Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Two Discrete Promoters Regulate the Alternatively Spliced Human Interferon Regulatory Factor-5 Isoforms

2005; Elsevier BV; Volume: 280; Issue: 22 Linguagem: Inglês

10.1074/jbc.m500543200

ISSN

1083-351X

Autores

Margo E. Mancl, Guodong Hu, Niquiche Sangster‐Guity, Stacey L. Olshalsky, Katherine Hoops, Patricia Fitzgerald‐Bocarsly, Paula M. Pitha, Karen Pinder, Betsy Barnes,

Tópico(s)

Herpesvirus Infections and Treatments

Resumo

Interferon regulatory factor-5 (IRF-5) is a mediator of virus-induced immune activation and type I interferon (Ifn) gene regulation. In human primary plasmacytoid dendritic cells (PDC), IRF-5 is transcribed into four distinct alternatively spliced isoforms (V1, V2, V3, and V4), whereas in human primary peripheral blood mononuclear cells two additional new isoforms (V5 and V6) were identified. The IRF-5 V1, V2, and V3 transcripts have different noncoding first exons and distinct insertion/deletion patterns in exon 6. Here we showed that V1 and V3 have distinct transcription start sites and are regulated by two discrete promoters. The V1 promoter (P-V1) is constitutively active, contains an IRF-E consensusbinding site, and is further stimulated in virus-infected cells by IRF family members. In contrast, endogenous V3 transcripts were up-regulated by type I Ifns, and the V3 promoter (P-V3) contains an Ifn-stimulated responsive element-binding site that confers responsiveness to Ifn through binding of the ISGF3 complex. In addition to V5 and V6, we have identified three more alternatively spliced IRF-5 isoforms (V7, V8, and V9); V5 and V6 were expressed in peripheral blood mononuclear cells from healthy donors and in immortalized B and T cell malignancies, whereas expression of V7, V8, and V9 transcripts were detected only in human cancers. The results of this study demonstrated the existence of multiple IRF-5 spliced isoforms with distinct cell type-specific expression, cellular localization, differential regulation, and dissimilar functions in virus-mediated type I Ifn gene induction. Interferon regulatory factor-5 (IRF-5) is a mediator of virus-induced immune activation and type I interferon (Ifn) gene regulation. In human primary plasmacytoid dendritic cells (PDC), IRF-5 is transcribed into four distinct alternatively spliced isoforms (V1, V2, V3, and V4), whereas in human primary peripheral blood mononuclear cells two additional new isoforms (V5 and V6) were identified. The IRF-5 V1, V2, and V3 transcripts have different noncoding first exons and distinct insertion/deletion patterns in exon 6. Here we showed that V1 and V3 have distinct transcription start sites and are regulated by two discrete promoters. The V1 promoter (P-V1) is constitutively active, contains an IRF-E consensusbinding site, and is further stimulated in virus-infected cells by IRF family members. In contrast, endogenous V3 transcripts were up-regulated by type I Ifns, and the V3 promoter (P-V3) contains an Ifn-stimulated responsive element-binding site that confers responsiveness to Ifn through binding of the ISGF3 complex. In addition to V5 and V6, we have identified three more alternatively spliced IRF-5 isoforms (V7, V8, and V9); V5 and V6 were expressed in peripheral blood mononuclear cells from healthy donors and in immortalized B and T cell malignancies, whereas expression of V7, V8, and V9 transcripts were detected only in human cancers. The results of this study demonstrated the existence of multiple IRF-5 spliced isoforms with distinct cell type-specific expression, cellular localization, differential regulation, and dissimilar functions in virus-mediated type I Ifn gene induction. Virus infection results in the activation of a defined set of cellular genes involved in host antiviral defense. Transcription factors of the interferon (Ifn) 1The abbreviations used are: Ifn, interferon; IRF-5, interferon regulatory factor-5; PBMC, peripheral blood mononuclear cells; PDC, plasmacytoid dendritic cells; RT, reverse transcription; MO, monocytes; RACE, rapid amplification of cDNA ends; DN, dominant negative; NDV, Newcastle Disease virus; VSV, vesicular stomatitis virus; UTR, untranslated region; ISG, Ifn-stimulated gene; HSV, herpes simplex virus; gfp, green fluorescent protein; NK, natural killer; SAP, secreted alkaline phosphatase; TLR, Toll-like receptor; IKK, IKappaB kinase. regulatory factor (IRF) family have been identified as having important roles in innate immunity by participating in both the immediate-early transcriptional response to infection and the secondary response to cytokines (1Mamane Y. Heylbroeck C. Genin P. Algarte M. Servant M.J. LePage C. DeLuca C. Kwon H. Lin R. Hiscott J. Gene (Amst.). 1999; 237: 1-14Crossref PubMed Scopus (464) Google Scholar, 2Barnes B. Lubyova B. Pitha P.M. J. Interferon Cytokine Res. 2002; 22: 59-71Crossref PubMed Scopus (273) Google Scholar, 3Stark G.R. Kerr I.M. Williams B.R. Silverman R.H. Schreiber R.D. Annu. Rev. Biochem. 1998; 67: 227-264Crossref PubMed Scopus (3380) Google Scholar, 4Taniguchi T. Ogasawara K. Takaoka A. Tanaka N. Annu. Rev. Immunol. 2001; 19: 623-655Crossref PubMed Scopus (1292) Google Scholar). While playing an important role in the antiviral immune response, IRFs also participate in cell growth regulation and apoptosis (5Tanaka N. Taniguchi T. Semin. Cancer Biol. 2000; 10: 73-81Crossref PubMed Scopus (73) Google Scholar, 6Takaoka A. Hayakawa S. Yanai H. Stoiber D. Negishi H. Kikuchi H. Sasaki S. Imai K. Shibue T. Honda K. Taniguchi T. Nature. 2003; 424: 516-523Crossref PubMed Scopus (739) Google Scholar). IRF-5 is one of the most recently characterized members of the IRF family (2Barnes B. Lubyova B. Pitha P.M. J. Interferon Cytokine Res. 2002; 22: 59-71Crossref PubMed Scopus (273) Google Scholar, 7Barnes B.J. Moore P.M. Pitha P.M. J. Biol. Chem. 2001; 26: 23382-23390Abstract Full Text Full Text PDF Scopus (311) Google Scholar, 8Barnes B.J. Kellum M.J. Field A.E. Pitha P.M. Mol. Cell. Biol. 2002; 22: 5721-5740Crossref PubMed Scopus (210) Google Scholar, 9Barnes B.J. Field A.E. Pitha-Rowe P.M. J. Biol. Chem. 2003; 278: 16630-16641Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 10Barnes B.J. Kellum M.J. Pinder K.E. Frisancho J.A. Pitha P.M. Cancer Res. 2003; 63: 6424-6431PubMed Google Scholar, 11Barnes B.J. Richards J. Mancl M. Hanash S. Beretta L. Pitha P.M. J. Biol. Chem. 2004; 279: 45194-45207Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 12Mori T. Anazawa Y. Iiizumi M. Fukuda S. Nakamura Y. Arakawa H. Oncogene. 2002; 21: 2914-2918Crossref PubMed Scopus (121) Google Scholar, 13Lin R. Yang L. Arguello M. Penafuerte C. Hiscott J. J. Biol. Chem. 2005; 280: 3088-3095Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar, 14Cheng F. Ando O. Brzostek S. VanScoy S. Reich N.C. Joint Meeting of the ICS and ISICR, San Juan, Puerto Rico, October 21–25, 2004. Mary Ann Liebert, Inc., Larchmont, NY2004: 27Google Scholar). It encodes a 60–63-kDa polypeptide that was originally identified as a regulator of type I Ifn gene expression (7Barnes B.J. Moore P.M. Pitha P.M. J. Biol. Chem. 2001; 26: 23382-23390Abstract Full Text Full Text PDF Scopus (311) Google Scholar, 9Barnes B.J. Field A.E. Pitha-Rowe P.M. J. Biol. Chem. 2003; 278: 16630-16641Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar). However, recent studies have indicated that it plays a role in many aspects of host defense (11Barnes B.J. Richards J. Mancl M. Hanash S. Beretta L. Pitha P.M. J. Biol. Chem. 2004; 279: 45194-45207Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar), including induction of multiple cytokines and chemokines involved in the recruitment of T lymphocytes (8Barnes B.J. Kellum M.J. Field A.E. Pitha P.M. Mol. Cell. Biol. 2002; 22: 5721-5740Crossref PubMed Scopus (210) Google Scholar). Subsequently, it has been shown that IRF-5 itself is regulated by type I Ifn (8Barnes B.J. Kellum M.J. Field A.E. Pitha P.M. Mol. Cell. Biol. 2002; 22: 5721-5740Crossref PubMed Scopus (210) Google Scholar, 10Barnes B.J. Kellum M.J. Pinder K.E. Frisancho J.A. Pitha P.M. Cancer Res. 2003; 63: 6424-6431PubMed Google Scholar), indicating an important regulatory pathway for the controlled induction of multiple immunomodulatory genes (11Barnes B.J. Richards J. Mancl M. Hanash S. Beretta L. Pitha P.M. J. Biol. Chem. 2004; 279: 45194-45207Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar). The role of IRF family members in the induction of cell arrest and cell death has been well established (5Tanaka N. Taniguchi T. Semin. Cancer Biol. 2000; 10: 73-81Crossref PubMed Scopus (73) Google Scholar, 10Barnes B.J. Kellum M.J. Pinder K.E. Frisancho J.A. Pitha P.M. Cancer Res. 2003; 63: 6424-6431PubMed Google Scholar, 12Mori T. Anazawa Y. Iiizumi M. Fukuda S. Nakamura Y. Arakawa H. Oncogene. 2002; 21: 2914-2918Crossref PubMed Scopus (121) Google Scholar, 15Tanaka N. Ishihara M. Lamphier M.S. Nozawa H. Matsuyama T. Mak T.W. Aizawa S. Tokino T. Oren M. Taniguchi T. Nature. 1996; 382: 816-818Crossref PubMed Scopus (302) Google Scholar, 16Heylbroeck C. Balachandran S. Servant M.J. DeLuca C. Barber G.N. Lin R. Hiscott J. J. Virol. 2000; 74: 3781-3792Crossref PubMed Scopus (150) Google Scholar, 17Tamura T. Ishihara M. Lamphier M.S. Tanaka N. Oishi I. Aizawa S. Matsuyama T. Mak T.W. Taki S. Taniguchi T. Nature. 1995; 376: 596-599Crossref PubMed Scopus (421) Google Scholar). Although IRF-5 participates in the virus-induced signaling cascade, its expression is also modulated by p53 (12Mori T. Anazawa Y. Iiizumi M. Fukuda S. Nakamura Y. Arakawa H. Oncogene. 2002; 21: 2914-2918Crossref PubMed Scopus (121) Google Scholar), and it has a role in the apoptotic signaling pathway that is p53-independent (10Barnes B.J. Kellum M.J. Pinder K.E. Frisancho J.A. Pitha P.M. Cancer Res. 2003; 63: 6424-6431PubMed Google Scholar). Thus, IRF-5 modulates the expression of a number of factors involved in cell cycle regulation and apoptosis, independent of viral infection (10Barnes B.J. Kellum M.J. Pinder K.E. Frisancho J.A. Pitha P.M. Cancer Res. 2003; 63: 6424-6431PubMed Google Scholar). The ability of IRF-5 to induce expression of proteins involved in the regulation of cell growth, apoptosis, and immunomodulation represents an important defense mechanism against extracellular stress, including viral infection. How significant is the overlapping cross-talk between Ifn and apoptotic signaling pathways is currently unknown, yet it has been suggested recently that type I Ifn can also induce p53 (6Takaoka A. Hayakawa S. Yanai H. Stoiber D. Negishi H. Kikuchi H. Sasaki S. Imai K. Shibue T. Honda K. Taniguchi T. Nature. 2003; 424: 516-523Crossref PubMed Scopus (739) Google Scholar). Altogether, the current data suggest an important role for IRF-5 in both Ifn- and p53-mediated signaling pathways. To date, a large number of IRF-5 sequences have been deposited to GenBank™. Most interesting, the first complete coding sequence of human IRF-5, isolated from lymphocytes and deposited in 1996 to GenBank™ (accession number U51127), was not functionally characterized. Subsequently, we had cloned two new isoforms of IRF-5, here termed variants 3 (V3; GenBank™ accession number AY504946) and 4 (V4; GenBank™ accession number AY504947) from a dendritic cell library (7Barnes B.J. Moore P.M. Pitha P.M. J. Biol. Chem. 2001; 26: 23382-23390Abstract Full Text Full Text PDF Scopus (311) Google Scholar), and we have characterized the identical polypeptide they encode (2Barnes B. Lubyova B. Pitha P.M. J. Interferon Cytokine Res. 2002; 22: 59-71Crossref PubMed Scopus (273) Google Scholar, 7Barnes B.J. Moore P.M. Pitha P.M. J. Biol. Chem. 2001; 26: 23382-23390Abstract Full Text Full Text PDF Scopus (311) Google Scholar, 8Barnes B.J. Kellum M.J. Field A.E. Pitha P.M. Mol. Cell. Biol. 2002; 22: 5721-5740Crossref PubMed Scopus (210) Google Scholar, 9Barnes B.J. Field A.E. Pitha-Rowe P.M. J. Biol. Chem. 2003; 278: 16630-16641Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 10Barnes B.J. Kellum M.J. Pinder K.E. Frisancho J.A. Pitha P.M. Cancer Res. 2003; 63: 6424-6431PubMed Google Scholar, 11Barnes B.J. Richards J. Mancl M. Hanash S. Beretta L. Pitha P.M. J. Biol. Chem. 2004; 279: 45194-45207Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar). In the past 2 years, two additional isoforms, termed variant 1 (V1; isoform a; NM_002200; U51127) and variant 2 (V2; isoform b; NM_032643), have been deposited to GenBank™. These two cDNAs encode proteins distinct from the isoforms 3 and 4 that we have identified, and their functions have yet to be characterized. Sequence analyses of these four isoforms reveal that they differ in their first exon and in the pattern of deletion(s) in exon 6. Alternative splicing of pre-mRNA has been described for other IRF family members, including IRF-1, -3, and -7, in which each isoform may be differentially expressed depending on the cell or tissue type (18Harada H. Kondo T. Ogawa S. Tamura T. Kitagawa M. Tanaka N. Lamphier M.S. Hirai H. Taniguchi T. Oncogene. 1994; 9: 3313-3320PubMed Google Scholar, 19Zhang L. Pagano J.S. Mol. Cell. Biol. 1997; 17: 5748-5757Crossref PubMed Scopus (227) Google Scholar, 20Zhang L. Pagano J.S. Semin. Cancer Biol. 2001; 11: 445-453Crossref PubMed Scopus (28) Google Scholar, 21Karpova A.Y. Howley P.M. Ronco L.V. Genes Dev. 2000; 14: 2813-2818Crossref PubMed Scopus (28) Google Scholar, 22Karpova A.Y. Ronco L.V. Howley P.M. Mol. Cell. Biol. 2001; 21: 4169-4176Crossref PubMed Scopus (52) Google Scholar). However, differential isoform expression and regulation of these IRFs at the promoter levels have not been addressed yet, even though the promoters of each have been isolated and partially characterized (23Lowther W.J. Moore P.A. Carter K.C. Pitha P.M. DNA Cell Biol. 1999; 18: 685-692Crossref PubMed Scopus (29) Google Scholar, 24Lu R. Au W.C. Yeow W. Hageman N. Pitha P.M. J. Biol. Chem. 2000; 41: 31805-31812Abstract Full Text Full Text PDF Scopus (139) Google Scholar, 25Sims S.H. Cha Y. Romine M.F. Gao P.Q. Gottlieb K. Deisseroth A.B. Mol. Cell. Biol. 1993; 13: 690-702Crossref PubMed Scopus (249) Google Scholar). The aim of the present study was to examine the regulated transcription of the human IRF-5 gene. The transcription analyses demonstrate that two distinct promoter regions differentially regulate exon 1 of V1-associated transcripts and exon 1 of V3 transcripts, where the P-V1 promoter responds to viral infection and the P-V3 promoter responds to Ifn stimulation. However, the transcription pattern of the IRF-5 gene is more complex, and we have identified nine distinct alternatively spliced IRF-5 mRNAs (V1–V9). Here we describe the alternative splice patterns of the new IRF-5 isoforms, their cell type-specific expression, localization, inducibility, and function in virus-mediated type I Ifn gene induction. Human HeLa, 293T, A549, and Madin-Darby bovine kidney cells were obtained from the American Type Tissue Collection (ATCC). Human fibroblasts (2fTGH) were from G. Stark (Cleveland Clinic), and primary human fibroblasts were from G. Hayward (Johns Hopkins University). These adherent cell lines were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum. Daudi, Namalwa, and BJAB B cell lymphomas, THP-1 acute monocytic leukemia, U937 monocytic lymphoma, and BC-3 and BCBL-1 primary effusion lymphomas (PEL) were from ATCC and cultivated in RPMI with 10% fetal bovine serum. Peripheral blood mononuclear cells (PBMC), plasmacytoid dendritic cells (PDC), monocytes (MO), natural killer (NK), and B and T cells were isolated and purified as described previously (26Izaguirre A. Barnes B.J. Amrute S. Yeow W.S. Megjugorac N. Dai J. Feng D. Chung E. Pitha P.M. Fitzgerald-Bocarsly P. J. Leukocyte Biol. 2003; 74: 1125-1138Crossref PubMed Scopus (288) Google Scholar, 27Dai J. Megjugorac N.J. Amrute S.B. Fitzgerald-Bocarsly P. J. Immunol. 2004; 173: 1535-1548Crossref PubMed Scopus (118) Google Scholar, 28Megjugorac N.J. Young H.A. Amrute S.B. Olshalsky S.L. Fitzgerald-Bocarsly P. J. Leukocyte Biol. 2004; 75: 504-514Crossref PubMed Scopus (143) Google Scholar) from fresh heparinized peripheral blood obtained with informed consent from healthy volunteers. PDC (Lin–, CD123+, CD11c–, and human leukocyte antigen-DR+ cells) were isolated by using BDCA-4 microbeads, MO by using CD14 beads, NK by using CD16 beads, T cells by using CD3 beads, and B cells by using CD19 beads (Miltenyi Biotec). Cell purities were all greater than 95%, as determined by flow cytometry. The human studies were approved by the Institutional Review Board of the New Jersey Medical School. Newcastle Disease virus (NDV) was obtained from the ATCC (VR-699); vesicular stomatitis virus was from P. Marcus (University of Connecticut); recombinant Ifn-α2B was purchased from Schering Plough (Kenilworth, NJ), and Ifn-γ was from R&D Systems, Inc. Herpes simplex virus type I (HSV-1) strain 2931 was originally obtained from Carlos Lopez then of the Sloan-Kettering Institute for Cancer Research (New York, NY); CpG (ODN 2336) was from the Coley Pharmaceutical Group (Wellesly, MA); Resiquimod (R848) was from GLSynthesis Inc. (Worcester, MA). The 5′ ends of the IRF-5 mRNAs were determined by using RNA from unstimulated or Ifnα2-stimulated (500 units/ml for 16 h) BJAB cells using the 5′/3′-RACE Kit, 2nd Generation (Roche Applied Science), as described by the manufacturer. For amplification from each first exon (Ex1), the RACEV1R primer was used for Ex1V1, RACEV2R for Ex1V2, and RACEV3R for Ex1V3 (primers 1–3, Table I). RNA was reverse-transcribed using these three primers that are specific for each first exon, with subsequent RNase I degradation of the RNA template. Following the addition of a homopolymeric A-tail to the antisense strand of the 5′ end of cDNAs, the tailed cDNA was amplified using a sense oligo(dT)-anchor primer and the same antisense primers specific for each first exon as named above. A second nested PCR was then performed using the oligo(dT)-anchor primer and a nested antisense primer specific for each first exon (primers 4–6, Table I). PCRs were carried out using Pfu proofreading polymerase for the generation of blunt-ended products, and an initial 2-min denaturation step at 94 °C followed by 10 cycles of successive incubations at 94 °C (15 s), 70 °C (30 s), and 72 °C (1 min) and 15 cycles of successive incubations at 94 °C (15 s), 70 °C (30 s), and 72 °C (initially 40 s with an increase of 20 s in each successive cycle), and a final 7-min elongation at 72 °C. PCR products were either electrophoresed on a 1.5% agarose gel or cloned in the pCR 4Blunt-TOPO vector using the Zero Blunt TOPO PCR cloning kit for sequencing (Invitrogen) and sequenced.Table IPrimers and oligonucleotidesNameSequence (5′ → 3′)1RACEV1RTGTCTGCGGTGCGCCTGCGTGG2RACEV2RCGAGCTCGCTTTCCAGGCGCAGCT3RACEV3RGGGGTTGCACCTGCCTAGTGCCG4RACEV1R-NCCAAGCTGAGCTCTGCCCAGGCT5RACEV2R-NCGCTTTCCAGGCGCAGCTGGAC6RACEV3R-NGCCTAGTGCCGCCTCTGAGCTGC7PIRF5-F14GGGGTACCCCGGGGAGGGAAGGTCAAAGTTC8PIRF5-R9CCGCTCGAGCCGGTGACATCAGCCAGTGAG9PIRF5-F7CGACGCGTCGCTCAGCCCGGATCTCCAGTTGC10PIRF5-R3CGACGCGTCGGTGCCACAGCAGTCCTAGTAAG11PRIF5-F2GGGGTACCCCCTTACTAGGACTGCTGTGGCAC12PIRF5-R4CCGCTCGAGCGGGAGAGGTAAGGCCGGCCCTTGCCTG13PIRF5-F1GGGGTACCCCCGACACATTCACTTCTGATGGG14PIRF5-R1CCGCTCGAGCGGCCTTGAAGATGGTGTTATCTCC15PIRF5-IRFE-MSGGAAATCAGACATCAAAATTGCCACCCGCTGAATTTTCC16PIRF5-IRFE-MASGGAAAATTCAGCGGGTGGCAATTTTGATGTCTGATTTCC17PIRF5-ISRE-MSGGCTGGGGCAGAAGCCGGAACTGAGCCC18PIRF5-ISRE-ASGGGCTCAGTTCCGGCTTCTGCCCCAGCC19IRF5 FA5′AGACCAAGCTTTTCAGCCTGG20IRF5 F3′AAGCGGCCGCGCCTTGTTATTGCATGCCAGC21PIRF5V1-F77CCTGGCGCAGCCACGCAGGCGCA22PIRF5V2-F13GCGCCTGGAAAGCGAGCTCG23PIRF5V3-F25CTAGGCAGGTGCAACCCCAAAA24PIRF5-R7CCAAAAGAGTAATCCTCAGGG25IRF5ex6 5′TTGCCAAGCCTGAGCCTCACA26IRF5 ex6 3′CTTGATCTCCAGGTCGGTCA27IRF5 FB3′AAGCGGCCGCGCCTTGTTATTGCATGCCAGC28ISRE-S-BGGAGGCTGGGGCAAGGAAATTGAAACTTGAGCCCGC29ISRE-AS-BGCGGGCTCAAGTTTCAATTTCCTTGCCCCAGCCTCC30IRF5-ISRE-S-BGGAGGCTGGGGCAGAAAGCGGAACTGAGCCCGC31IRF5-ISRE-AS-BGCGGGCTCAGTTCCGCTTTCTGCCCCAGCCTCC Open table in a new tab Genomic DNA was prepared from human BJAB cells. PCR was used to amplify the P-V1, P-V2, P-V3, and P-Ex2 5′-flanking regions (Fig. 1A) from the genomic BJAB DNA using, respectively, the following primers: PIRF5-F14 and PIRF5-R9, PIRF5-F7 and PIRF5-R3, PIRF5-F2 and PIRF5-R4, PIRF5-F1 and PIRF5-R1 (primers 7–14, Table I). All fragments were cloned into the KpnI and XhoI sites of pGL-3 basic vector (Promega) with the exception of the P-V2 fragment, which was cloned into the MluI site of the same vector. Nucleotide sequences for P-V1 (AY519977) and P-V3 (AY519978) were deposited to GenBank™. The P-V1 and P-V3 constructs were used to generate the mutation constructs P-V1-IRFE-M and P-V3-ISRE-M (primers 15–18, Table I). Site-directed mutagenesis was performed with the QuikChange Site-directed Mutagenesis kit (Stratagene) according to the manufacturers' specifications. Total RNA was isolated using the Qiagen RNeasy mini kit, and 1 μg was reverse-transcribed to cDNA using oligo(dT) primers. From this mixture of cDNAs, IRF-5, IRF-7, IfnA, IfnB, and β-actin cDNA were amplified by PCR as described (7Barnes B.J. Moore P.M. Pitha P.M. J. Biol. Chem. 2001; 26: 23382-23390Abstract Full Text Full Text PDF Scopus (311) Google Scholar, 29Yeow W.S. Au W.C. Juang Y.T. Fields C.D. Dent C.L. Gewert D.R. Pitha P.M. J. Biol. Chem. 2000; 275: 6313-6320Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). The IRF-5 primers (7Barnes B.J. Moore P.M. Pitha P.M. J. Biol. Chem. 2001; 26: 23382-23390Abstract Full Text Full Text PDF Scopus (311) Google Scholar) (primers 19 and 20, Table I) used to detect all known IRF-5 isoforms bind to a region in the carboxyl terminus spanning exons 7–9. For screening of IRF-5 isoform expression associated with a specific exon 1, sense primers that were specific for each first exon and a common antisense primer that results in amplification through exon 4 were used (Fig. 1B). IRF-5 V1 cDNA was amplified with PIRF5V1-F77 (specific to Ex1V1), V2 cDNA with PIRF5-F13 (specific to Ex1V2), or V3 cDNA with PIRF5V3-F25 (specific to Ex1V3) and PIRF5-R7 (exon 4 specific) primers (primers 21–24, Table I). Optimal PCR cycling conditions for the V1, V2, and V3 transcripts were as follows: 1 cycle at 94 °C (4 min); 37 cycles at 94 °C (1 min), 63.9 °C (1 min), and 72 °C (1 min 30 s); and 1 cycle at 72 °C (5 min). For the determination of exon 6 patterning in various cell types, primers that amplify exon 5 (primer 25) through exon 7 (primer 26) were used. Optimal PCR conditions were as follows: 1 cycle at 94 °C (4 min); 40 cycles at 94 °C (1 min), 63.9 °C (1 min), and 72 °C (1 min 30 s); and 1 cycle 72 °C (5 min). In order to distinguish between V1- and V4-specific expression and to determine expression of new IRF-5 variants associated with their specific deletion/insertion pattern(s) in exons 5–7, exons 1–7 were amplified with each specific exon 1 sense primer (primers 21–23, Table I and Fig. 1B) and a common antisense primer (primer 26, Table I and Fig. 1B). Optimal PCR conditions were identical to the exon 1–4 PCR amplification, except 37 cycles were used. PCR products were either electrophoresed on a 1.5% agarose gel and/or cloned to the pCR®2.1-TOPO vector using the TOPO TA cloning kit (Invitrogen) and sequenced. The IRF-1, IRF-3, IRF-5 (V3 and V4), and IRF-7 expression vectors were described (7Barnes B.J. Moore P.M. Pitha P.M. J. Biol. Chem. 2001; 26: 23382-23390Abstract Full Text Full Text PDF Scopus (311) Google Scholar, 30Au W.C. Su Y. Raj N.B. Pitha P.M. J. Biol. Chem. 1993; 268: 24032-24040Abstract Full Text PDF PubMed Google Scholar, 31Au W.C. Moore P.A. Lowther W. Juang Y.T. Pitha P.M. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11657-11661Crossref PubMed Scopus (349) Google Scholar, 32Au W.C. Moore P.A. LaFleur D.W. Tombal B. Pitha P.M. J. Biol. Chem. 1998; 273: 29210-29217Abstract Full Text Full Text PDF PubMed Scopus (240) Google Scholar). Full-length IRF-5 V2 was subcloned from the pOTB7 plasmid (Open Biosystems) to pCMV-tag2b (Stratagene Inc.) at EcoRI and XhoI restriction sites. For the cloning of new IRF-5 isoforms, total RNA was isolated from PBMC or THP-1 cells. Superscript one-step PCR was performed using a Pfu proofreading polymerase with sense primers specific to each first exon (primers 21–23, Table I) and a common antisense primer that results in amplification through exon 9 (primer 27, Table I). Briefly, cDNA was synthesized at 45 °C (30 min) and 94 °C (2 min). PCR cycling conditions were as follows: 35 cycles 94 °C (30 s), 57 °C (30 s), and 68 °C (2 min 30 s); 1 cycle 72 °C (10 min). PCR products were electrophoresed on a 1.0% agarose gel, purified, and either cloned directly to the pCR 4Blunt-TOPO vector (Invitrogen) and sequenced or end conversion was performed, and the PCR product was cloned directly to the pSTBlue-1 vector (Novagen) and sequenced. Once full-length positive clones were identified through sequencing, each IRF-5 isoform cDNA was then subcloned to the pCMV-Tag2b mammalian FLAG-tagged expression vector (Stratagene). IRF-5 isoforms were also cloned to pEGFP-C1 vector (Clontech) at EcoRI and SalI sites. Nucleotide sequences (V5, accession number AY693665; V6, accession number AY693666; V7, accession number AY693667; V8, accession number AY693668; and V9, accession number AY693669) were deposited to GenBank™. Biotinylated antisense oligonucleotides were annealed with the corresponding sense oligonucleotides (primers 28–31, Table I). Briefly, 4 μg of biotinylated DNA was incubated with 100 μg of DynaBeads M-280 streptavidin (Dynal Inc.) for 16 h in 200 μl of TEN buffer (20 mm Tris, pH 8.0, 1 mm EDTA, 0.1 m NaCl), and unbound DNA was removed by extensive washing. Cell extracts were prepared as described previously (29Yeow W.S. Au W.C. Juang Y.T. Fields C.D. Dent C.L. Gewert D.R. Pitha P.M. J. Biol. Chem. 2000; 275: 6313-6320Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar) from control untreated BJAB cells or cells stimulated with 500 units/ml Ifnα2 for 16 h. Extracts (300 μg of protein) were incubated with bound DNA (7Barnes B.J. Moore P.M. Pitha P.M. J. Biol. Chem. 2001; 26: 23382-23390Abstract Full Text Full Text PDF Scopus (311) Google Scholar, 24Lu R. Au W.C. Yeow W. Hageman N. Pitha P.M. J. Biol. Chem. 2000; 41: 31805-31812Abstract Full Text Full Text PDF Scopus (139) Google Scholar) and washed, and the bound proteins were identified by immunoblotting. Rabbit polyclonal antibodies against ISGF3γp48, STAT1, and STAT2 were purchased from Santa Cruz Biotechnologies. Signals were visualized using the ECL detection reagents (Amersham Biosciences). Purified PBMC, PDC, MO, NK, and B and T cells were stimulated with either Ifn-α2B (10,000 IU), HSV-1 (multiplicity of infection of 1), or CpG DNA (40 μg/ml) for 6 h at 37°C with 5% CO2. BJAB and Daudi were stimulated with Ifn-α2 (1000 units/ml) for 16 h; Daudi and THP-1 were infected with NDV (240 plaque-forming units) for 16 h; THP-1 was stimulated with VSV (multiplicity of infection of 2) or R848 (10 μm) for 16 h. 2fTGH cells were transiently transfected with gfp-IRF-5 variant expression plasmids using the Superfect transfection reagent (Qiagen) for 30 h and then examined by fluorescent microscopy using a Nikon TE-200 and DXM12000F at ×40 magnification. Dual Luciferase Assay—293T, 2fTGH, or HeLa cells were transfected in 60-mm dishes using SuperFect. 2 μg of the reporter plasmid DNA and 0.1 μg of pRL-CMV (internal control; Promega) were used for each transfection. In co-transfection experiments a 1:1 ratio of the reporter and expression plasmid (2 μg each) were used. The final concentration of transfected DNA was kept constant in all co-transfection assays. Cells were harvested 24 h post-transfection unless additional treatments were performed. For further treatments, cells were split 12–16 h post-transfection into 6-well plates and incubated for another 8 h, after which medium was replaced either with Dulbecco's modified Eagle's medium containing recombinant Ifn-α2 (500 units/ml), Ifn-γ (1000 units/ml), or NDV (50 μl/ml). Treatments/infections were incubated an additional 16 h, and cells were then harvested and lysed with 1× Passive Lysis Buffer (Promega). Protein concentrations were determined using the Bio-Rad Protein Assay according to manufacturer's instructions. Luciferase assays were carried out using the Dual Luciferase Assay kit according to the manufacturer's specifications (Promega). Experiments were repeated at least three times in duplicate. SAP Assay—2 × 105 2fTGH or 2fTGH/IRF-5 V3 (7Barnes B.J. Moore P.M. Pitha P.M. J. Biol. Chem. 2001; 26: 23382-23390Abstract Full Text Full Text PDF Scopus (311) Google Scholar) stable expressing cells were transfected with a constant amount of DNA (2 μg/6-well plate) by using the Superfect transfection reagent (Qiagen). Equal amounts of the indicated SAP reporter plasmids and IRF5-expressing plasmids were co-transfected with the β-galactosidase expression plasmid (50 ng). Transfected cells were split 16 h later, incubated for an additional 6 h, and either left uninfected or infected with NDV for another 16 h. The SAP was determined as described (29Yeow W.S. Au W.C. Juang Y.T. Fields C.D. Dent C.L. Gewert D.R. Pitha P.M. J. Biol. Chem. 2000; 275: 6313-6320Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 33Dent C.L. Macbride S.J. Sharp N.A. Gewert D.R. Eur. J. Biochem. 1996; 16: 99-107Google Scholar). Each experiment was repeated at least three times; β-galactosidase expression levels were used to normalize the difference in transfection efficiency. Ifn Cytopathic Effect Assay—2fTGH cells (0.5 × 105 cells/well of a 6-well plate) were transiently transfected with 50 ng of each FLAG-tagged IRF-5 full-length variant expression vector. 16 h later, cells were split in duplicate to a 24-well plate, incubated for 8 h, and either left uninfected or infected with NDV for an additional 16 h. The levels of biologically active type I Ifn or Ifn-α were determined in the cell culture supernatants by the viral cytopathic effect assay (34Cheung S.C. Chattopadhyay S.K. Hartley J.W. Morse III, H.C. Pitha P.M. J. Immunol. 1991; 146: 121-127PubMed Google Scholar). VSV was used as the challenging viru

Referência(s)