Phorbol Esters and Related Analogs Regulate the Subcellular Localization of β2-Chimaerin, a Non-protein Kinase C Phorbol Ester Receptor
2001; Elsevier BV; Volume: 276; Issue: 21 Linguagem: Inglês
10.1074/jbc.m011368200
ISSN1083-351X
AutoresMarı́a J. Caloca, Hongbin Wang, Andrew S. deLemos, Shaomeng Wang, Marcelo G. Kazanietz,
Tópico(s)Cancer Mechanisms and Therapy
ResumoThe novel phorbol ester receptor β2-chimaerin is a Rac-GAP protein possessing a single copy of the C1 domain, a 50-amino acid motif initially identified in protein kinase C (PKC) isozymes that is involved in phorbol ester and diacylglycerol binding. We have previously shown that, like PKCs, β2-chimaerin binds phorbol esters with high affinity in a phospholipid-dependent manner (Caloca, M. J., Fernandez, M. N., Lewin, N. E., Ching, D., Modali, R., Blumberg, P. M., and Kazanietz, M. G. (1997) J. Biol. Chem. 272, 26488–26496). In this paper we report that like PKC isozymes, β2-chimaerin is translocated by phorbol esters from the cytosolic to particulate fraction. Phorbol esters also induce translocation of α1 (n)- and β1-chimaerins, suggesting common regulatory mechanisms for all chimaerin isoforms. The subcellular redistribution of β2-chimaerin by phorbol esters is entirely dependent on the C1 domain, as revealed by deletional analysis and site-directed mutagenesis. Interestingly, β2-chimaerin translocates to the Golgi apparatus after phorbol ester treatment, as revealed by co-staining with the Golgi marker BODIPY-TR-ceramide. Structure relationship analysis of translocation using a series of PKC ligands revealed substantial differences between translocation of β2-chimaerin and PKCα. Strikingly, the mezerein analog thymeleatoxin is not able to translocate β2-chimaerin, although it very efficiently translocates PKCα. Phorbol esters also promote the association of β2-chimaerin with Rac in cells. These data suggest that chimaerins can be positionally regulated by phorbol esters and that each phorbol ester receptor class has distinct pharmacological properties and targeting mechanisms. The identification of selective ligands for each phorbol ester receptor class represents an important step in dissecting their specific cellular functions. The novel phorbol ester receptor β2-chimaerin is a Rac-GAP protein possessing a single copy of the C1 domain, a 50-amino acid motif initially identified in protein kinase C (PKC) isozymes that is involved in phorbol ester and diacylglycerol binding. We have previously shown that, like PKCs, β2-chimaerin binds phorbol esters with high affinity in a phospholipid-dependent manner (Caloca, M. J., Fernandez, M. N., Lewin, N. E., Ching, D., Modali, R., Blumberg, P. M., and Kazanietz, M. G. (1997) J. Biol. Chem. 272, 26488–26496). In this paper we report that like PKC isozymes, β2-chimaerin is translocated by phorbol esters from the cytosolic to particulate fraction. Phorbol esters also induce translocation of α1 (n)- and β1-chimaerins, suggesting common regulatory mechanisms for all chimaerin isoforms. The subcellular redistribution of β2-chimaerin by phorbol esters is entirely dependent on the C1 domain, as revealed by deletional analysis and site-directed mutagenesis. Interestingly, β2-chimaerin translocates to the Golgi apparatus after phorbol ester treatment, as revealed by co-staining with the Golgi marker BODIPY-TR-ceramide. Structure relationship analysis of translocation using a series of PKC ligands revealed substantial differences between translocation of β2-chimaerin and PKCα. Strikingly, the mezerein analog thymeleatoxin is not able to translocate β2-chimaerin, although it very efficiently translocates PKCα. Phorbol esters also promote the association of β2-chimaerin with Rac in cells. These data suggest that chimaerins can be positionally regulated by phorbol esters and that each phorbol ester receptor class has distinct pharmacological properties and targeting mechanisms. The identification of selective ligands for each phorbol ester receptor class represents an important step in dissecting their specific cellular functions. protein kinase C classical PKC novel PKC diacylglycerol GTPase-activating protein molecular dynamics phorbol 12-myristate 13-acetate polymerase chain reaction green fluorescent protein glutathioneS-transferase The phorbol ester tumor promoters are the most common tools for the activation of protein kinase C (PKC)1 in biological systems. These natural compounds exert a variety of effects in cells, which have been largely attributed to the calcium-dependent classical PKCs (cPKCα, βI, βII, and γ) or calcium-independent novel PKCs (nPKCδ, ε, η, and θ). Unlike cPKCs and nPKCs, the third class of PKC isozymes or atypical PKCs (aPKCζ and PKCλ/ι) is phorbol ester-unresponsive. Phorbol esters also target PKCμ (PKD), a kinase related to PKC that has unique substrate specificity and regulation (1Nishizuka Y. FASEB. J. 1995; 9: 484-496Crossref PubMed Scopus (2376) Google Scholar, 2Mellor H. Parker P.J. Biochem. J. 1998; 332: 281-292Crossref PubMed Scopus (1366) Google Scholar, 3Newton A.C. Curr. Opin. Cell Biol. 1997; 9: 161-167Crossref PubMed Scopus (852) Google Scholar, 4Ron D. Kazanietz M.G. FASEB. J. 1999; 13: 1658-1676Crossref PubMed Scopus (556) Google Scholar). The heterogeneity in the phorbol ester responses is probably related to the multiple phorbol ester receptors present in each cell type. An additional level of complexity in the phorbol ester responses is conferred by the unique pharmacological profile of each phorbol ester analog. In fact, ligands for PKCs not only include the typical diterpene phorbol esters but also a large number of unrelated structural analogs such as nonphorbol ester diterpenes (e.g. mezereins, octahydromezerein, and thymeleatoxin), macrocyclic lactones (e.g. bryostatins), and indole alkaloids (e.g. indolactams and teleocidins). The differential effects of phorbol ester analogs in cellular models suggest unique modes of interaction with different phorbol ester receptor classes and may explain the heterogeneous properties of the ligands (4Ron D. Kazanietz M.G. FASEB. J. 1999; 13: 1658-1676Crossref PubMed Scopus (556) Google Scholar, 5Blumberg P.M. Mol. Carcinog. 1991; 4: 339-344Crossref PubMed Scopus (128) Google Scholar, 6Kazanietz M.G. Caloca M.J. Eroles P. Fujii T. Garcia-Bermejo M.L. Reilly M. Wang H. Biochem. Pharmacol. 2000; 60: 1417-1424Crossref PubMed Scopus (69) Google Scholar, 7Kazanietz M.G. Mol. Carcinog. 2000; 28: 5-11Crossref PubMed Scopus (148) Google Scholar). One of the important novel concepts that has emerged in the past few years is that PKC isozymes are not the only receptors for the phorbol esters and related derivatives. In fact three novel families of phorbol ester receptors unrelated to PKCs have been isolated. These novel phorbol ester receptors, which lack a kinase domain in their structure, include the chimaerin isoforms, Caenorhabditis elegansUnc-13 and its mammalian homologs (Munc13 isoforms), and RasGRP. These proteins have in common a single copy of the C1 domain, a 50/51-amino acid motif that is duplicated in tandem in cPKC and nPKCs, which is the binding site for the phorbol esters and diacylglycerol (DAG) in these PKCs (4Ron D. Kazanietz M.G. FASEB. J. 1999; 13: 1658-1676Crossref PubMed Scopus (556) Google Scholar, 6Kazanietz M.G. Caloca M.J. Eroles P. Fujii T. Garcia-Bermejo M.L. Reilly M. Wang H. Biochem. Pharmacol. 2000; 60: 1417-1424Crossref PubMed Scopus (69) Google Scholar, 7Kazanietz M.G. Mol. Carcinog. 2000; 28: 5-11Crossref PubMed Scopus (148) Google Scholar). It has recently been reported that chimaerins, Unc-13, and RasGRP bind phorbol esters and related analogs with high affinityin vitro, thereby suggesting that a single copy of the C1 domain is sufficient to confer binding responsiveness. In all cases phorbol ester binding is phospholipid-dependent, and acidic phospholipids are the most efficient cofactors for reconstitution of binding (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 9Kazanietz M.G. Lewin N.E. Bruns J.D. Blumberg P.M. J. Biol. Chem. 1995; 270: 10777-10783Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 10Ebinu J.O. Bottorff D.A. Chan E.Y. Stang S.L. Dunn R.J. Stone J.C. Science. 1998; 280: 1082-1086Crossref PubMed Scopus (553) Google Scholar, 11Lorenzo P.S. Behshti M. Pettit G.R. Stone J.C. Blumberg P.M. Mol. Pharmacol. 2000; 57: 840-846PubMed Google Scholar). The identification of these "nonkinase" phorbol ester receptors suggests that phorbol esters and related analogs may regulate cellular pathways independently of the activation of PKC isozymes. Chimaerins are a novel family of phorbol ester receptors with Rac GTPase-activating protein (GAP) activity and therefore accelerate the hydrolysis of GTP to GDP leading to Rac inactivation. Chimaerins comprise at least four isozymes (α1- or n-, α2-, β1-, and β2-chimaerins) that are alternative spliced variants from the α- and β-chimaerin genes (14Hall C. Sin W.C. Teo M. Michael G.J. Smith P. Dong J.M. Lim H.H. Manser E. Spurr N.K. Jones T.A. Lim L. Mol. Cell. Biol. 1993; 13: 4986-4998Crossref PubMed Google Scholar, 15Leung T. How B.-E. Manser E. Lim L. J. Biol. Chem. 1993; 268: 3813-3816Abstract Full Text PDF PubMed Google Scholar, 16Leung T. How B.-E. Manser E. Lim L. J. Biol. Chem. 1994; 269: 12888-12892Abstract Full Text PDF PubMed Google Scholar). The C1 domain in chimaerin isozymes has ∼40% homology with those of PKC isozymes. Using the radioligand [3H]phorbol 12,13-dibutyrate, we have reported that β2-chimaerin is a high affinity receptor for phorbol esters in vitro (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Competition assays revealed that different ligands have unique patterns of recognition for different phorbol ester receptors. In fact, although DAGs and indolactams have similar affinities for PKCs and β2-chimaerin, thymeleatoxin (a mezerein analog) has ∼60 times less affinity for β2-chimaerin (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Therefore, it is likely that specific residues within individual C1 domains are critical for conferring binding specificity. Limited information is available on the ligand binding properties of these novel phorbol ester receptors. The regulation, localization, and function of the chimaerins are largely unexplored. One of the hallmarks for the activation of cPKCs and nPKCs by phorbol esters is their change in subcellular localization or "translocation." Translocation of PKC isozymes is a complex process that not only involves lipid-protein interactions mediated by the C1 domain and other motifs, but it is also dictated by protein-protein associations that may play a key role in determining function specificity for each PKC isozyme (12Jaken S. Parker P.J. Bioessays. 2000; 22: 245-254Crossref PubMed Scopus (234) Google Scholar, 13Mochly-Rosen D. Gordon A.S. FASEB. J. 1998; 12: 35-42Crossref PubMed Scopus (510) Google Scholar). The aim of this study is to investigate whether chimaerins are subject to subcellular redistribution or translocation by phorbol ester analogs. The results presented in this paper show that chimaerins are subject to subcellular translocation by phorbol ester derivatives. Using a series of deletion mutants of β2-chimaerin, we determined that translocation is entirely dependent on the ligand binding to the C1 domain. Interestingly, we found that upon stimulation with different analogs, β2-chimaerin translocates to the Golgi apparatus. These data indicate that the chimaerin family of phorbol ester receptors has unique ligand recognition properties and suggests that phorbol esters have the potential to regulate additional targets in addition to PKC isozymes. PMA, 4α-PMA, thymeleatoxin, (−)-octylindolactam V, 12-deoxyphorbol 13-phenyacetate, and GF 109203X were purchased from LC Laboratories (Woburn, MA). Bryostatin 1 was a kind gift from Dr. Peter M. Blumberg (NCI, National Institutes of Health). BODIPY-TR-ceramide was obtained from Molecular Probes, Inc. (Eugene, OR). Cell culture reagents and media were obtained from Life Technologies, Inc. COS-1 cells were cultured in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, 100 units/ml penicillin, and 100 μg/ml streptomycin at 37 °C in a humidified 5% CO2 atmosphere. A 1.4-kilobase XhoI-MluI fragment comprising the full-length β2-chimaerin was ligated into the mammalian expression vector pCR3ε to generate pCR3ε-β2-chimaerin, as we have previously described elsewhere (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). To generate a GFP construct for β2-chimaerin (pEGFP-β2-chimaerin), a 1.4-kilobaseEcoRI-EcoRI fragment was isolated from pCRII-β2-chimaerin (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar) and subcloned in-frame into the GFP plasmid pEGFP-C3 (CLONTECH; Ref. 17Caloca M.J. Garcı́a-Bermejo M.L. Blumberg P.M. Lewin N.L. Kremmer E. Mischak H. Wang S. Nacro K Bienfait B. Marquez V.E. Kazanietz M.G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11854-11859Crossref PubMed Scopus (94) Google Scholar). Deletion mutants of β2-chimaerin were generated by PCR using from pEGFP-β2-chimaerin as a template. The following oligonucleotides were used (EcoRI and SalI restriction sites are underlined): CATGAATTCATGCGTCTCCTCTCC and AGATGTCGACGGCAGTCATTGGGAAC (amino acids 1–262), for pEGFP-β2-N-C1; GAGGAATTCCACAACTTTAAGGTCC and AGATGTCGACGGCAGTCATTGGGAAC (amino acids 213–262), for pEGFP-β2-C1; GAGGAATTCCACAACTTTAAGGTCC and GCGCGTCGACATTAGAATAAAACGTCTTCG (amino acids 213–466), for pEGFP-β2-C1-GAP. The PCR products were ligated into pCRII using the TA cloning kit (Invitrogen). The correspondingEcoRI and SalI fragments were isolated and subcloned into the GFP plasmid pEGFP-C2 (CLONTECH). The construct pEGFP-β2-GAP was generated by PCR from pACG2T-β2-chimaerin (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar) using the following oligonucleotides: CGCACGCGTGAATAAAACGTCTTCGTTTTCTATTAA and AGCCTCCAGATGGTGGTAGACATATGCATTCGGGAA. The PCR product was ligated into pCRII, and a fragment comprising the GAP domain (amino acids 291–466) was isolated by digestion with EcoRI and ligated in frame into pEGFP-C2 to generate pEGFP-β2-GAP. To construct pEGFP-α1-chimaerin, the full-length cDNA for α1-chimaerin (18Areces L.B. Kazanietz M.G. Blumberg P.M. J. Biol. Chem. 1994; 269: 19553-19558Abstract Full Text PDF PubMed Google Scholar) was used as a template, and EcoRI and XhoI sites were created by PCR (restriction sites underlined), using the following oligonucleotides: CCGGAATTCATGCCATCCAAAGAGTCTTGGTC and CCGCTCGAGCTAAAATAAAATGTCTTC. The insert was ligated in frame into pEGFP-C2. β1-Chimaerin was isolated from human testis cDNA (CLONTECH) by PCR using the following oligonucleotides: GTCAGGCTCGAGGGATCCATGCTTTGCACGTCTCCCGTC (XhoI site underlined) and CGCACGCTGAAACAGAACATCTTCGTTTTCTATTAA. The β1-chimaerin cDNA was subcloned into pCRII vector, and aXhoI-EcoRI fragment from that plasmid was subcloned into pEGFP-C3 to generate pEGFP-β1-chimaerin. Generation of the mutant C246A-β2-chimaerin and the plasmid pEGFP-C246A-β2-chimaerin was described elsewhere (17Caloca M.J. Garcı́a-Bermejo M.L. Blumberg P.M. Lewin N.L. Kremmer E. Mischak H. Wang S. Nacro K Bienfait B. Marquez V.E. Kazanietz M.G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11854-11859Crossref PubMed Scopus (94) Google Scholar). In all cases, constructs were sequenced by the dideoxy chain termination method. Mammalian expression vectors for chimaerins or deletion mutants were transfected into COS-1 cells in 6-well plates using LipofectAMINE (Life Technologies, Inc.) according to the manufacturer's protocol. 48 h after transfection, cells were treated with different concentrations of phorbol ester analogs. Experiments were performed in the presence of the PKC inhibitor GF 109203X (5 μm), added 30 min before and during the incubation with the phorbol ester analogs, as we have previously described (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Cells were harvested into lysis buffer (50 mm Tris-HCl, pH 7.4, 5 mm EGTA, 5 μg/ml 4-(2-aminoethyl)-benzenesulfonyl fluoride, 5 μg/ml leupeptin, 5 μg/ml aprotinin, and 1 μg/ml pepstatin A) and lysed by sonication. Separation of cytosolic (soluble) and particulate fractions was performed by ultracentrifugation as described previously (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 17Caloca M.J. Garcı́a-Bermejo M.L. Blumberg P.M. Lewin N.L. Kremmer E. Mischak H. Wang S. Nacro K Bienfait B. Marquez V.E. Kazanietz M.G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11854-11859Crossref PubMed Scopus (94) Google Scholar). Equal amounts of protein (10 μg) for each fraction were subjected to SDS-polyacrylamide gel electrophoresis and transferred to nitrocellulose membranes that were immunostained with different antibodies. The following antibodies were used: anti-PKCα antibody (1:3,000; Upstate Biotechnology Inc., Lake Placid, NY), anti-β2-chimaerin antibody (1:1,000), and anti-GFP antibody (1:25,000). The intensity of the bands was determined by densitometry using a Scanner Control, version 1.00 (Molecular Dynamics, Inc., Sunnyvale, CA). Densitometric analysis was performed under conditions that yielded a linear response. COS-1 cells were transfected with the GFP expression vectors using FuGENE (Roche Molecular Biochemicals), according to the manufacturer's protocol. After 48 h, cells were treated with the phorbol ester analogs and fixed with 3.7% formaldehyde. Photomicrographs were taken with an Olympus fluorescent microscope. For staining of the Golgi network, COS-1 cells transfected with the GFP-expression vectors were incubated with BODIPY TR ceramide (2 μg/ml) for 30 min at 37 °C. After incubation, cells were washed twice with PBS and then treated with phorbol esters for 30 min. Cells were then washed and fixed with 3.7% formaldehyde. Slides were mounted using Vectashield and viewed with a Bio-Rad MRC-1024ES laser scanning confocal microscope. The confocal images were processed using Confocal AssistantTM, version 4.02. All the images shown are individual middle sections of projected Z series mounting. A newly developed q jumping molecular dynamics simulation method, which has been used to successfully predict the PKC-ligand receptor complex (19Pak Y. Wang S. J. Phys. Chem. B. 2000; 104: 354-359Crossref Scopus (63) Google Scholar), was used to predict the binding model of thymeleatoxin in complex with β2-chimaerin. The major advantage of this program is its ability to include both the ligand and receptor flexibility in the docking simulation. The q jumping algorithm has been implemented in the CHARMM program, as described previously (19Pak Y. Wang S. J. Phys. Chem. B. 2000; 104: 354-359Crossref Scopus (63) Google Scholar, 20Brooks B.R. Bruccoleri R.E. Olafson B.D. States D.J. Swaminathan S. Karplus M. J. Comput. Chem. 1993; 4: 187-217Crossref Scopus (14159) Google Scholar). The q jumping procedure was carried out using a CHARMM script. The CHARMM force field (21MacKerell Jr., A.D. Bashford D. Bellott M. Dunbrack Jr., R.L. Evanseck J.D. Field M.J. Fisher S. Gao J. Guo H. Ha S. Joseph-McCarthy D. Kuchnir L. Kuczera K. Lau F.T.K. Mattos C. Michnick S. Ngo T. Nguyen D.T. Prodhom B. Reiher III, W.E. Roux B. Schlenkrich M. Smith J.C. Stote R. Straub J. Watanabe M Wiorkiewicz-Kuczera J. Yin D. Karplus M. J. Phys. Chem. B. 1998; 102: 3586-3616Crossref PubMed Scopus (12008) Google Scholar) was used to describe the structure of the receptor, and all the necessary parameters for thymeleatoxin were generated by using the QUANTA program (Molecular Simulations Inc., San Diego, CA). The three-dimensional structure of β2-chimaerin C1 domain was modeled based upon the x-ray structure of PKCδ C1b, as described previously (17Caloca M.J. Garcı́a-Bermejo M.L. Blumberg P.M. Lewin N.L. Kremmer E. Mischak H. Wang S. Nacro K Bienfait B. Marquez V.E. Kazanietz M.G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11854-11859Crossref PubMed Scopus (94) Google Scholar, 22Zhang G. Kazanietz M.G. Blumberg P.M. Hurley J.H. Cell. 1995; 81: 917-924Abstract Full Text PDF PubMed Scopus (610) Google Scholar). Starting from the phorbol 13-acetate structure in the x-ray crystal data (22Zhang G. Kazanietz M.G. Blumberg P.M. Hurley J.H. Cell. 1995; 81: 917-924Abstract Full Text PDF PubMed Scopus (610) Google Scholar), the initial conformation of thymeleatoxin was generated by QUANTA. All the appropriate hydrogen atoms were added to the ligand and minimized. In the docking simulation, the ligand was allowed to be fully flexible, and all the side chains of the residues 8–12 and 20–27, which form the ligand binding site in β2-chimaerin, were allowed to be flexible; everything else in the receptor was fixed in our docking simulation. Then, the MD simulations described above were carried out in vacuum, using the following q jumping parameters: q = 1.02–1.03, ε = 800 andPJ = 0.1. The q jumping MD simulations were carried out at T = 300 K, using the constant temperature algorithm of Berendsen et al. (23Berendsen H.J.C. Postma J.P.M. van Gunsteren W.F. Di Nola A. Haak J.R. J. Chem. Phys. 1984; 81: 3684-3690Crossref Scopus (24707) Google Scholar). The SHAKE algorithm (24Ryckaert J.P. Ciccotti G. Berendsen H.J.C. J. Comput. Phys. 1977; 23: 327-341Crossref Scopus (17656) Google Scholar) was used to fix all the bonds containing hydrogen with a time step of 1 fs. For energy evaluations, a distance-dependent dielectric model was employed with the nonbonding interactions truncated at 8 Å. Finally nuclear Overhauser effect constraints consisting of a central atom of the ligand, and each α-carbon atom in the β2-chimaerin residues 10 and 24 was introduced to prevent the ligand from escaping from the binding site completely. With the MD protocol, we performed several independent MD runs for 1–2 ns, and the binding mode was determined from the lowest minimum energy conformation from each of the MD trajectories. Then, the resulting complex structures were further refined by a minimization consisting of 5000 steps of adopted Newton-Raphson method. To determine GTPase activity of β2-chimaerin, recombinant purified Rac was first incubated at 30 °C for 10 min with [γ-32P]GTP (60 μCi/nmol; Amersham Pharmacia Biotech) in loading buffer (50 mm Tris-HCl, pH 7.5, 50 mm NaCl, 0.1 mm dithiothreitol, and 0.5 μmMgCl2). The loading reaction was stopped by the addition of MgCl2 (final concentration, 10 mm). Purified β2-chimaerin (expressed in Sf9 cells) was then incubated with loaded Rac in reaction buffer (50 mm Tris-HCl, pH 7.5, 0.1 mm dithiothreitol, 10 mm MgCl2, 1 mg/ml bovine serum albumin, 1 mm GTP) at 15 °C, and Rac GTPase activity was determined in filters by measuring the reduction in Rac-bound radioactivity (25Garrett M.D. Self A.J. van Oers C. Hall A. J. Biol. Chem. 1989; 264: 10-13Abstract Full Text PDF PubMed Google Scholar). To determine the effect of phospholipids on GAP activity, purified β2-chimaerin was preincubated with 100 μg/ml of phospholipids (variable proportions of phosphatidylserine, and the remaining lipid is neutral phosphatidylcholine) for 45 min at 30 °C in reaction buffer, prior to adding the loaded Rac. Experiments were performed in duplicate. In general, duplicate determinations differed by <10%. Expression and purification of recombinant β2-chimaerin from Sf9 cells is described elsewhere (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). COS-1 cells were co-transfected with pCR3ε-β2-chimaerin and pEBG-Rac (a mammalian expression vector for GST-Rac) or pEBG (empty vector for expression of GST alone). pEBG vectors were a kind gift of Dr. Margaret M. Chou (University of Pennsylvania School of Medicine). 48 h after transfection cells were treated with GF 109203X (5 μm) for 30 min and then for 1 h with PMA (3 μm). After treatment, cells were harvested into lysis buffer (50 mm Tris-HCl, pH 7.4, 1% Nonidet P-40, 5 mm MgCl2, 0.1 mm dithiothreitol, 5 μg/ml 4-(2-aminoethyl)-benzenesulfonyl fluoride, 5 μg/ml leupeptin, 5 μg/ml aprotinin, and 1 μg/ml pepstatin A), and the lysates were then incubated with glutathione-Sepharose 4B beads (Amersham Pharmacia Biotech) for 2 h at 4 °C. Beads were extensively washed with lysis buffer, resuspended in Laemmli's sample buffer, and boiled. Samples were subjected to 12% SDS-polyacrylamide gel electrophoresis, transferred to nitrocellulose membranes, and then probed with anti-β2-chimaerin antibody (1:1000). Aliquots of total lysates were also probed with an anti-β2-chimaerin antibody (1:1000) and an anti-GST antibody (Amersham Pharmacia Biotech; 1:1,000). We have previously shown that β2-chimaerin, a RacGAP protein, is a high affinity phorbol ester receptor. Our previous work revealed that β2-chimaerin binds [3H]phorbol 12,13-dibutyrate in a phospholipid-dependent fashion with an affinity that is in the same range as cPKCs and nPKCs (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). Cells were transfected with the mammalian expression vector pCR3ε-β2-chimaerin, and high levels of expression of β2-chimaerins were observed 48 h later, as judged by Western blot analysis and by assessing phorbol ester binding levels (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). To assess the effects of phorbol esters on the subcellular distribution of β2-chimaerin, cells were treated with PMA and then subjected to subcellular fractionation. The levels of β2-chimaerin in soluble (cytosolic) and particulate fraction were then determined by Western blot. These experiments were carried out in the presence of the PKC inhibitor GF 109203X (5 μm) to rule out any involvement of PKCs in the effect of phorbol esters, as we have previously described (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 17Caloca M.J. Garcı́a-Bermejo M.L. Blumberg P.M. Lewin N.L. Kremmer E. Mischak H. Wang S. Nacro K Bienfait B. Marquez V.E. Kazanietz M.G. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11854-11859Crossref PubMed Scopus (94) Google Scholar). Fig. 1 shows that PMA induced translocation of β2-chimaerin from the soluble to the particulate fraction in a dose-dependent manner. A GFP fusion construct for β2-chimaerin was also generated and responds to PMA in a similar fashion as the nonfused construct, suggesting that, as previously described for PKC isozymes (26Ohmori S. Shirai Y. Sakai N. Fujii M. Konishi H. Kikkawa U. Saito N. Mol. Cell. Biol. 1998; 18: 5263-5271Crossref PubMed Google Scholar, 27Feng X. Zhang J. Barak L.S. Meyer T. Caron M.G. Hannun Y.A. J. Biol. Chem. 1998; 273: 10755-10762Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 28Wang Q.J. Bhattacharyya D. Garfield S. Nacro K. Marquez V.E. Blumberg P.M. J. Biol. Chem. 1999; 274: 37233-37239Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar, 29Wang Q.J. Fang T.W. Fenick D. Garfield S. Bienfait B. Marquez V.E. Blumberg P.M. J. Biol. Chem. 2000; 275: 12136-12146Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar), the GFP tag does not affect responsiveness to phorbol esters. As expected, nonfused GFP protein was unresponsive to PMA. Phorbol ester derivatives and related analogs have unique binding properties for discrete PKC isozymes, and recent studies have shown that different derivatives have differential properties for translocating PKC isozymes (28Wang Q.J. Bhattacharyya D. Garfield S. Nacro K. Marquez V.E. Blumberg P.M. J. Biol. Chem. 1999; 274: 37233-37239Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar, 29Wang Q.J. Fang T.W. Fenick D. Garfield S. Bienfait B. Marquez V.E. Blumberg P.M. J. Biol. Chem. 2000; 275: 12136-12146Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar). Our previous in vitrostudies on structure-activity analysis revealed striking differences in binding potency between β2-chimaerin and PKC isozymes. In fact, although phorbol esters and 12-deoxyphorbol esters have ∼10-fold lower affinity for β2-chimaerin than for PKCα, indole alkaloids (indolactams) have similar binding potency, and mezerein derivatives such as the tumor promoter thymeleatoxin show ∼60-fold less affinity for β2-chimaerin (8Caloca M.J. Fernandez M.N. Lewin N.E. Ching D. Modali R. Blumberg P.M. Kazanietz M.G. J. Biol. Chem. 1997; 272: 26488-26496Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar). To explore the structure-activity for translocation of β2-chimaerin, we investigated the effect of four different analogs on the subcellular redistribution of this novel receptor and compared it with PKCα (Fig.2). The macrocyclic lactone bryostatin 1, an analog with an atypical spectrum of biological responses compared with the typical phorbol esters, was
Referência(s)