CELF6, a Member of the CELF Family of RNA-binding Proteins, Regulates Muscle-specific Splicing Enhancer-dependent Alternative Splicing
2004; Elsevier BV; Volume: 279; Issue: 17 Linguagem: Inglês
10.1074/jbc.m310687200
ISSN1083-351X
AutoresAndrea N. Ladd, Nicole H. Nguyen, Kavin Malhotra, Thomas A. Cooper,
Tópico(s)RNA modifications and cancer
ResumoWe previously described a family of five RNA-binding proteins: CUG-binding protein, embryonic lethal abnormal vision-type RNA-binding protein 3, and the CUG-binding protein and embryonic lethal abnormal vision-type RNA-binding protein 3-like factors (CELFs) 3, 4, and 5. We demonstrated that all five of these proteins specifically activate exon inclusion of cardiac troponin T minigenes in vivo via muscle-specific splicing enhancer (MSE) sequences. We also predicted that a sixth family member, CELF6, was located on chromosome 15. Here, we describe the isolation and characterization of CELF6. Like the previously described CELF proteins, CELF6 shares a domain structure containing three RNA-binding domains and a divergent domain of unknown function. CELF6 is strongly expressed in kidney, brain, and testis and is expressed at very low levels in most other tissues. In the brain, expression is widespread and maintained from the fetus to the adult. CELF6 activates exon inclusion of a cardiac troponin T minigene in transient transfection assays in an MSE-dependent manner and can activate inclusion via multiple copies of a single element, MSE2. These results place CELF6 in a functional subfamily of CELF proteins that includes CELFs 3, 4, and 5. CELF6 also promotes skipping of exon 11 of insulin receptor, a known target of CELF activity that is expressed in kidney. We previously described a family of five RNA-binding proteins: CUG-binding protein, embryonic lethal abnormal vision-type RNA-binding protein 3, and the CUG-binding protein and embryonic lethal abnormal vision-type RNA-binding protein 3-like factors (CELFs) 3, 4, and 5. We demonstrated that all five of these proteins specifically activate exon inclusion of cardiac troponin T minigenes in vivo via muscle-specific splicing enhancer (MSE) sequences. We also predicted that a sixth family member, CELF6, was located on chromosome 15. Here, we describe the isolation and characterization of CELF6. Like the previously described CELF proteins, CELF6 shares a domain structure containing three RNA-binding domains and a divergent domain of unknown function. CELF6 is strongly expressed in kidney, brain, and testis and is expressed at very low levels in most other tissues. In the brain, expression is widespread and maintained from the fetus to the adult. CELF6 activates exon inclusion of a cardiac troponin T minigene in transient transfection assays in an MSE-dependent manner and can activate inclusion via multiple copies of a single element, MSE2. These results place CELF6 in a functional subfamily of CELF proteins that includes CELFs 3, 4, and 5. CELF6 also promotes skipping of exon 11 of insulin receptor, a known target of CELF activity that is expressed in kidney. Alternative splicing allows the production of multiple mRNA species from a single gene, which often give rise to functionally distinct protein isoforms. Regulation of alternative splicing not only produces multiple mRNAs but can also modulate the levels of these different isoforms in a tissue- or developmental stage-specific manner to meet the functional needs of the cell. Numerous examples of regulated alternative splicing have been found, but few regulatory factors that control cell-specific alternative splicing have been identified. In the best-characterized vertebrate experimental systems, alternative splicing regulation is the result of dynamic antagonism between trans-acting factors binding to positive or negative elements in the pre-mRNA and promoting or repressing the use of alternative splice sites. Some of these elements bind cell-specific splicing factors. For example, neuron-specific inclusion of alternative exons in several pre-mRNAs is mediated by binding of the activator Nova-1, which is expressed only in neurons. This neuron-specific activity is antagonized by binding of the ubiquitously expressed repressor polypyrimidine tract-binding protein (PTB) in non-neuronal cells (1Grabowski P.J. Black D.L. Prog. Neurobiol. 2001; 65: 289-308Crossref PubMed Scopus (282) Google Scholar). The muscle-specific alternative exon 5 of cardiac troponin T (cTNT) 1The abbreviations used are: cTNT, cardiac troponin T; CUG-BP, CUG-binding protein; ETR-3, embryonic lethal abnormal vision-type RNA-binding protein 3; CELF, CUG-BP and ETR-3-like factor; MSE, muscle-specific splicing enhancer; UTR, untranslated region; IR, insulin receptor; ORF, open reading frame; RRM, RNA recognition motif; DM, myotonic dystrophy; EST, expressed sequence tag; RNP, ribonucleoprotein; PTB, polypryimidine tract-binding protein. is also regulated by antagonistic activities. Muscle-specific splicing enhancers (MSEs) in cTNT pre-mRNAs regulate inclusion of exon 5 in striated muscle by binding to activators and repressors of splicing. Negative elements within MSEs upstream and downstream of exon 5 repress exon inclusion in non-muscle cells by binding PTB (2Charlet-B N. Logan P. Singh G. Cooper T. Mol. Cell. 2002; 9: 649-658Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar). This repression is antagonized in muscle cells by positive elements within MSEs downstream of exon 5 that bind members of the CUG-binding protein (CUG-BP) and embryonic lethal abnormal vision-type RNA-binding protein 3 (ETR-3)-like factor (CELF) family, promoting exon inclusion (2Charlet-B N. Logan P. Singh G. Cooper T. Mol. Cell. 2002; 9: 649-658Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar). We previously described five members of the CELF family, all of which activated MSE-dependent exon inclusion of cTNT minigenes in fibroblasts (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar). Expression of CELF proteins is widespread, although individual members are preferentially expressed in different cell types and developmental stages (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar). Disruption of CELF function may play a role in disease states. CUG-BP has been implicated in the pathogenesis of myotonic dystrophy (4Timchenko L.T. Miller J.W. Timchenko N.A. Devore K.V. Lin L.J. Roberts R. Caskey C.T. Swanson M.S. Nucleic Acids Res. 1996; 24: 4407-4414Crossref PubMed Scopus (400) Google Scholar), a neuromuscular disease caused by expansion of an unstable CTG repeat in the 3′-untranslated region (UTR) of the DMPK gene (5Brook J. Mccurrach M. Harley H. Buckler A. Church D. Aburatani H. Hunter K. Stanton V. Thirion J. Hudson T. Sohn R. Zemelman B. Snell R. Rundle S. Crow S. Davies J. Shelbourne P. Buxton J. Jones C. Juvonen V. Johnson K. Harper P. Shaw D. Housman D. Cell. 1992; 68: 799-808Abstract Full Text PDF PubMed Scopus (2133) Google Scholar, 6Fu Y. Pizzuti A. Fenwick R. King J. Rajnarayan S. Dunne P. Dubel J. Nasser G. Ashizawa T. Dejong P. Wieringa B. Korneluk R. Perryman M. Epstein H. Caskey C. Science. 1992; 255: 1256-1258Crossref PubMed Scopus (1296) Google Scholar, 7Mahadevan M. Tsilfidis C. Sabourin L. Shutler G. Amemiya C. Jansen G. Neville C. Narang M. Barcelo J. Ohoy K. Leblond S. Earlemacdonald J. Dejong P. Wieringa B. Korneluk R. Science. 1992; 255: 1253-1255Crossref PubMed Scopus (1477) Google Scholar) or a CCTG repeat in the first intron of the ZNF9 gene (8Liquori C. Ricker K. Moseley M. Jacobsen J. Kress W. Naylor S. Day J. Ranum L. Science. 2001; 293: 864-867Crossref PubMed Scopus (1029) Google Scholar). The splicing of targets of CUG-BP is misregulated in myotonic dystrophy and contributes to insulin resistance (9Savkur R. Phillips A. Cooper T. Nat. Genet. 2001; 29: 40-47Crossref PubMed Scopus (660) Google Scholar) and myotonia (10Charlet-B N. Savkur R. Singh G. Philips A. Grice E. Cooper T. Mol. Cell. 2002; 10: 45-53Abstract Full Text Full Text PDF PubMed Scopus (515) Google Scholar), two clinical manifestations of the disease. Another CELF family member, ETR-3, has also recently been implicated in the misregulation of splicing in Duchenne and Becker muscular dystrophies (11Sironi M. Cagliani R. Comi G. Pozzoli U. Bardoni A. Giorda R. Bresolin N. FEBS Lett. 2003; 537: 30-34Crossref PubMed Scopus (17) Google Scholar) and is a candidate gene for defects associated with partial monosomy 10p (12Lichtner P. Attié-Bitach T. Schuffenhauer S. Henwood J. Bouvagnet P. Scambler P. Meitinger T. Vekemans M. J. Mol. Med. 2002; 80: 431-442Crossref PubMed Scopus (38) Google Scholar) and familial arrhythmogenic right ventricular dysplasia (13Li D. Bachinski L. Roberts R. Genomics. 2001; 74: 396-401Crossref PubMed Scopus (36) Google Scholar). Thus, CELF proteins are important regulators of cell-specific alternative splicing during normal development and disease. Here we describe a sixth member of the CELF family, CELF6. CELF6 is preferentially expressed in kidney, testis, and brain. Like the previously described CELF proteins, CELF6 activates exon inclusion in fibroblasts via MSEs in transient transfection assays. CELF6 can also activate inclusion via multiple copies of a single element, MSE2, placing it in a functional subfamily of CELF proteins that includes CELFs 3, 4, and 5. Finally, CELF6 promotes skipping of exon 11 in insulin receptor (IR), another known target of CELF activity. Identification and Analysis of CELF6 Sequence—CELF6 was first identified in cosmids from chromosome 15 (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar) and predicted from high throughput genomic sequence (Ref. 14Good P. Chen Q. Warner S. Herring D. J. Biol. Chem. 2000; 275: 28583-28592Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar; GenBank™ accession number AF401233). CELF6 cDNAs were amplified by polymerase chain reaction (PCR) from human adult brain cDNA (Clontech) as described previously (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar). Primer sequences were ATCATTTGGATCCATGGCCGCGGCGCCGGGAGGGT and AATCGATCTCGAGTCAGTAAGGCCGGTTGGCATCC. PCR products were cloned into the pcDNA3.1HisC vector (Invitrogen) in-frame with the N-terminal Xpress epitope tag, and sequences were confirmed by overlapping reads of both strands. Sequence profile and phlyogenetic analyses were performed as described previously (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar). Northern and Dot Blots—Commercial Northern and RNA dot blots (Clontech) were hybridized against a CELF6 3′-UTR probe generated by PCR from human adult brain cDNA (Clontech) using the primers TGACCTGCTTTCACTGACCAG and AGTCCTTTGGTCCCTAAACTC. 3′-UTR probes were likewise generated for CELF3 (GTCTGGAGATCCCAGAGGAAG and AAACCCCTAATGTGGGGAAGA), CELF4 (ACGCCAATCGCCCGTACTGAG and CATCTTCTTCTTCATGTCATATATATT), and CELF5 (TGTCCTCCATCCCCCGTTTCTGTT and TAAATCACCATCGCTGTCGTC). The PCR products were cloned into the pCR-Blunt II-TOPO plasmid using the ZeroBlunt TOPO Cloning kit (Invitrogen), cut with EcoRI, and gel isolated using the Qiaquick Gel Extraction Kit (Qiagen). CUG-BP was subcloned into the pcDNA3.1(+) vector (Invitrogen) from a CUG-BP/Nab50 plasmid provided by L. Timchenko (Baylor College of Medicine), and a 3′-UTR probe was excised with HincII and BstBI. ETR-3 was cloned into the pcDNA3.1(+) vector from a phage clone provided by Dr. C. C. Liew (University of Toronto, Toronto, Ontario, Canada), and a 3′-UTR probe was excised with PvuII and NotI. Probes were end-labeled using Random Primed Labeling Kit (Amersham Biosciences). Hybridization was performed at 68 °C in Express Hyb solution (Ambion). Cotransfection Experiments—R35C, RTBPSRAX, and M2/M2TB minigenes have been described previously (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar, 15Cooper T.A. Mol. Cell. Biol. 1998; 18: 4519-4525Crossref PubMed Scopus (43) Google Scholar). IR minigenes have been described previously (16Kosaki A. Nelson J. Webster N.J.G. J. Biol. Chem. 1998; 273: 10331-10337Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar) and were used previously to demonstrate regulation of IR alternative splicing by CUG-BP (9Savkur R. Phillips A. Cooper T. Nat. Genet. 2001; 29: 40-47Crossref PubMed Scopus (660) Google Scholar). QT35 quail fibroblasts were plated at a density of 1.8 × 106 cells/60-mm-diameter tissue culture dish in 3 ml of medium (F10 medium supplemented with 5% fetal bovine serum, 1% chick serum, 10% tryptose phosphate, and 2 mml-glutamine) and cultured overnight at 37 °C in 5% CO2. COS-M6 cells were plated in 3 ml of high-glucose DMEM supplemented with 10% fetal bovine serum and 2 mml-glutamine. Cells were transfected with 100 ng of minigene DNA, 0-3 μg of CELF6 expression plasmid, and carrier DNA to 3.1 μg of total DNA using FuGENE 6 (Roche Applied Science). Total RNA and protein were harvested 48 h after transfection and subjected to reverse transcription-PCR and Western blotting as described previously (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar), except that the amount of oligo(dT)12-18 primer used to produce cDNA was increased to 100-300 ng/reaction. Statistical Analysis—The mean values for the extent of exon inclusion accompanying each dose of CELF6 expression plasmid were compared with the means of values obtained from the minigenes alone using a two-tailed pooled t test assuming a normal distribution. This test also assumes that the population variances are equal; to confirm that this assumption was valid, preliminary F tests were conducted where the α level was set at α = 0.2. Identification of CELF6 —We previously reported the identification of a family of five RNA-binding proteins called CELF proteins. We identified a sixth family member, CELF6, as homologous segments in cosmid sequences from chromosome 15, but no corresponding expressed sequence tags (ESTs) were available at that time (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar). CELF6 (also called BRUNOL6) was also predicted from conceptual translation of a potential cDNA derived from high throughput genomic sequence (14Good P. Chen Q. Warner S. Herring D. J. Biol. Chem. 2000; 275: 28583-28592Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). To obtain the actual coding region of CELF6, we amplified full-length CELF6 from human brain cDNA by PCR using primers that contained the predicted start and stop codons based on our analysis of chromosome 15 cosmid sequences. We used the sequences of the four different cDNAs obtained (Fig. 1B) to BLAST updated EST data bases and aligned our sequences, the matching ESTs, and human genomic sequence to determine the exon structure for CELF6 (Fig. 1A). CELF6 is composed of 14 exons, including a novel exon (exon 3) not previously predicted. Coding sequence ends less than 30 nucleotides upstream of the exon 13-exon 14 junction, and most of the CELF6 3′-UTR lies within exon 14. Four CELF6 open reading frames (ORFs) generated by alternative splicing were identified (Fig. 1B). Translation of ORF1 gives rise to a full-length CELF protein that matches previously reported predicted translations (GenBank™ accession numbers AF401233 and AF425606). The domain structure of CELF6 is the same as that of other CELF family members (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar): three RNP-containing RNA recognition motifs (RRMs) and a 268-amino acid divergent domain separating RRM2 and RRM3. CELF6 also possesses numerous potential phosphorylation sites, a potential nuclear localization signal at the C terminus, and an alanine-rich region within the divergent domain. By retention of an intron, inclusion of an alternative exon, or use of an alternative splice site in exon 9, ORFs 2-4 contain upstream termination codons (Fig. 1B). The retention of intron 5 in ORF2, which is otherwise identical to ORF1, introduces a frameshift that truncates RRM2 upstream of RNP1, one of two highly conserved sequences required for the RNA binding activity of RRMs (17Burd C. Dreyfuss G. Science. 1994; 265: 615-621Crossref PubMed Scopus (1752) Google Scholar). ORF3 skips exon 10 but includes an upstream exon (exon 3) that contains an in-frame stop codon. ORF4 lacks exon 11 and uses an alternative 3′ splice site in exon 9 that introduces an upstream frameshift, altering the C-terminal portion of the divergent domain and removing RRM3. Previous comparative analysis of human CELF proteins suggested that the CELF family can be divided into two subfamilies, the first containing CUG-BP and ETR-3 and the second containing CELFs 3, 4, and 5 (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar). To determine how CELF6 is related to other CELF proteins, we compared full-length CELF6 (ORF1) with the other members of the CELF family (Fig. 2). CELF6 is more closely related to CELFs 3, 4, and 5 than CUG-BP and ETR-3, indicating that it falls within the second subfamily of CELF proteins. CELF6 and Other Members of the CELF Family Are Broadly Expressed—To examine the expression of CELF6, commercial Northern blots containing RNAs from adult human tissues were hybridized against a 3′-UTR probe. As shown in Fig. 3, CELF6 is preferentially expressed in kidney and brain. A large mRNA of approximately 7.5 kilobases (kb) is abundant in kidney, whereas a smaller mRNA of approximately 4 kb is expressed in brain and at lower levels in kidney. Both of these mRNA isoforms are detectable at very low levels in several other tissues. The differentially spliced regions in ORFs 1-4 are not large enough to explain the difference in size between the two CELF6 mRNA isoforms seen by Northern blotting. Size differences of this magnitude between different mRNA isoforms are usually attributable to differences in polyadenylation. Indeed, there are numerous human CELF6 ESTs that contain 3′-UTR sequences that extend beyond the polyadenylated 3′ end of the published CELF6 mRNA sequence (GenBank™ accession number AF401233), suggesting that a downstream polyadenylation site is sometimes used. To examine CELF6 expression in more detail, a commercial RNA dot blot containing a greater variety of human adult as well as fetal tissues was hybridized with the 3′-UTR probe (Fig. 4A). This blot confirmed that the highest levels of CELF6 expression are in adult kidney, brain, and testis. Low levels were observed in most other tissues, although expression was not detected in several cell lines. Within the brain, CELF6 expression is widespread, being observed in all regions of the brain tested (see Fig. 4A: 1, A-H; 2, A-H; and 3, B and C). In fetal tissues, CELF6 expression was highest in brain but was also detectable in kidney, although at levels lower than those seen in the adult. To develop profiles of CELF mRNA expression in these tissues, the CELF6 dot blot was compared with those of the five other CELF family members (Ref. 3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar (data not shown) and Fig. 4B herein). Like CELF6, CUG-BP, ETR-3, and CELF4 are broadly expressed. CUG-BP is strongly expressed in all adult and fetal tissues tested. ETR-3 is detectable in all tissues at some level, but ETR-3 expression is highest in brain, heart, and thymus. CELF4 is highly expressed throughout the brain and in glandular tissues; moderately expressed in heart, skeletal muscle, and liver; and detectable at very low levels in all other tissues tested. CELF3 and CELF5 are restricted to brain, where they are expressed at varying levels in different regions (see Fig. 4B: A, 1-8; B, 1-6; D, 4; and G, 1). The patterns of CELF3 and CELF5 expression are nearly identical, except in pituitary gland, where CELF3 is strongly expressed, whereas CELF5 is almost undetectable. CELF6 Positively Regulates MSE-dependent Splicing in Vivo—We have shown previously that members of the CELF family bind to MSEs and activate cTNT exon inclusion in an MSE-dependent manner (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar). To determine whether the different ORFs of CELF6 can mediate cTNT exon inclusion, the four CELF6 ORFs were subcloned into expression vectors and cotransfected with the R35C minigene into QT35 quail fibroblast cells. R35C contains a heterologous alternative exon flanked by cTNT MSEs 1-4 and gives rise to predominantly exon-skipped mRNAs in fibroblasts, although exon inclusion is promoted in the presence of exogenous (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar) or endogenous (2Charlet-B N. Logan P. Singh G. Cooper T. Mol. Cell. 2002; 9: 649-658Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar) CELF proteins. Western blots probed with antibodies against the N-terminal epitope tag confirmed that ORF1, ORF2, and ORF4 constructs all expressed proteins of the expected sizes; ORF3 was not detected at any dose on Western blots (Fig. 5). The ORF3 expression construct was confirmed by sequencing both strands; therefore, we conclude that the expressed protein is unstable. All three of the CELF6 ORFs that expressed detectable protein increased the level of exon inclusion in a dose-dependent manner (Fig. 5A). ORF3 did not affect the level of exon inclusion, consistent with the absence of detectable protein. To determine whether enhanced exon inclusion by CELF6 is MSE-dependent, the CELF6 expression plasmids were cotransfected with the RTBPSRAX minigene containing the same alternative exon flanked by human β-globin intron 1 sequences that lack MSEs. None of the ORFs significantly enhanced exon inclusion in the absence of MSEs (Fig. 5B). CELF6 Promotes Exon Inclusion via MSE2 Alone—CELFs 3, 4, and 5 are all able to promote exon inclusion via multiple copies of a single element, MSE2, but CUG-BP and ETR-3 cannot (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar). To determine whether CELF6 can promote exon inclusion via MSE2 alone, ORFs 1-4 were cotransfected with the M2/M2TB minigene, which contains a 52-nucleotide alternative exon flanked on either side by three copies of MSE2. As before, Western blots confirmed expression of ORFs 1, 2, and 4, but not ORF3, in these experiments (Fig. 6). ORFs 1, 2, and 4 all promoted exon inclusion (Fig. 6), placing CELF6 in the functional subfamily suggested by comparison of CELF protein sequences (Fig. 2A). CELF6 Promotes Skipping of IR Exon 11—In addition to regulating cTNT exon 5 inclusion, CUG-BP has been shown to promote skipping of the alternative exon 11 of IR (9Savkur R. Phillips A. Cooper T. Nat. Genet. 2001; 29: 40-47Crossref PubMed Scopus (660) Google Scholar). To determine whether CELF6 also promotes IR exon 11 skipping, ORFs 1, 2, and 4 were cotransfected with the IR-N minigene into COS-M6 cells (Fig. 7A). COS-M6 cells were used for these experiments because the basal level of IR exon 11 inclusion in QT35 cells is already <10% (data not shown). ORF3 was not included in this experiment because ORF3 protein is not expressed at detectable levels at any dose. Western blots confirmed ORF1, ORF2, and ORF4 protein expression (Fig. 7). Like CUG-BP, the full-length CELF6 ORF1 promoted IR exon 11 skipping in a dose-dependent manner (Fig. 7A). ORF4 also promoted exon skipping, although to a much lesser extent than ORF1, despite expressing protein levels at least comparable with those seen at 1 μg of ORF1 expression plasmid. ORF2, in contrast, had no effect on the level of exon inclusion at any dose. A 1.8-kb region within IR that is required for responsiveness to CUG-BP and contains a CUG-BP binding site has been identified (9Savkur R. Phillips A. Cooper T. Nat. Genet. 2001; 29: 40-47Crossref PubMed Scopus (660) Google Scholar). To determine whether reduced exon 11 inclusion by CELF6 is also dependent on this region, CELF6 ORF1, ORF2, and ORF4 expression plasmids were cotransfected into COS-M6 cells with the IR-E minigene lacking this region (Fig. 7B). Interestingly, CELF6 ORF1 and ORF4 both promote exon skipping, despite the lack of the CUG-BP regulatory region, suggesting that CELF6 acts through different sequences than CUG-BP on some substrates. The response of the IR-E minigene to ORF4 was greater than the response to ORF1, although this may be attributable to the higher level of protein expressed for ORF4 relative to ORF1 in this set of experiments. A New Member of the CELF Family—In this study, we isolated cDNAs and performed functional analysis of protein isoforms of CELF6 (also called BRUNOL6), a sixth member of the CELF family whose existence was previously only predicted (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar, 14Good P. Chen Q. Warner S. Herring D. J. Biol. Chem. 2000; 275: 28583-28592Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). Four CELF6 open reading frames generated by alternative splicing were found, one of which includes a novel exon, exon 3. Although ORFs 2-4 encode truncated CELF6 proteins, and the proteins from ORF2 and ORF4 regulate splicing, it is not clear whether any of these proteins are made in vivo. The premature termination codons introduced in all three ORFs lie more than 50 nucleotides upstream of an exon-intron junction and thus would likely lead to destruction of these mRNAs via the nonsense-mediated decay pathway (18Sun X. Moriarty P.M. Maquat L.E. EMBO J. 2000; 19: 4734-4744Crossref PubMed Scopus (74) Google Scholar). Thus, alternative splicing of CELF6 could lead to down-regulation of its expression. The relative abundance of the four CELF6 mRNA isoforms is unknown because they were isolated by non-quantitative PCR. It is possible that CELF6 undergoes differential alternative splicing in a tissue-specific or developmental stage-specific manner as a means of regulating levels of CELF6 protein. Interestingly, two of the truncated proteins, ORFs 2 and 4, promoted MSE-dependent exon inclusion to levels similar to those promoted by the full-length CELF6 when expressed at high levels in transient transfection assays. Furthermore, ORF4 (but not the shorter ORF2) promoted exon 11 skipping in IR minigenes. Regardless of whether the truncated proteins are naturally expressed, this suggests that the C terminus is not required to influence alternative splicing. Consistent with this result, it has been reported that another CELF protein, ETR-3 (also called BRUNOL3), binds to RNA via the first two RRMs (14Good P. Chen Q. Warner S. Herring D. J. Biol. Chem. 2000; 275: 28583-28592Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). Furthermore, deletional analysis of human ETR-3 and CELF4 indicate that the two N-terminal RRMs plus a small portion of the adjacent divergent domain are sufficient for full activity (19Singh G. Charlet-B N. Han J. Cooper T.A. Nucleic Acids Res. 2004; 32: 1232-1241Crossref PubMed Scopus (37) Google Scholar). Although the C terminus of CELF6 is not required for activity, this does not mean that it does not normally contribute to its function. Deletion mutants of ETR-3 consisting of only the C-terminal RRM plus a portion of the adjacent divergent domain are also active (19Singh G. Charlet-B N. Han J. Cooper T.A. Nucleic Acids Res. 2004; 32: 1232-1241Crossref PubMed Scopus (37) Google Scholar), suggesting that the C termini of CELF proteins may also participate in splicing regulation. CELF-mediated Regulation of Alternative Splicing in Kidney and Brain—Although CELF6 can activate splicing of cTNT minigenes, CELF6 is not expressed at high levels in striated muscle and thus is unlikely to be a key regulator of endogenous cTNT alternative splicing. CELF6 also promoted exon skipping in minigenes of IR, however, which is endogenously expressed at high levels in kidney and brain (20Goldstein B.J. Mullter-Wieland D. Kahn C.R. Mol. Endocrinol. 1987; 1: 759-766Crossref PubMed Scopus (51) Google Scholar). The pattern of CELF6 expression suggests that it plays a role in regulating alternative splicing in kidney and brain. Members of the CELF family have distinct but overlapping patterns of expression, and every tissue examined to date has been shown to express at least one member of the CELF family (Fig. 4; Ref. 3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar), suggesting that regulation of alternative splicing by CELF proteins is widespread. In the kidney, CELF6 may be the primary regulator of CELF-mediated alternative splicing events. By RNA dot blot, CELF3 and CELF5 expression is restricted to brain, and although other CELF mRNAs are detectable in kidney, by Western blot ETR-3 and CELF4 proteins are expressed at very low levels in kidney, whereas CUG-BP is not detectable at all (3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar). In contrast, all six known members of the CELF family are expressed in brain (Fig. 4; Ref. 3Ladd A. Charlet-B N. Cooper T. Mol. Cell. Biol. 2001; 21: 1285-1296Crossref PubMed Scopus (344) Google Scholar). Regulation of alternative splicing in brain has been functionally linked to at least one member of the CELF family. ETR-3 has been implicated in the regulation of brain region-specific alternative splicing of exons 5 and 21 of the N-methyl-d-aspartate receptor (NMDA R1) in the rat (21Zhang W. Haiying L. Kyoungha H. Grabowski P. RNA (N. Y.). 2002; 8: 671-685Crossref Pub
Referência(s)