1, -2, and -4 are present in the cytoplasm, whereasUGE4 is additionally enriched close to Golgi stacks. All UGE genes tested complement the UGE4rhd1 phenotype, confer increased galactose tolerance in planta, and complement the galactose metabolization deficiency in the Saccharomyces cerevisiae gal10 mutant. We suggest that plant UGE isoforms function in different metabolic situations and that enzymatic properties, gene expression pattern, and subcellular localization contribute to the differentiation of isoform function. The biosynthesis of plant carbohydrates requires specific glycosyl-transferases that act on activated sugars, typically uridine diphosphate, adenosine diphosphate, and guanosine diphosphate hexoses and pentoses. In addition to acting as biosynthetic substrates, nucleotide sugars are modified at their glycosyl moieties by nucleotide sugar interconversion enzymes to generate different sugars and are intermediates in the uptake of the free sugars released from the breakdown of nutritional or storage carbohydrates and other sources. The biochemistry and reaction mechanism of many nucleotide sugar interconversion pathways have been reviewed previously (1Feingold D.S. Encyclopedia of Plant Physiology. 1982; (Springer-Verlag, Berlin): 3-76Google Scholar). cDNAs coding for nucleotide sugar interconverting enzymes have been cloned and recombinant proteins purified, leading the way to x-ray crystallography (2Mulichak A.M. Bonin C.P. Reiter W.D. Garavito R.M. Biochemistry. 2002; 41: 15578-15589Crossref PubMed Scopus (45) Google Scholar, 3Holden H.M. Rayment I. Thoden J.B. J. Biol. Chem. 2003; 278: 43885-43888Abstract Full Text Full Text PDF PubMed Scopus (362) Google Scholar, 4Shaw M.P. Bond C.S. Roper J.R. Gourley D.G. Ferguson M.A. Hunter W.N. Mol. Biochem. Parasitol. 2003; 126: 173-180Crossref PubMed Scopus (48) Google Scholar, 5Ishiyama N. Creuzenet C. Lam J.S. Berghuis A.M. J. Biol. Chem. 2004; 279: 22635-22642Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). The complete sequencing of entire genomes revealed a surprising over-representation of genes encoding putative isoforms of nucleotide sugar interconversion enzymes in plant genomes (6Reiter W.D. Vanzin G.F. Plant Mol. Biol. 2001; 47: 95-113Crossref PubMed Scopus (190) Google Scholar, 7Seifert G.J. Curr. Opin. Plant Biol. 2004; 7: 277-284Crossref PubMed Scopus (265) Google Scholar), but the functional significance of this apparent genetic redundancy remains to be established. One of the best characterized nucleotide sugar interconversion enzymes is UDP-glucose 4-epimerase (EC 5.1.3.2; UGE), 4The abbreviations used are: UGE, UDP-d-glucose/UDP-d-galactose 4-epimerase; BSA, bovine serum albumin; CSB.DB, comprehensive systems biology database; ECFP, enhanced cyan fluorescent protein; GAE, UDP-d-glucuronic acid 4-epimerase; PBS, phosphate buffered saline solution; SD, synthetic defined; MES, 4-morpholinoethanesulfonic acid. 4The abbreviations used are: UGE, UDP-d-glucose/UDP-d-galactose 4-epimerase; BSA, bovine serum albumin; CSB.DB, comprehensive systems biology database; ECFP, enhanced cyan fluorescent protein; GAE, UDP-d-glucuronic acid 4-epimerase; PBS, phosphate buffered saline solution; SD, synthetic defined; MES, 4-morpholinoethanesulfonic acid. which interconverts UDP-d-glucose (UDP-Glc) and UDP-d-galactose (UDP-Gal). The reaction mechanism of UGE is thought to occur via transfer of the 4′-OH hydrogen of the sugar to the nicotinamide ring of noncovalently bound NAD+, rotation of the resulting 4′-ketopyranose intermediate in the active site, and transfer of the hydride from the nicotinamide ring of NADH back to C-4 of the sugar (3Holden H.M. Rayment I. Thoden J.B. J. Biol. Chem. 2003; 278: 43885-43888Abstract Full Text Full Text PDF PubMed Scopus (362) Google Scholar). UGE is essential for de novo biosynthesis of UDP-Gal, a precursor for the biosynthesis of numerous different carbohydrates, glycolipids, and glycosides. On the other hand, UGE is also required for the catabolic uptake of galactose into the central metabolism, and therefore UGE deficiency exacerbates galactose toxicity in plants (8Dörmann P. Benning C. Plant J. 1998; 13: 641-652Crossref PubMed Scopus (59) Google Scholar) and in yeast (9Ross K.L. Davis C.N. Fridovich-Keil J.L. Mol. Genet. Metab. 2004; 83: 103-116Crossref PubMed Scopus (66) Google Scholar) and also leads to different forms of human galactosemia (10Thoden J.B. Wohlers T.M. Fridovich-Keil J.L. Holden H.M. J. Biol. Chem. 2001; 276: 20617-20623Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar, 11Novelli G. Reichardt J.K. Mol. Genet. Metab. 2000; 71: 62-65Crossref PubMed Scopus (80) Google Scholar). The completely sequenced genome of the model plant Arabidopsis thaliana contains five genes predicted to encode UGE (6Reiter W.D. Vanzin G.F. Plant Mol. Biol. 2001; 47: 95-113Crossref PubMed Scopus (190) Google Scholar, 7Seifert G.J. Curr. Opin. Plant Biol. 2004; 7: 277-284Crossref PubMed Scopus (265) Google Scholar); the fully sequenced rice genome contains four putative UGE-encoding genes, and cDNA clones putatively encoding three UGE isoforms were recently isolated from barley (12Zhang Q. Hrmova M. Shirley N.J. Lahnstein J. Fincher G.B. Biochem. J. 2006; 394: 115-124Crossref PubMed Scopus (39) Google Scholar). Two studies previously addressed the genetic role of individual UGE isoforms in A. thaliana. UGE1 was transgenically overexpressed and suppressed (8Dörmann P. Benning C. Plant J. 1998; 13: 641-652Crossref PubMed Scopus (59) Google Scholar). Despite an increase by up to 250% and a decrease to 10% compared with the wild type UGE activity, no alteration in carbohydrate composition was observed. However, tolerance to galactose was correlated to UGE1 expression in various transgenic lines. Loss of function mutations in UGE4 were found to induce dramatic morphological alterations in roots and correlated with a reduction of cell wall bound galactose without affecting the level of galactolipids (13Seifert G.J. Barber C. Wells B. Dolan L. Roberts K. Curr. Biol. 2002; 12: 1840-1845Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). Because all UGE isoforms are expressed in roots, the specific effect of UGE4 loss of function was surprising and prompted the speculation that individual isoforms might be physically associated with specific galactosyltransferases facilitating substrate channeling, a speculation that was also presented in the context of the noncatalytic loops in the structure of Trypanosoma brucei UGE (4Shaw M.P. Bond C.S. Roper J.R. Gourley D.G. Ferguson M.A. Hunter W.N. Mol. Biochem. Parasitol. 2003; 126: 173-180Crossref PubMed Scopus (48) Google Scholar). In potato tubers, overexpression of two different UGE isoforms increased cell wall galactose content. This indicates that UGE activity is rate-limiting for the biosynthesis of some cell wall polymers (14Oomen R.J.F.J. Bang D.-T. Tzitzikas E.N. Bakx E.J. Schols H.S. Visser R.G.F. Vincken J.-P. Plant Sci. 2004; 166: 1097-1104Crossref Scopus (25) Google Scholar). Interestingly, overexpression of one potato UGE isoform increased galactose tolerance, whereas overexpression of the other isoform did not. These observations suggest that UGE isoforms might perform specific roles in planta. Besides metabolic channeling, further explanations for the observed discrepancy between bulk UGE activity and UDP-Gal flux might be found in the differential sensitivities to control mechanisms such as redox control, feedback inhibition, or allosteric regulation (reviewed in Ref. 7Seifert G.J. Curr. Opin. Plant Biol. 2004; 7: 277-284Crossref PubMed Scopus (265) Google Scholar). Moreover, the possibility has been discussed of “one-way enzymes,” where the Km value for one substrate differs substantially from the Km value for the other substrate, despite an equilibrium constant (Keq) close to unity (15Cornish-Bowden A. Fundamentals of Enzyme Kinetics, 3rd Ed. 2004; (Portland Press Ltd., London): 23-70Google Scholar). To investigate qualitative and quantitative biochemical differences between plant UGE isoforms, we systematically compared the enzymatic properties of all five UGE isoforms of A. thaliana. Systems properties of UGE isoforms were investigated in public expression data bases and by subcellular localization studies. Our data suggest that all UGE paralogs are catalytically active in both directions but appear to have adapted to different metabolic roles in vivo. Cloning and Recombinant Expression of UGEs in Escherichia coli— UGE4 bacterial expression was described previously (13Seifert G.J. Barber C. Wells B. Dolan L. Roberts K. Curr. Biol. 2002; 12: 1840-1845Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). Using A. thaliana wild type (Col-0) seedling total cDNA as template, the coding sequences of UGE1-3 and -5 were amplified using the following oligonucleotides (from 5′ to 3′): U1/Nde-F, CATATGGGTTCTTCTGTGGAGCAG; U1/Bgl-R, AGATCTCAAAGCTTATTCTGGTAACC; U2/Vsp-F, ATTAATATGGCGAAGAGTGTTTTGG; U2/Bgl-R, AGATCTTATGAAGAGGAGCCATTGGAGG; U3/Nde-F, CATATGGGTTCTTCTGTGGAACAG; U3/Bgl-R, AGATCTCAAGGCTTCTTCTGGAAACC; U5/Vsp-F, ATTAATATGGCTAGAAACGTTCTAGTAAG; and U5/Bgl-R, AGATCTTAATGAGAGTTGTCTTCAGAA, respectively. PCR products were cloned into pGEM-T (Promega), and individual clones were sequenced. Correct open reading frames of UGE1 and UGE3 were released using NdeI and BglII; UGE2 and UGE5 were released using VspI and BglII and ligated into NdeI- and BglII-digested, gel-purified pET15b (Novagen). Because UGE2 and UGE5 cDNA sequences contain internal NdeI sites, VspI was used for cloning into pET15. This procedure introduces 1 asparagine residue between the UGE peptide and the 20-amino acid-long amino-terminal hexahistidine peptide. Recombinant UGE proteins were expressed and affinity-purified as described previously for UGE4 (13Seifert G.J. Barber C. Wells B. Dolan L. Roberts K. Curr. Biol. 2002; 12: 1840-1845Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar). UGE preparations containing 50% glycerol were frozen on dry ice and kept at -80 °C. After purification, staining with Sypro Ruby Protein Gel Stain (Molecular Probes, Invitrogen) revealed a certain degree of unspecific proteins bound to the Hisbind (Novagen) affinity matrix. The content of recombinant UGE1-5 was 50, 70, 60, 82, and 71%, respectively. To keep the manipulation of the proteins as low as possible, no further purification step was attempted. Specific enzyme concentration was determined by co-electrophoresis of 5-35 ng of protein assay standard II lyophilized bovine serum albumin (BSA, Bio-Rad catalog number 500-0007), scanning the gel on a PROXPRESS proteomic imaging system (PerkinElmer Life Sciences) using 480/30 nm excitation and 630/30 nm emission filters, and quantification of specific bands by Labworks software (UVP, Inc.). Cloning and Recombinant Expression of UGEs in Yeast—The cDNA inserts were cleaved from the pGEM-T plasmids using NdeI (UGE1, -3, and -4) or AseI/VspI (UGE2 and -5) and BglII and then gel-purified. The fragments were cloned into the NdeI and BamHI restriction sites of the cleaved and de-phosphorylated yeast two-hybrid plasmids pGBKT7 and pGADT7 (Clontech). For functional complementation of the UGE-deficient yeast mutant, the bait plasmids pGBKT7 and pGBKT7-UGE1 to-5 were transformed into the gal10 strain by small scale transformation, and transformants were selected on SD/-Trp-selective medium. For the complementation assay, transformed mutant cells were grown at 30 °C on SD/-Trp-selective medium and galactose solid medium (1% yeast extract (Duchefa), 2% Bacto-peptone (BD Biosciences), 0.8% galactose (Sigma), 2% Micro agar (Duchefa); w/v). All UGE isoforms were tested for interaction both with themselves and with each other by yeast two-hybrid assays. Each UGE bait (GBKT7-UGE1-5) was co-transformed with UGE prey (pGADT7-UGE1-5) into the AH109 reporter strain (Clontech), and double transformants were selected on SD/-Leu/-Trp medium. For yeast two-hybrid interaction assays, double transformants were grown on SD/-His/-Trp/-Leu for selection of activation of the HIS reporter gene and on SD/-Ade/-His/-Trp/-Leu for selection of activation of the HIS and the ADE reporter genes. UDP-Gal 4-Epimerase Assay—UGE was assayed as described previously (8Dörmann P. Benning C. Plant J. 1998; 13: 641-652Crossref PubMed Scopus (59) Google Scholar). The standard epimerase reaction was performed in 50 mm Tris/HCl, pH 7.4, containing 0.1 mm NAD+ and 125 μg·ml-1 acetylated BSA (Sigma catalog number B 2518) at 25 °C, unless stated otherwise. To start kinetic measurements, 175 μl of UDP-Gal (Calbiochem catalog number 670111) solution was added to 25 μl of pre-warmed enzyme solution, and the reaction was stopped after 10 min by adding 25 μl of 1.2 m HCl. After 5 min at 100 °C and cooling, 25 μl of 1.2 m NaOH was added. Glucose was quantified in a coupled reaction by adding 100 μlof a solution containing 5 μg·ml-1 horseradish peroxidase (Sigma catalog number P 8250, 179 units·mg-1), 100 μg·ml-1 glucose oxidase (Sigma catalog number 49180, 198 units·mg-1), and 300 μg·ml-1 o-dianisidine dihydrochloride (Sigma catalog number D-3252) in 100 mm sodium phosphate buffer, pH 7.0, for 30 min at room temperature, against a glucose standard series in a buffer identical to the epimerase buffer. The reactions were stopped by adding 300 μlof6 m HCl, and the absorbance was detected at 540 nm. The linearity of the epimerase reaction was tested between 5 and 30 min and by varying enzyme concentrations. Maximal reaction rate and Km values were determined by varying UDP-Gal concentration between 0.05 and 2.5 mm using best fit to single site saturation kinetics in the pharmacology menu of Sigmaplot 8.0 software. To determine Keq, UDP-Glc was converted by re-adding fresh enzyme until there was no further change in the UDP-Glc:UDP-Gal ratio. UDP-Glc 4-Epimerase Assay—The velocity of conversion of UDP-Glc to UDP-Gal was determined at 5 mm UDP-Glc (Sigma catalog number U 4625) in a 50-μl volume of 50 mm Tris/HCl, pH 7.4, containing 0.1 mm NAD+and 125 μg·ml-1 acetylated BSA (Sigma catalog number B 2518) at 25 °C. The epimerase reaction was stopped after 10 min with 25 μl of 0.3 m HCl, hydrolyzed at 100 °C for 5 min, and neutralized using a mole equivalent of NaOH. Galactose was quantified in a coupled reaction by adding 50 μl of a solution containing 0.2 units·ml-1 horseradish peroxidase, 4 units·ml-1 galactose oxidase, and 0.1 mm Amplex Red (all from Molecular Probes, catalog number A22179), in a 150 mm Tris/HCl, pH 7.2, 3 mm CaCl2 buffer against a galactose standard in a buffer identical to the epimerase buffer. Because detection of fluorescence produced unsatisfactorily high variability, the absorbance of the oxidized Amplex Red was detected at 560 nm in 96-well microtiter plates (Costar 9017) using a Spectramax 340pc plate reader. The absorbance differential between 200 and 300 s of reaction time typically gave the best linearity of the reaction. Amplex Red was handled to ensure minimal light exposure. To ensure linearity of the epimerase reaction, a range of enzyme concentrations was tested. To ensure substrate saturation, 5-9 mm UDP-Glc was used. The direct determination of Km UDP-Glc at low substrate concentrations did not yield reproducible data because of low signal to noise ratio. Therefore, the KmUDP-Glc value was derived from the Haldane relationship shown in Equation 1 (15Cornish-Bowden A. Fundamentals of Enzyme Kinetics, 3rd Ed. 2004; (Portland Press Ltd., London): 23-70Google Scholar), Keq=[UDP-Gal]∞[UDP-Glc]∞=kcatIDP-GlcKmUDP-GalKmUDP-GlckcatUDP-Gal(Eq. 1) using Keq of 0.33 and the kinetic constants corresponding to the highest rate of UDP-Gal conversion. Overexpression of UGEs in A. thaliana—UGE2, -3, and -4 were amplified using the following oligonucleotides: UGE2/STA/Xba, TCTAGATGGCGAAGAGTGTTTTGG; UGE2/STO/Eco, GAATTCTTATGAAGAGGAGCCATTG; UGE3/STA/Xba, TCTAGATGGGTTCTTCTGTGGAAC; UGE3/STO/Bam, GGATCCTCAAGGCTTCTTCTGGAAAC; R1/STA/Xba, TCTAGATGGTTGGGAATATTCTGGTGACCGGTGGT; and R1/STO/EcoRI, GAATTCTTATGTTGAGTTTGGTGAAGAACCGT. Plasmid preparations of bacterial artificial chromosome (BAC) genomic clones were used as PCR templates (UGE2, T32A16; UGE3, F16M19; and UGE4, F15H21). The bacterial galE gene (GenBank™ accession number X06226; base 1-1071) was amplified using the following oligonucleotides: GALE/STA/Xba, TCTAGATGAGAGTTCTGGTTACCGGTGGT; GALE/STO/Eco, GAATTCTTAATCGGGATATCCCTGTGGATG; and an E. coli DH5α colony as the template. PCR products were cloned into pGEM-T (Promega) and sequenced. After release of the inserts by restriction digest, the fragments were cloned into pGREENII containing a cauliflower mosaic virus 35S promoter terminator cassette and Basta resistance (16Hellens R.P. Edwards E.A. Leyland N.R. Bean S. Mullineaux P.M. Plant Mol. Biol. 2000; 42: 819-832Crossref PubMed Scopus (1224) Google Scholar). A. thaliana UGE4rhd1-1 mutant plants were transformed using vacuum infiltration with Agrobacterium strain GV3101 containing overexpression constructs (17Clough S.J. Bent A.F. Plant J. 1998; 16: 735-743Crossref PubMed Google Scholar). The transgenic line ES7-2overexpressing UGE1 cDNA (8Dörmann P. Benning C. Plant J. 1998; 13: 641-652Crossref PubMed Scopus (59) Google Scholar) was kindly provided by P. Dörmann. Translational UGE Fluorescent Protein Fusions—To generate carboxyl-terminal translational fusions between UGE genes and enhanced fluorescent protein (ECFP), the genomic sequences of UGE1, UGE2, and UGE4, including 5′-upstream regions of 1.5, 1.7, and 1.5 kb, respectively, were amplified from BAC DNA using the following primers: SphU1-5′-F, TTACGAGCATGCCGCGGCGACTGCAGAAATAGTTGTAAGATACTAAG; XmaU1-3′-R, TGATACCCGGGGTGAAAGCTTATTCTGGTAACCCCATGGATTATT; SphU2-F, TTACGAGCATGCTCTAGATGGCCTCAGTTAATTCAGGCGAAAG; XmaU2-R, TGATACCCGGGGTGATGAAGAGGAGCCATTGGAGGAGGAATTGTA; SphR1-F, TTACGAGCATGCCGCGGACAAAACTTCGTTGTATCTATTTAGG; and XmaR1-R, TGATACCCGGGGTGATGTTGAGTTTGGTGAAGAACCGTAAC. The products were cloned into pGEM-T (Promega) and sequenced. Using the SphI and XmaI restriction sites, correct inserts were cloned into pECFP (Clontech). Terminator regions were amplified and sequenced after pGEM-T subcloning using the following oligonucleotides: NotU1-3′-F, TGCGGCCGCATTTACTTCTTTTGTTTGGAGTTACC; ApaU1-3′-R, TGGGCCCATAAATGGATATTGTAAGGCTAATC; NotU2-3′-F, TGCGGCCGCTTCTCCTTTTTTAATTTTTATTTTGCC; ApaU2-3′-R, TGGGCCCTTCGGTGATTTGTTATTGTGGAC; NotIR1-3′-F, ACTATGTAAGTGCGGCCGCTAACGAAGCTAATGTATCCAACACTCC; and ApaIR1-3′-R, ATAGAATTGTTGGGCCCGCAAAATATTTTTTCGGCAAAACCGT. The terminator regions were added after the ECFP stop codon using NotI and ApaI digestion of the corresponding UGE:CFP recombinant clones. The resulting fusion constructs were cloned into pGREEN0229 (16Hellens R.P. Edwards E.A. Leyland N.R. Bean S. Mullineaux P.M. Plant Mol. Biol. 2000; 42: 819-832Crossref PubMed Scopus (1224) Google Scholar) and transformed into uge4 mutant and wild type plants as described above. To generate an amino-terminal GFP fusion of UGE4, the DNA of enhanced green fluorescent protein (Clontech) was generated using the following oligonucleotide primers: CY-GFP-F, ATGGTGAGCAAGGGCGAGGAGCTGTTCACC; CY-GFP-AscI, CCGCGGCGCGCCCTTGTACAGCTCGTCCATGCC. The UGE4 promoter was amplified using the following oligonucleotide primers: R1/5′XHO-F, AAACTCGAGTCACACACTTGTCAACAAACCCGGTTAG; R1/5′CY-GFP-R, CTCGCCCTTGCTCACCATCGAAGCTCGAAGAGGCGATGAAGAAAGAGAG. The enhanced green fluorescent protein sequence and the UGE4 promoter sequence were fused by mixing the purified PCR products and amplification using the oligonucleotides R1/5′XHO-F and CY-GFP-AscI. The resulting product was cloned into pGEM-T and sequenced. The UGE4 gene including the terminator region was amplified using the following oligonucleotide primers: R1/STA/AscI, AAGGGCGCGCCGATGGTTGGGAATATTCTGGTGACCGGTGGT; Not-R1/3′, AAAAGGAAAAGCGGCCGCATTTTTATATAAATGAAATGAGAATGTGGATG, and were cloned into pGEM-T and sequenced. The UGE4 sequence was excised using AscI and NotI and cloned into the RHD1 promoter:GFP fusion containing clone. The resulting fusion was cloned into pGREEN0229 (16Hellens R.P. Edwards E.A. Leyland N.R. Bean S. Mullineaux P.M. Plant Mol. Biol. 2000; 42: 819-832Crossref PubMed Scopus (1224) Google Scholar) and transformed into uge4 mutants as described above. UGE4-specific Antibodies—UGE4-specific antiserum was raised commercially (BioGenes, Berlin) by immunization of rabbits with a peptide corresponding to the 16 carboxyl-terminal amino acid residues of UGE4 conjugated to keyhole limpet hemocyanin. Specific antibodies were subsequently affinity-purified using immobilized peptide. The rhd1-4 mutant, that contains a premature stop codon before the carboxyl-terminal half of UGE4 (13Seifert G.J. Barber C. Wells B. Dolan L. Roberts K. Curr. Biol. 2002; 12: 1840-1845Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar), served as control in various assays. In microscopic applications, the antiserum 3605g produced an unspecific signal in cell walls but bound specifically to intracellular UGE4. Immunogold Transmission Electron Microscopy—Roots of 4-day-old seedlings were excised and were vacuum-infiltrated for 5 min with MES (20 mm). The samples were high pressure frozen, freeze-substituted in acetone containing 0.5% uranyl acetate, and embedded in LR white resin as described previously (18Jolliffe N.A. Brown J.C. Neumann U. Vicre M. Bachi A. Hawes C. Ceriotti A. Roberts L.M. Frigerio L. Plant J. 2004; 39: 821-833Crossref PubMed Scopus (55) Google Scholar). Ultrathin sections of ∼90 nm were taken using a Leica UC6 ultramicrotome (Leica, Milton Keynes, UK) and picked up on pyroxylin- and carbon-coated gold grids. For immunogold labeling, grids were incubated on drops of 50 mm glycine/PBS for 15 min followed by drops of pre-prepared Aurion blocking buffer (5% BSA, 0.1% cold water fish skin gelatin, 5-10% normal goat serum, 15 mm NaN3/PBS, pH 7.4) (Aurion, Netherlands) for 30 min and then equilibrated in 0.1% BSA-C/PBS (Aurion, Netherlands). Grids were incubated with the primary antibody diluted in equilibration buffer overnight at 4 °C, washed five times in equilibration buffer, and incubated for 3 h with the secondary antibody conjugated to 10 nm gold (BioCell, Agar Scientific Ltd., Essex, UK) diluted 1:50 in equilibration buffer. After four washes in equilibration buffer, 20-min washes three times in PBS and 30-min washes two times in water, the grids were contrast-stained with uranyl acetate and lead citrate before observation in a Jeol 1200 EX transmission electron microscope at 80 kV. Photographic images were taken using Kodak electron image film. Meta-analysis of Publicly Available Expression Data—Data on organ-specific expression were obtained from the GENEVESTIGATOR data base (19Zimmermann P. Hirsch-Hoffmann M. Hennig L. Gruissem W. Plant Physiol. 2004; 136: 2621-2632Crossref PubMed Scopus (2051) Google Scholar) using the Gene Atlas tool. Expression signals for each UGE gene were normalized. Cell type-specific gene expression data in root tips were published previously (20Birnbaum K. Shasha D.E. Wang J.Y. Jung J.W. Lambert G.M. Galbraith D.W. Benfey P.N. Science. 2003; 302: 1956-1960Crossref PubMed Scopus (983) Google Scholar), and spatial representations were queried online. The degree of co-expression between individual genes was queried in the comprehensive systems biology data base (CSB.DB) (21Steinhauser D. Usadel B. Luedemann A. Thimm O. Kopka J. Bioinformatics (Oxf.). 2004; 20: 3647-3651Crossref PubMed Scopus (140) Google Scholar) or by an alternative approach using pre-processing of raw data and discretization of signal changes between time points (22Rawat A. Analysis of Time Series Microarray Data. 2005; (M.Sc. thesis, School of Computing Sciences, University of East Anglia, Norwich)Google Scholar). This method preserves the entire set of genes queried, and its results match well with other algorithms. Experimental details and the full result of this analysis are available online in the Arabidopsis Systems Interaction data base. Gel Filtration (Size Exclusion) Chromatography—Freshly purified UGE protein (0.1-1.0 mg) was buffer exchanged into gel filtration buffer (20 mm Tris/HCl, pH 7.4, 150 mm NaCl) using an Amicon Ultra-4 centrifugal filter unit with a 10-kDa nominal molecular weight limit (Millipore). The protein solution was separated on a Superdex 200 HR 10/30 gel filtration column (Amersham Biosciences) with a 0.5 ml·min-1 flow rate. At the column outlet the absorption at 280 nm was measured online to detect eluting proteins. The molecular weights corresponding to the protein peaks in the eluate were calculated from the elution volume using a standard curve generated with the following proteins of known molecular weight: β-amylase, 200 kDa; alcohol dehydrogenase, 150 kDa; carbonic anhydrase, 29 kDa; and cytochrome c, 12.4 kDa. Dynamic Light Scattering—The hydrodynamic radius of freshly purified His-tagged UGE protein (80-800 μg/ml) filtered through a 0.1-μm Ultrafree-MC centrifugal filter unit (Millipore) was measured with a DynaPro99 Dynamic Light Scattering instrument (Protein Solutions) at 20 °C. Results were analyzed using the instrument control software Dynamics (Protein Solutions). The molecular weight was calculated from the hydrodynamic radius using the default volume shape hydration model. UGE Isoforms Are Dimeric and Can Interact Homo- and Hetero-typically—All five A. thaliana UGE genes are predicted to code for polypeptides of ∼40 kDa (Table 1). Dynamic light scattering of all five UGEs indicates molecular masses between 64 and 103 kDa suggesting dimeric quaternary structure (Table 1). In agreement with that interpretation, all UGEs elute as single peaks corresponding to 73-93-kDa proteins in gel filtration experiments (Table 1). Yeast two-hybrid assays detect self-interaction of UGE proteins and reveal interaction between different UGE isoforms (Fig. 1). In this system the affinities of both homotypic and heterotypic interactions are relatively weak, leading to activation of the HIS but not of the ADE reporter genes.TABLE 1Summary of molecular properties of A. thaliana UGE isoformsCalculated massMass, dynamic light scattering (hydrodynamic radius, nm)Mass, gel chromatography (elution volume, ml)kDakDakDaUGE141.1103 (3.89)83 (13.8)UGE240.391 (3.74)77 (13.9)UGE340.898 (3.83)73 (14.0)UGE440.084 (3.64)89 (13.7)UGE540.291 (3.74)93 (13.6) Open table in a new tab Differential Effect of Temperature, pH, and NaCl—Recombinant purified enzymes corresponding to each of the five isoforms interconvert UDP-Glc and UDP-Gal with a Keq of 0.33. As expected, Keq is identical for all isoforms. The UGE isoforms exhibit di
Referência(s)