The Isomerase Active Site of Cyclophilin A Is Critical for Hepatitis C Virus Replication
2009; Elsevier BV; Volume: 284; Issue: 25 Linguagem: Inglês
10.1074/jbc.m109.007625
ISSN1083-351X
AutoresUdayan Chatterji, Michael Bobardt, Suganya Selvarajah, Feng Yang, Hengli Tang, N SAKAMOTO, Grégoire Vuagniaux, Tanya Parkinson, Philippe Gallay,
Tópico(s)Toxin Mechanisms and Immunotoxins
ResumoCyclosporine A and nonimmunosuppressive cyclophilin (Cyp) inhibitors such as Debio 025, NIM811, and SCY-635 block hepatitis C virus (HCV) replication in vitro. This effect was recently confirmed in HCV-infected patients where Debio 025 treatment dramatically decreased HCV viral load, suggesting that Cyps inhibitors represent a novel class of anti-HCV agents. However, it remains unclear how these compounds control HCV replication. Recent studies suggest that Cyps are important for HCV replication. However, a profound disagreement currently exists as to the respective roles of Cyp members in HCV replication. In this study, we analyzed the respective contribution of Cyp members to HCV replication by specifically knocking down their expression by both transient and stable small RNA interference. Only the CypA knockdown drastically decreased HCV replication. The re-expression of an exogenous CypA escape protein, which contains escape mutations at the small RNA interference recognition site, restored HCV replication, demonstrating the specificity for the CypA requirement. We then mutated residues that reside in the hydrophobic pocket of CypA where proline-containing peptide substrates and cyclosporine A bind and that are vital for the enzymatic or the hydrophobic pocket binding activity of CypA. Remarkably, these CypA mutants fail to restore HCV replication, suggesting for the first time that HCV exploits either the isomerase or the chaperone activity of CypA to replicate in hepatocytes and that CypA is the principal mediator of the Cyp inhibitor anti-HCV activity. Moreover, we demonstrated that the HCV NS5B polymerase associates with CypA via its enzymatic pocket. The study of the roles of Cyps in HCV replication should lead to the identification of new targets for the development of alternate anti-HCV therapies. Cyclosporine A and nonimmunosuppressive cyclophilin (Cyp) inhibitors such as Debio 025, NIM811, and SCY-635 block hepatitis C virus (HCV) replication in vitro. This effect was recently confirmed in HCV-infected patients where Debio 025 treatment dramatically decreased HCV viral load, suggesting that Cyps inhibitors represent a novel class of anti-HCV agents. However, it remains unclear how these compounds control HCV replication. Recent studies suggest that Cyps are important for HCV replication. However, a profound disagreement currently exists as to the respective roles of Cyp members in HCV replication. In this study, we analyzed the respective contribution of Cyp members to HCV replication by specifically knocking down their expression by both transient and stable small RNA interference. Only the CypA knockdown drastically decreased HCV replication. The re-expression of an exogenous CypA escape protein, which contains escape mutations at the small RNA interference recognition site, restored HCV replication, demonstrating the specificity for the CypA requirement. We then mutated residues that reside in the hydrophobic pocket of CypA where proline-containing peptide substrates and cyclosporine A bind and that are vital for the enzymatic or the hydrophobic pocket binding activity of CypA. Remarkably, these CypA mutants fail to restore HCV replication, suggesting for the first time that HCV exploits either the isomerase or the chaperone activity of CypA to replicate in hepatocytes and that CypA is the principal mediator of the Cyp inhibitor anti-HCV activity. Moreover, we demonstrated that the HCV NS5B polymerase associates with CypA via its enzymatic pocket. The study of the roles of Cyps in HCV replication should lead to the identification of new targets for the development of alternate anti-HCV therapies. Hepatitis C virus (HCV) 2The abbreviations used are: HCVhepatitis C virusCsAcyclosporine ACypcyclophilinIFNinterferonPPIasepeptidyl-prolyl cis-trans-isomerasesiRNAsmall interfering RNAHAhemagglutininshRNAsmall hairpin RNAHIV-1human immunodeficiency virus, type 1FACSfluorescence-activated cell sorterIFSAintracellular FACS staining assayPBSphosphate-buffered salineHSV-1herpes simplex virus, type 1GFPgreen fluorescent protein. is the main contributing agent of acute and chronic liver diseases worldwide (1Pawlotsky J.M. Hepatology. 2006; 43: S207-S220Crossref PubMed Scopus (168) Google Scholar). Primary infection is often asymptomatic or associated with mild symptoms. However, persistently infected individuals develop high risks for chronic liver diseases such as hepatocellular carcinoma and liver cirrhosis (1Pawlotsky J.M. Hepatology. 2006; 43: S207-S220Crossref PubMed Scopus (168) Google Scholar). The combination of IFNα and ribavirin that serves as current therapy for chronically HCV-infected patients not only has a low success rate (about 50%) (2Hayashi N. Takehara T. J. Gastroenterol. 2006; 41: 17-27Crossref PubMed Scopus (137) Google Scholar) but is often associated with serious side effects (2Hayashi N. Takehara T. J. Gastroenterol. 2006; 41: 17-27Crossref PubMed Scopus (137) Google Scholar). There is thus an urgent need for the development of novel anti-HCV treatments (2Hayashi N. Takehara T. J. Gastroenterol. 2006; 41: 17-27Crossref PubMed Scopus (137) Google Scholar). hepatitis C virus cyclosporine A cyclophilin interferon peptidyl-prolyl cis-trans-isomerase small interfering RNA hemagglutinin small hairpin RNA human immunodeficiency virus, type 1 fluorescence-activated cell sorter intracellular FACS staining assay phosphate-buffered saline herpes simplex virus, type 1 green fluorescent protein. The immunosuppressive drug cyclosporine A (CsA) was reported to be clinically effective against HCV (3Akiyama H. Yoshinaga H. Tanaka T. Hiruma K. Tanikawa S. Sakamaki H. Onozawa Y. Wakita T. Kohara M. Bone Marrow Transplant. 1997; 20: 993-995Crossref PubMed Scopus (28) Google Scholar). Controlled trials showed that a combination of CsA with IFNα is more effective than IFNα alone, especially in patients with a high viral load (4Inoue K. Sekiyama K. Yamada M. Watanabe T. Yasuda H. Yoshiba M. J. Gastroenterol. 2003; 38: 567-572Crossref PubMed Scopus (164) Google Scholar, 5Inoue K. Yoshiba M. Transplant. Proc. 2005; 37: 1233-1234Crossref PubMed Scopus (38) Google Scholar). Moreover, recent in vitro studies provided evidence that CsA prevents both HCV RNA replication and HCV protein production in an IFNα-independent manner (6Goto K. Watashi K. Murata T. Hishiki T. Hijikata M. Shimotohno K. Biochem. Biophys. Res. Commun. 2006; 343: 879-884Crossref PubMed Scopus (124) Google Scholar, 7Ishii N. Watashi K. Hishiki T. Goto K. Inoue D. Hijikata M. Wakita T. Kato N. Shimotohno K. J. Virol. 2006; 80: 4510-4520Crossref PubMed Scopus (135) Google Scholar, 8Ma S. Boerner J.E. TiongYip C. Weidmann B. Ryder N.S. Cooreman M.P. Lin K. Antimicrob. Agents Chemother. 2006; 50: 2976-2982Crossref PubMed Scopus (152) Google Scholar, 9Nakagawa M. Sakamoto N. Enomoto N. Tanabe Y. Kanazawa N. Koyama T. Kurosaki M. Maekawa S. Yamashiro T. Chen C.H. Itsui Y. Kakinuma S. Watanabe M. Biochem. Biophys. Res. Commun. 2004; 313: 42-47Crossref PubMed Scopus (208) Google Scholar, 10Watashi K. Hijikata M. Hosaka M. Yamaji M. Shimotohno K. Hepatology. 2003; 38: 1282-1288Crossref PubMed Scopus (467) Google Scholar). CsA exerts this anti-HCV activity independently of its immunosuppressive activity because the nonimmunosuppressive Cyp inhibitors such as Debio 025, NIM811, and SCY-635 also block HCV RNA and protein production (9Nakagawa M. Sakamoto N. Enomoto N. Tanabe Y. Kanazawa N. Koyama T. Kurosaki M. Maekawa S. Yamashiro T. Chen C.H. Itsui Y. Kakinuma S. Watanabe M. Biochem. Biophys. Res. Commun. 2004; 313: 42-47Crossref PubMed Scopus (208) Google Scholar, 11Coelmont L. Kaptein S. Paeshuyse J. Vliegen I. Dumont J.M. Vuagniaux G. Neyts J. Antimicrob. Agents Chemother. 2009; 53: 967-976Crossref PubMed Scopus (114) Google Scholar, 12Hopkins S. Scorneaux B. Huang Z. Murray M.G. Harris R. 59th Annual Meeting of the American Association for the Study of Liver Diseases, San Francisco, California, October 31–November 1, 2008. AASLD, Alexandria, VA2008Google Scholar, 13Mathy J.E. Ma S. Compton T. Lin K. Antimicrob. Agents Chemother. 2008; 52: 3267-3275Crossref PubMed Scopus (59) Google Scholar, 14Paeshuyse J. Kaul A. De Clercq E. Rosenwirth B. Dumont J.M. Scalfaro P. Bartenschlager R. Neyts J. Hepatology. 2006; 43: 761-770Crossref PubMed Scopus (257) Google Scholar). Unlike CsA, these molecules do not display calcineurin affinity and specifically inhibit the peptidyl-prolyl cis-trans-isomerase (PPIase) Cyps. Most importantly, recent clinical data demonstrated that Debio 025 dramatically decreased HCV viral load (3.6 log decrease) in patients coinfected with HCV and HIV (15Flisiak R. Horban A. Gallay P. Bobardt M. Selvarajah S. Wiercinska-Drapalo A. Siwak E. Cielniak I. Higersberger J. Kierkus J. Aeschlimann C. Grosgurin P. Nicolas-Métral V. Dumont J.M. Porchet H. Crabbé R. Scalfaro P. Hepatology. 2008; 47: 817-826Crossref PubMed Scopus (205) Google Scholar). This 14-day Debio 025 treatment (1200 mg orally administered twice daily) was effective against the three genotypes (genotypes 1, 3, and 4) represented in the study. More recently, the anti HCV effect of Debio 025 in combination with peginterferon α 2a (peg-IFNα2a) was investigated in treatment-inexperienced patients with chronic hepatitis C. Debio 025 (600 mg administered once daily) in combination with peg-IFNα2a (180 μg/week) for 4 weeks induced a continuous decay in viral load that reached −4.61 ± 1.88 IU/ml in patients with genotypes 1 and 4 and −5.91 ± 1.11 IU/ml in patients with genotypes 2 and 3 at week 4 (16Flisiak R. Dumont J.M. Crabbé R. Expert Opin. Invest. Drugs. 2007; 16: 1345-1354Crossref PubMed Scopus (49) Google Scholar). The Debio 025 findings are critical because they suggest that Cyp inhibitors represent a novel class of anti-HCV agents. However, it remains unclear how these compounds control HCV replication. The fact that several recent studies using small RNA interference knockdown approaches suggest that Cyps are critical for the HCV life cycle (9Nakagawa M. Sakamoto N. Enomoto N. Tanabe Y. Kanazawa N. Koyama T. Kurosaki M. Maekawa S. Yamashiro T. Chen C.H. Itsui Y. Kakinuma S. Watanabe M. Biochem. Biophys. Res. Commun. 2004; 313: 42-47Crossref PubMed Scopus (208) Google Scholar, 17Watashi K. Ishii N. Hijikata M. Inoue D. Murata T. Miyanari Y. Shimotohno K. Mol. Cell. 2005; 19: 111-122Abstract Full Text Full Text PDF PubMed Scopus (397) Google Scholar, 18Yang F. Robotham J.M. Nelson H.B. Irsigler A. Kenworthy R. Tang H. J. Virol. 2008; 82: 5269-5278Crossref PubMed Scopus (204) Google Scholar) strongly implies that there is a direct or indirect link between the CsA- and CsA derivative-mediated inhibitory effect on HCV replication and host Cyps. The discovery 20 years ago of the first cellular protein showing PPIase activity (19Lang K. Schmid F.X. Fischer G. Nature. 1987; 329: 268-270Crossref PubMed Scopus (431) Google Scholar) was entirely unrelated to the discovery of CypA as an intracellular protein possessing a high affinity for CsA (20Handschumacher R.E. Harding M.W. Rice J. Drugge R.J. Speicher D.W. Science. 1984; 226: 544-547Crossref PubMed Scopus (1513) Google Scholar). It is only a few years later that Fischer et al. (21Fischer G. Wittmann-Liebold B. Lang K. Kiefhaber T. Schmid F.X. Nature. 1989; 337: 476-478Crossref PubMed Scopus (1263) Google Scholar) demonstrated that the 18-kDa protein with PPIase activity and CypA represent a single unique protein. All Cyps contain a common domain of 109 amino acids, called the Cyp-like domain, which is surrounded by domains specific to each Cyp members and which dictates their cellular compartmentalization and function (22Wang P. Heitman J. Genome Biol. 2005; 6: 226-231Crossref PubMed Scopus (519) Google Scholar). Bacteria, fungi, insects, plants, and mammals contain Cyps, which all have PPIase activity and are structurally conserved (22Wang P. Heitman J. Genome Biol. 2005; 6: 226-231Crossref PubMed Scopus (519) Google Scholar). To date, 16 Cyp members have been identified, and 7 of them are found in humans: CypA, CypB, CypC, CypD, CypE, Cyp40, and CypNK (22Wang P. Heitman J. Genome Biol. 2005; 6: 226-231Crossref PubMed Scopus (519) Google Scholar). Although there is a growing body of evidence that Cyps control HCV replication in human hepatocytes, a major disagreement currently exists on the respective roles of Cyp members in HCV replication. One study suggests that CypB, but not CypA, is critical for HCV replication (17Watashi K. Ishii N. Hijikata M. Inoue D. Murata T. Miyanari Y. Shimotohno K. Mol. Cell. 2005; 19: 111-122Abstract Full Text Full Text PDF PubMed Scopus (397) Google Scholar), another suggests that CypA, but not CypB and CypC, is critical for HCV replication (18Yang F. Robotham J.M. Nelson H.B. Irsigler A. Kenworthy R. Tang H. J. Virol. 2008; 82: 5269-5278Crossref PubMed Scopus (204) Google Scholar), and a third study suggests that three Cyps, CypA, B, and C, are all required for HCV replication (9Nakagawa M. Sakamoto N. Enomoto N. Tanabe Y. Kanazawa N. Koyama T. Kurosaki M. Maekawa S. Yamashiro T. Chen C.H. Itsui Y. Kakinuma S. Watanabe M. Biochem. Biophys. Res. Commun. 2004; 313: 42-47Crossref PubMed Scopus (208) Google Scholar). Thus, although it becomes evident that Cyps serve as HCV co-factors, their respective contributions and roles in the HCV life cycle remain to be determined. An understanding of the mechanisms that control the Cyp inhibitor-mediated anti-HCV effect is imperative because it will provide new alternate anti-HCV therapies and shed light on the still poorly understood early and late steps of the HCV life cycle. Huh7 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and antibiotics. CsA (Sigma) was prepared in dimethyl sulfoxide at 10 mg/ml and diluted in tissue culture medium for each experiment to 2.5 μm. Debio 025 (gift from Debiopharm, Lausanne, Switzerland) was prepared in ethanol at 10 mm and diluted further in tissue culture medium to 2 μm for each experiment. Ten micrograms of in vitro transcribed genomic Con1 RNA was electroporated into Huh-7 cells. At the indicated time points, intracellular HCV RNA was analyzed via reverse-transcription quantitative polymerase chain reaction and presented as genome equivalents/microgram total RNA as described previously (23Kapadia S.B. Brideau-Andersen A. Chisari F.V. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 2014-2018Crossref PubMed Scopus (375) Google Scholar). The primers for reverse-transcription quantitative polymerase chain reaction were: HCV, 5′-ATGGCGTTAGTATGAGTGTC-3′ (sense) and 5′-GGCATTGAGCGGGTTGATC-3′ (antisense); glyceraldehyde 3-phosphate dehydrogenase, 5′-GAAGGTGAAGGTCGGAGTC-3′ (sense), and 5′-GAAGATGGTGATGGGATTTC-3′ (antisense). Annealed duplex siRNA oligonucleotides contained a 3′-dTdT overhand (Qiagen). siRNA target sequences were: AAGGGTTCCTGCTTTCACAGA for CypA; AAGGTGGAGAGAGCACCAAGACA for CypB; GTGACATCACCACTGGAGATG for CypC; AACCTGCTAAATTGTGCGTTA for CypD; and AATTCTCCGAACGTGTCACGT for control. The cells were transfected with 100 nm siRNA using Lipofectamine 2000 (Invitrogen). For effect of siRNA Cyp knockdown on HCV RNA replication, the cells were transfected with siRNA Cyp and then retransfected 24 h later. An HIV-1-based lentiviral vector was used to express all Cyp shRNA as described previously (24Liu S. Asparuhova M. Brondani V. Ziekau I. Klimkait T. Schümperli D. Nucleic Acids Res. 2004; 32: 3752-3759Crossref PubMed Scopus (53) Google Scholar). The Cyp target sequences are the same as those indicated just above. Lentiviral particles production and transduction was conducted as described previously (24Liu S. Asparuhova M. Brondani V. Ziekau I. Klimkait T. Schümperli D. Nucleic Acids Res. 2004; 32: 3752-3759Crossref PubMed Scopus (53) Google Scholar). Generation of stable Cyp knockdown cell lines was obtained after 3 weeks under puromycin (1 μg/ml) selection. All of the cell lines were tested for mycoplasm contamination, which may nonspecifically interfere with HCV replication. To restore CypA expression in Huh7 CypA knockdown cells, a CypA cDNA bearing silent mutations that render it nontargetable by the CypA shRNA was subcloned into pcDNA3 with HindIII and NotI sites to generate pcDNA3- resistant wild-type CypA, which contains an N-terminal HA tag. Using pcDNA3-resistant wild-type CypA as template, we engineered two plasmids carrying either the H126Q (pcDNA3-resistant H126Q CypA) or the R55A (pcDNA3- resistant R55A CypA) mutation in the hydrophobic pocket of CypA that disallows its isomerase activity (25Zydowsky L.D. Etzkorn F.A. Chang H.Y. Ferguson S.B. Stolz L.A. Ho S.I. Walsh C.T. Protein Sci. 1992; 1: 1092-1099Crossref PubMed Scopus (257) Google Scholar). Parental or subgenomic HCV Con1-containing Huh7 cells (1 million) treated with or without siRNA or shRNA targeting Cyps were trypsinized and washed twice with 10 ml of sterile phosphate-buffered saline and lysed for 30 min on ice in 100 μl of lysis buffer (10 mm NaCl, 10 mm Tris, pH 7.4, 0.5% Nonidet P-40, 1× protease inhibitors). The lysates were cleared via centrifugation at 14,000 rpm for 10 min in a microcentrifuge. Supernatants (70 μl) were collected and protein concentration of cell lysates measured with a Coomassie-based Bio-Rad kit. The cell lysates were then subjected to Western blotting with antibodies to CypA (26Saphire A.C. Bobardt M.D. Gallay P.A. EMBO J. 1999; 18: 6771-6785Crossref PubMed Scopus (145) Google Scholar), CypB (Zymed Laboratories Inc.), CypC (Protein Tech Group, Inc.), CypD (Calbiochem), NS5A (ViroStat), and NS5B (Alexis Biochemicals). Amido Black staining of the membranes confirmed that the loading of samples had been properly normalized. The cellular expression of resistant wild-type, H126Q, or R55A CypA proteins was verified by Western blotting using anti-HA antibodies (The Scripps Research Institute (TSRI), Antibody Core Facility). For HIV-1 infection, Cyp knockdown Huh7 cells lines were infected with HIV-1-GFP (NL4.3 virus encoding the GFP gene and pseudotyped with the vesicular stomatitis virus G envelope protein) (generous gift from C. Aiken and D. Gabuzda). Forty-eight hours post-infection, intracellular GFP levels were quantified by FACS. For HSV-1 infection, Cyp knockdown Huh7 cells lines were infected with HSV-1-GFP (K26GFP virus encoding the GFP gene) (generous gift from P. Desai). Forty-eight hours post-infection, intracellular GFP levels were quantified by FACS. For Dengue infection, Cyp knockdown Huh7 cells lines were infected with Dengue-2 (Dengue-2 16681) (generous gift from R. Kinney). Dengue-2 infection was examined using an intracellular FACS staining assay (IFSA). Briefly, IFSA was conducted as described previously (27Kao C.L. Wu M.C. Chiu Y.H. Lin J.L. Wu Y.C. Yueh Y.Y. Chen L.K. Shaio M.F. King C.C. J. Clin. Microbiol. 2001; 39: 3672-3677Crossref PubMed Scopus (34) Google Scholar, 28Martin N.C. Pardo J. Simmons M. Tjaden J.A. Widjaja S. Marovich M.A. Sun W. Porter K.R. Burgess T.H. J. Virol. Methods. 2006; 134: 74-85Crossref PubMed Scopus (30) Google Scholar) with minor modifications. Three days post-infection, the cells were washed, trypsinized, resuspended in PBS at 1 × 106/ml, and fixed with 0.2% paraformaldehyde in PBS for 30 min on ice. The cells were washed, permeabilized in PBS containing 0.2% Tween for 15 min at 37 °C, washed, and resuspended in FACS buffer (PBS containing 2% fetal bovine serum). For intracellular staining, the cells (105) were incubated for 30 min at 4 °C with 10 μg/ml of isotype controls, mouse monoclonal anti-Dengue capsid 9A7 IgG (TSRI, Antibody Core Facility). Cell permeabilization was confirmed by staining cells with mouse anti-tubulin IgG (Santa Cruz Biotechnologies). The cells were washed, incubated with secondary phycoerythrin-conjugated anti-mouse IgG (10 μg/ml) for 30 min at 4 °C, washed again, resuspended in PBS, fixed in 2% paraformaldehyde, and stored at 4 °C until FACS analysis. For HCV replication, Cyp knockdown Huh7 cells lines were electroporated with 10 μg of in vitro transcribed genomic Con1 RNA. Seven days post-transfection, HCV infection was quantified by measuring intracellular NS5B levels by IFSA using anti-NS5B IgG (Alexis Biochemicals). CypA-HIV-1 Gag interaction was studied by examining the incorporation of host CypA into budding HIV-1 particles by Western blot. Briefly, HIV-1 particles were transiently expressed in Huh7 cells by GeneJuice (EMD Biosciences) transfection with a mixture of 5 μg of proviral HIV-1 (NL4.3) DNA together with 5 μg of CypA plasmids (pcDNA3-resistant wild-type, H126Q, and R55A plasmids). Viral supernatants, harvested 48 h post-transfection, were filtered through a 0.2-μm-pore size filter to remove cellular debris, pelleted through a sucrose cushion, standardized for HIV-1 capsid content by p24 enzyme-linked immunosorbent assay (Alliance, PerkinElmer), resuspended in 2× sodium dodecyl sulfate loading buffer, and subjected to Western blotting with antibodies directed against the HA tag. Parental Huh7 cells (3 million) were co-transfected with NS5B-Myc (5 μg of DNA) and wild-type CypA-HA or H126Q CypA-HA (5 μg of DNA) plasmids in the presence or absence of Debio 025 (2 μm). Three days post-transfection, the cells were collected and lysed. The cell lysates (1 ml) were precleared for 1 h with 20 μl of agarose beads. Co-immunoprecipitation procedures were conducted according to the manufacturer's instructions (Pierce HA tag IP/Co-IP kit). Bound material was eluted and analyzed by Western blotting using anti-HA and anti-Myc IgG (Santa Cruz Biotechnology). Previous studies suggested that at least three members of the Cyp family, CypA, CypB, and CypC, modulate HCV replication (9Nakagawa M. Sakamoto N. Enomoto N. Tanabe Y. Kanazawa N. Koyama T. Kurosaki M. Maekawa S. Yamashiro T. Chen C.H. Itsui Y. Kakinuma S. Watanabe M. Biochem. Biophys. Res. Commun. 2004; 313: 42-47Crossref PubMed Scopus (208) Google Scholar, 17Watashi K. Ishii N. Hijikata M. Inoue D. Murata T. Miyanari Y. Shimotohno K. Mol. Cell. 2005; 19: 111-122Abstract Full Text Full Text PDF PubMed Scopus (397) Google Scholar, 18Yang F. Robotham J.M. Nelson H.B. Irsigler A. Kenworthy R. Tang H. J. Virol. 2008; 82: 5269-5278Crossref PubMed Scopus (204) Google Scholar). We thus examined whether HCV exploits all of these Cyp members or rather a unique Cyp member to efficiently replicate in human hepatocytes. To address this issue, we knocked down each of these Cyps by transient siRNA interference and examined the effect of the Cyp knockdown on HCV replication. Specifically, Huh7 cells containing the subgenomic HCV Con1 replicon (genotype 1b) were transfected with siRNAs that target either luciferase (control siRNA), CypA (CypA siRNA), CypB (CypB siRNA), CypC (CypC siRNA), or CypD (CypD siRNA). To avoid siRNA toxicity, the cells were washed 24 h post-transfection. Seven days post-transfection, the cells were collected and lysed. To ensure that the siRNA treatments did not nonspecifically influence growth and viability of transfected hepatocytes, the cells were counted and analyzed for trypan blue uptake 7 days post-transfection. We exclusively analyzed the lysates of cells, which gave numbers of viable cells comparable with those of control siRNA-treated cells. The cell lysates were standardized for protein content and analyzed for Cyp content by Western blot using antibodies directed against CypA, CypB, CypC, or CypD. The expression of each Cyp was profoundly reduced by siRNAs Cyp compared with siRNA control (Fig. 1A), demonstrating the efficacy of the siRNA treatments. Moreover, siRNA Cyp treatments were specific because each siRNA Cyp treatment did not alter the expression of the other Cyps (Fig. 1A). For example, the siRNA, which targeted CypA, did not influence CypB, CypC, or CypD expression (Fig. 1A). Importantly, transient CypB, CypC, or CypD knockdown did not significantly influence HCV protein expression. Indeed, NS5A and NS5B levels in siRNA CypB-, CypC-, and CypD-treated hepatocytes were similar to those of control siRNA-treated cells (Fig. 1B), suggesting that these Cyps play no or a minor role in HCV protein expression. In sharp contrast, NS5A and NS5B levels were profoundly diminished in hepatocytes treated with the siRNA CypA (Fig. 1B), demonstrating that CypA, rather than CypB, CypC, and CypD, plays a major role in HCV protein expression. We then asked whether CypA, but not other Cyp members, is also critical for HCV RNA replication. To address this issue, naïve Huh7 cells were electroporated with in vitro transcribed genomic Con1 RNA. One day post-electroporation, the cells were transfected with control or siRNA Cyp as described above. Viral RNA replication was monitored for 8 days by analyzing intracellular HCV RNA via reverse-transcription quantitative polymerase chain reaction as described previously (23Kapadia S.B. Brideau-Andersen A. Chisari F.V. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 2014-2018Crossref PubMed Scopus (375) Google Scholar). We verified that the expression of CypA, CypB, CypC, and CypD was knocked down via the Cyp siRNA treatment 8 days post-electroporation (data not shown). We found that the HCV RNA replication in hepatocytes treated with siRNA CypC and CypD was comparable with that in siRNA control-treated cells, whereas the viral RNA replication in siRNA CypB was only slightly diminished (Fig. 1C). In contrast, viral RNA replication was profoundly attenuated in the siRNA CypA-treated cells (Fig. 1C). Altogether these data suggest that CypA, but not CypB, CypC, and CypD, represents an essential host factor for both HCV RNA replication and HCV protein expression. The introduction of siRNA into cultured cells provides a fast and efficient means of knocking down gene expression. However, siRNA has been shown to be effective for only short term gene inhibition in certain mammalian cells. Supporting this notion, we found that although Cyp expression was dramatically reduced 5–7 days after siRNA transfection, Cyp expression recovered 9 or 10 days post-siRNA transfection (data now shown). Even a slight rebound in Cyp protein expression may interfere with the interpretation of the data. To avoid this issue, we conducted experiments similar to those described above but using shRNA to stably silence Cyp gene expression. We constructed plasmids encoding shRNA that target CypA, CypB, or CypC. As above, we constructed as control a plasmid that encodes an shRNA that targets luciferase. Plasmids were packaged into HIV-1-based particles pseudotyped with the vesicular stomatitis virus G envelope to permit entry into and infection of hepatocytes. The advantage of using the HIV-1-based vector is that the DNA encoding the shRNA will be stably integrated into the host chromosomes of the hepatocytes. Parental Huh7 cells were exposed to the HIV-1-based particles for 24 h, cultured under puromycin selection for 3 or 4 weeks, and analyzed for Cyp content by Western blot. As expected, CypA, CypB, and CypC levels in shRNA Cyp-transduced cells were severely reduced compared with control shRNA-treated cells (Fig. 2A). We then tested the Cyp knockdown (KD) cell lines for their capacities to support HCV RNA replication as described above. Importantly, the HCV RNA replication was only profoundly reduced in the stable CypA-KD cell line (Fig. 2B), further suggesting that CypA, but not CypB, CypC, and CypD, is essential for HCV replication. It is important to note that we did not observe differences in growth between the cell lines (data not shown), suggesting that these particular Cyps do not play a significant role in Huh7 cell division and multiplication. To further demonstrate the specificity of the CypA requirement for HCV replication, CypA, CypB, and CypC knockdown and control cell lines were exposed to various viruses including HIV-1, HSV-1, the flavivirus Dengue and HCV. Infectivity was scored by measuring the intracellular levels of GFP for both HIV-1 and HSV-1, levels of capsid for Dengue, and levels of NS5B for HCV. GFP levels were significantly reduced in HIV-1-exposed CypA knockdown cells compared with control, CypB- and CypC-KD cells (Fig. 2C, top left panel). This is in accordance with previous studies suggesting that HIV-1 requires CypA to optimally infect human cells (29Franke E.K. Yuan H.E. Luban J. Nature. 1994; 372: 359-362Crossref PubMed Scopus (653) Google Scholar, 30Thali M. Bukovsky A. Kondo E. Rosenwirth B. Walsh C.T. Sodroski J. Göttlinger H.G. Nature. 1994; 372: 363-365Crossref PubMed Scopus (565) Google Scholar). All of the cell lines exposed to HSV-1 or Dengue expressed similar levels of GFP (HSV-1) and capsid (Dengue) (Fig. 2C, top right and bottom left panels, respectively), suggesting that HSV-1 and Dengue do no require any of these Cyps to infect human cells. Importantly, NS5B levels were dramatically reduced in the CypA knockdown cells compared with control, CypB and CypC knockdown cells (Fig. 2C). This further suggests that HCV, like HIV-1, specifically exploits CypA to infect and replicate in human cells, more specifically in hepatocytes. The peptide bond generally exists in two relatively stable isomeric forms: cis and trans (31Schiene C. Fischer G. Curr. Opin. Struct. Biol. 2000; 10: 40-45Crossref PubMed Scopus (175) Google Scholar). The ribosome synthesizes peptide bonds in the lower energy state trans peptide bond form, which is sterically favored, and whose side chains are 180 degrees opposite each other (32Hübner D. Drakenberg T. Forsén S. Fischer G. FEBS Lett. 1991; 284: 79-81Crossref PubMed Scopus (27) Google Scholar, 33Deleted in proofGoogle Scholar). However, bonds preceding each proline (peptidyl-prolyl bonds) also occur in the cis form in both unfolded and native proteins, with the side chains adjacent to each other (32Hübner D. Drakenberg T. Forsén S. Fischer G. FEBS Lett. 1991; 284: 79-81
Referência(s)