Thymosin-β4 Regulates Motility and Metastasis of Malignant Mouse Fibrosarcoma Cells
2002; Elsevier BV; Volume: 160; Issue: 3 Linguagem: Inglês
10.1016/s0002-9440(10)64910-3
ISSN1525-2191
AutoresTokushige Kobayashi, Futoshi Okada, Nobuyuki Fujii, Naoko Tomita, Satoru Ito, Hiroshi Tazawa, Tetsuya Aoyama, Sung Ki Choi, Toshiyuki Shibata, Hisakazu Fujita, Masuo Hosokawa,
Tópico(s)Microtubule and mitosis dynamics
ResumoWe identified a thymosin-β4 gene overexpression in malignant mouse fibrosarcoma cells (QRsP-30) that were derived from clonal weakly tumorigenic and nonmetastatic QR-32 cells by using a differential display method. Thymosin-β4 is known as a 4.9-kd polypeptide that interacts with G-actin and functions as a major actin-sequestering protein in cells. All of the six malignant fibrosarcoma cell lines that have been independently converted from QR-32 cells expressed high levels of thymosin-β4 mRNA and its expression in tumor cells was correlated with tumorigenicity and metastatic potential. Up-regulation of thymosin-β4 in QR-32 cells (32-S) transfected with sense thymosin-β4 cDNA converted the cells to develop tumors and formed numerous lung metastases in syngeneic C57BL/6 mice. In contrast, antisense thymosin-β4 cDNA-transfected QRsP-30 (30-AS) cells reduced thymosin-β4 expression, and significantly lost tumor formation and metastases to distant organs. Vector-alone transfected cells (32-V or 30-V cells) behaved like their parental cells. We observed that tumor cell motility, cell shape, and F-actin organization is regulated in proportion to the level of thymosin-β4 expression. These findings indicate that thymosin-β4 molecule regulates fibrosarcoma cell tumorigenicity and metastasis through actin-based cytoskeletal organization. We identified a thymosin-β4 gene overexpression in malignant mouse fibrosarcoma cells (QRsP-30) that were derived from clonal weakly tumorigenic and nonmetastatic QR-32 cells by using a differential display method. Thymosin-β4 is known as a 4.9-kd polypeptide that interacts with G-actin and functions as a major actin-sequestering protein in cells. All of the six malignant fibrosarcoma cell lines that have been independently converted from QR-32 cells expressed high levels of thymosin-β4 mRNA and its expression in tumor cells was correlated with tumorigenicity and metastatic potential. Up-regulation of thymosin-β4 in QR-32 cells (32-S) transfected with sense thymosin-β4 cDNA converted the cells to develop tumors and formed numerous lung metastases in syngeneic C57BL/6 mice. In contrast, antisense thymosin-β4 cDNA-transfected QRsP-30 (30-AS) cells reduced thymosin-β4 expression, and significantly lost tumor formation and metastases to distant organs. Vector-alone transfected cells (32-V or 30-V cells) behaved like their parental cells. We observed that tumor cell motility, cell shape, and F-actin organization is regulated in proportion to the level of thymosin-β4 expression. These findings indicate that thymosin-β4 molecule regulates fibrosarcoma cell tumorigenicity and metastasis through actin-based cytoskeletal organization. Tumor development and progression occur in a consecutive and multistep process that involves several gene alterations. The most serious change is the latter process, tumor progression, because tumor cells acquire an invasive and metastatic phenotype that is the main cause of death and a major barrier to successful treatment for cancer patients. Therefore, for early diagnosis and effective therapeutic intervention, we need to detect the alterations associated with transition from benign to malignant tumor cells on a molecular basis. Animal tumor models are revealing genes associated with tumor progression that also appear in human cancers such as NM23,1Steeg PS Bevilacqua G Kopper L Thorgeirsson UP Talmadge JE Liotta LA Sobel ME Evidence for a novel gene associated with low tumor metastatic potential.J Natl Cancer Inst. 1988; 80: 200-204Crossref PubMed Scopus (1345) Google Scholar Kiss-1,2Lee J-H Miele ME Hicks DJ Phillips KK Trent JM Weissman BE Welch DR KiSS-1, a novel human malignant melanoma metastasis-suppressor gene.J Natl Cancer Inst. 1996; 88: 1731-1737Crossref PubMed Scopus (867) Google Scholar mts1,3Ebralidze A Tulchinsky E Grigorian M Afanasyeva A Senin V Revazova E Lukanidin E Isolation and characterization of a gene specifically expressed in different metastatic cells and whose deduced gene product has a high degree of homology to a Ca2+-binding protein family.Genes Dev. 1989; 3: 1086-1093Crossref PubMed Scopus (326) Google Scholar and CD44,4Gunthert U Hofmann M Rudy W Reber S Zoller M Haussmann I Matzku S Wenzel A Ponta H Herrlich P A new variant of glycoprotein CD44 confers metastatic potential to rat carcinoma cells.Cell. 1991; 65: 13-24Abstract Full Text PDF PubMed Scopus (1666) Google Scholar which are differentially expressed between high-and low-metastatic tumor cells. The tumor progression model of mouse fibrosarcoma cells (QR clone) has been established by our group, which has advantages compared to other models.5Okada F Hosokawa M Hamada J-I Hasegawa J Koto M Mizutani T Ren J Takeichi N Kobayashi H Malignant progression of a mouse fibrosarcoma by host cells reactive to a foreign body (gelatin sponge).Br J Cancer. 1992; 66: 635-639Crossref PubMed Scopus (62) Google Scholar, 6Okada F Hosokawa M Hamada J Hasegawa J Mizutani M Takeichi N Kobayashi H Progression of a weakly tumorigenic mouse fibrosarcoma at the site of early phase of inflammation caused by plastic plates.Jpn J Cancer Res. 1993; 84: 1230-1236Crossref PubMed Scopus (12) Google Scholar, 7Okada F Nakai K Kobayashi T Shibata T Tagami S Kawakami Y Kitazawa T Kominami R Yoshimura S Suzuki K Taniguchi N Inanami O Kuwabara M Kishida H Nakae D Konishi Y Moriuchi T Hosokawa M Inflammatory cell-mediated tumour progression and minisatellite mutation correlate with the decrease of antioxidative enzymes in murine fibrosarcoma cells.Br J Cancer. 1999; 79: 377-385Crossref PubMed Scopus (27) Google Scholar, 8Choi S Kobayashi M Wang J Habelhah H Okada F Hamada J-I Moriuchi T Totsuka Y Hosokawa M Activated leukocyte cell adhesion molecule (ALCAM) and annexin II are involved in the metastatic progression of tumor cells after chemotherapy with Adriamycin.Clin Exp Metastasis. 2000; 18: 45-50Crossref PubMed Scopus (40) Google Scholar, 9Hosokawa M Nakai K Okada F Tumor progression accelerated by oxygen species and its chemoprevention.in: Ohigashi H Osawa T Terao J Watanabe S Yoshikawa T Food Factors for Cancer Prevention. Springer-Verlag, Tokyo1997: 77-81Crossref Google Scholar, 10Choi S Okada F Kobayashi M Habelhah H Nakae D Konishi Y Totsuka Y Hosokawa M Single treatment with cisplatin or UFT, but not their combination treatment enhances the metastatic capacity of mouse fibrosarcoma cells.Anticancer Drugs. 1999; 10: 235-243Crossref PubMed Scopus (8) Google Scholar The QR tumor clones regress spontaneously after injection of up to 2 × 105 cells subcutaneously or 1 × 106 cells intravenously in normal syngeneic mice; the tumor regression is mediated by host immunity because the tumor cells grow progressively in immunosuppressed or nude mice and a tumor cell-derived immunosuppressive factor, prostaglandin E2 (PGE2) is associated with this process.11Okada F Hosokawa M Hasegawa J Ishikawa M Chiba I Nakamura Y Kobayashi H Regression mechanisms of mouse fibrosarcoma cells after in vitro exposure to quercetin: diminution of tumorigenicity with a corresponding decrease in the production of prostaglandin E2.Cancer Immunol Immunother. 1990; 31: 358-364Crossref PubMed Scopus (38) Google Scholar Thus by using QR clones, we are able to mimic the natural course of tumor progression, ie, transition from weak tumorigenicity and nonmetastatic benign tumor cells or dormant state of tumor cells to tumorigenic/metastatic malignant tumor cells in mice. The transitional change can be determined by augmented tumorigenicity or metastatic potential.5Okada F Hosokawa M Hamada J-I Hasegawa J Koto M Mizutani T Ren J Takeichi N Kobayashi H Malignant progression of a mouse fibrosarcoma by host cells reactive to a foreign body (gelatin sponge).Br J Cancer. 1992; 66: 635-639Crossref PubMed Scopus (62) Google Scholar, 6Okada F Hosokawa M Hamada J Hasegawa J Mizutani M Takeichi N Kobayashi H Progression of a weakly tumorigenic mouse fibrosarcoma at the site of early phase of inflammation caused by plastic plates.Jpn J Cancer Res. 1993; 84: 1230-1236Crossref PubMed Scopus (12) Google Scholar, 7Okada F Nakai K Kobayashi T Shibata T Tagami S Kawakami Y Kitazawa T Kominami R Yoshimura S Suzuki K Taniguchi N Inanami O Kuwabara M Kishida H Nakae D Konishi Y Moriuchi T Hosokawa M Inflammatory cell-mediated tumour progression and minisatellite mutation correlate with the decrease of antioxidative enzymes in murine fibrosarcoma cells.Br J Cancer. 1999; 79: 377-385Crossref PubMed Scopus (27) Google Scholar, 8Choi S Kobayashi M Wang J Habelhah H Okada F Hamada J-I Moriuchi T Totsuka Y Hosokawa M Activated leukocyte cell adhesion molecule (ALCAM) and annexin II are involved in the metastatic progression of tumor cells after chemotherapy with Adriamycin.Clin Exp Metastasis. 2000; 18: 45-50Crossref PubMed Scopus (40) Google Scholar, 9Hosokawa M Nakai K Okada F Tumor progression accelerated by oxygen species and its chemoprevention.in: Ohigashi H Osawa T Terao J Watanabe S Yoshikawa T Food Factors for Cancer Prevention. Springer-Verlag, Tokyo1997: 77-81Crossref Google Scholar, 10Choi S Okada F Kobayashi M Habelhah H Nakae D Konishi Y Totsuka Y Hosokawa M Single treatment with cisplatin or UFT, but not their combination treatment enhances the metastatic capacity of mouse fibrosarcoma cells.Anticancer Drugs. 1999; 10: 235-243Crossref PubMed Scopus (8) Google Scholar The model is available for detection of possible internal or external factors for tumor progression. We have previously identified that inflammation5Okada F Hosokawa M Hamada J-I Hasegawa J Koto M Mizutani T Ren J Takeichi N Kobayashi H Malignant progression of a mouse fibrosarcoma by host cells reactive to a foreign body (gelatin sponge).Br J Cancer. 1992; 66: 635-639Crossref PubMed Scopus (62) Google Scholar, 6Okada F Hosokawa M Hamada J Hasegawa J Mizutani M Takeichi N Kobayashi H Progression of a weakly tumorigenic mouse fibrosarcoma at the site of early phase of inflammation caused by plastic plates.Jpn J Cancer Res. 1993; 84: 1230-1236Crossref PubMed Scopus (12) Google Scholar, 7Okada F Nakai K Kobayashi T Shibata T Tagami S Kawakami Y Kitazawa T Kominami R Yoshimura S Suzuki K Taniguchi N Inanami O Kuwabara M Kishida H Nakae D Konishi Y Moriuchi T Hosokawa M Inflammatory cell-mediated tumour progression and minisatellite mutation correlate with the decrease of antioxidative enzymes in murine fibrosarcoma cells.Br J Cancer. 1999; 79: 377-385Crossref PubMed Scopus (27) Google Scholar, 12Okada F Hosokawa M Hasegawa J Kuramitsu Y Nakai K Yuan L Lao H Kobayashi H Takeichi N Enhancement of in vitro prostaglandin E2 production by mouse fibrosarcoma cells after co-culture with various anti-tumour effector cells.Br J Cancer. 1994; 70: 233-238Crossref PubMed Scopus (17) Google Scholar or antitumor drug treatments8Choi S Kobayashi M Wang J Habelhah H Okada F Hamada J-I Moriuchi T Totsuka Y Hosokawa M Activated leukocyte cell adhesion molecule (ALCAM) and annexin II are involved in the metastatic progression of tumor cells after chemotherapy with Adriamycin.Clin Exp Metastasis. 2000; 18: 45-50Crossref PubMed Scopus (40) Google Scholar, 9Hosokawa M Nakai K Okada F Tumor progression accelerated by oxygen species and its chemoprevention.in: Ohigashi H Osawa T Terao J Watanabe S Yoshikawa T Food Factors for Cancer Prevention. Springer-Verlag, Tokyo1997: 77-81Crossref Google Scholar, 10Choi S Okada F Kobayashi M Habelhah H Nakae D Konishi Y Totsuka Y Hosokawa M Single treatment with cisplatin or UFT, but not their combination treatment enhances the metastatic capacity of mouse fibrosarcoma cells.Anticancer Drugs. 1999; 10: 235-243Crossref PubMed Scopus (8) Google Scholar accelerated tumor progression and the resultant daughter cells possessed irreversibly stable malignant phenotypes, all of which derived from a clonal QR-32 tumor line. Comparison of the genes between single-cell-originated benign tumor cells and its derived malignant tumor cells would be of benefit for identifying the progression-associated gene alterations because of their very close genetic backgrounds. We tried to define gene expression comparatively between QR-32 cells and its derived progressor cell line, QRsP-30 cells by differential display and the identified thymosin-β4 gene was transcriptionally elevated in all of the malignant tumor cell lines we tested. We demonstrated that thymosin-β4 expression regulated tumorigenicity, cell motility, and metastatic potential of fibrosarcoma cells through actin-based cytoskeletal organization by sense and antisense thymosin-β4 cDNA transfection strategy. The weakly tumorigenic and poorly metastatic mouse clonal fibrosarcoma cell line QR-32, its derivative highly tumorigenic and highly metastatic cell line, QRsP, and the transfectants were maintained as previously described.5Okada F Hosokawa M Hamada J-I Hasegawa J Koto M Mizutani T Ren J Takeichi N Kobayashi H Malignant progression of a mouse fibrosarcoma by host cells reactive to a foreign body (gelatin sponge).Br J Cancer. 1992; 66: 635-639Crossref PubMed Scopus (62) Google Scholar, 7Okada F Nakai K Kobayashi T Shibata T Tagami S Kawakami Y Kitazawa T Kominami R Yoshimura S Suzuki K Taniguchi N Inanami O Kuwabara M Kishida H Nakae D Konishi Y Moriuchi T Hosokawa M Inflammatory cell-mediated tumour progression and minisatellite mutation correlate with the decrease of antioxidative enzymes in murine fibrosarcoma cells.Br J Cancer. 1999; 79: 377-385Crossref PubMed Scopus (27) Google Scholar Briefly, these cell lines were maintained in Eagle's minimum essential medium that contained 8% fetal bovine serum, sodium pyruvate, nonessential amino acids and l-glutamine, at 37°C, in a humidified 5% carbon dioxide/95% air mixture. The mRNA differential display was performed following the original technique described by Liang and Pardee.13Liang P Pardee AB Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction.Science. 1992; 257: 967-971Crossref PubMed Scopus (4745) Google Scholar DNase I-digested total RNA (1 μg) from QR-32 and QRsP-30 cells were, respectively, reverse-transcribed with 200 U of Superscript RNase H-reverse transcriptase (GIBCO BRL) in the presence of 2.5 μmol/L of one of four anchored primers, T15MG, T15MC, T15MA, and T15MT (Operon Technologies Inc.). Sixty arbitrary 10-mer primer (Operon Technologies, Inc.) was selected at random to be used for polymerase chain reaction (PCR) with the appropriate anchored primer with 5 U/μl of Taq polymerase (Takara). The cycling conditions were 3 minutes at 94°C, 5 minutes at 40°C, 5 minutes at 72°C (1 cycle), 15 seconds at 95°C, 2 minutes at 40°C, 1 minute at 72°C (25 cycles), and 5 minutes at 72°C (1 cycle). Two independent reaction products, respectively, from QR-32 and QRsP-30 cells were separated in 8% polyacrylamide gel with glycerol-tolerant running buffer (United States Biochemical). Differentially expressed cDNA bands were directly excised from the gel and reamplified with the same primer sets in high-stringency conditions. Bands were then cloned into pGEM-T (Promega Corp.) and sequenced with ALF express sequencer (Amersham Pharmacia Biotech). The coding region of thymosin-β4 (nucleotides 158 to 292) was cloned from QRsP-30 cDNA library by PCR. The coding region of thymosin-β4 cDNA was inserted into the pcDNA3.1 vector, which contains the cytomegalovirus enhancer-promoter (Invitrogen) at the Pme I and Xho I sites in the direction of sense or antisense orientation. The orientation of the insert was determined by enzymatic digestion and it was confirmed that no mutations were introduced during the PCR amplification by direct DNA sequencing (data not shown). The thymosin-β4 sense or antisense vector, and the vector alone pcDNA3.1 were individually transfected into tumor cells with Lipofectin reagent (GIBCO/BRL). Transfectants stably expressing the introduced vector were selected by continuous neomycin treatment with 400 μg/ml (Geneticin, GIBCO/BRL). Neomycin-resistant cells were cloned by the limiting dilution method and maintained in the medium containing neomycin. Total RNA was isolated from cells exponentially growing in vitro with a Trizol reagent (GIBCO/BRL). Twenty μg of total RNA was size-fractionated on a denaturing formaldehyde-agarose gel (1.0%) and transferred onto trans-Blot transfer membrane (Bio-Rad). The membrane was hybridized at 42°C for 24 hours with denatured thymosin-β4 probe labeled with [α-32P] dCTP (Amersham) with the use of a random-primer DNA-labeling kit (Takara, Japan) in the buffer containing 50% formamide, 5× SSPE, 0.5% sodium dodecyl sulfate (SDS), 5× Denhardt's solution, and 100 μg of denatured salmon sperm DNA. Then the membranes were washed with 2× standard saline citrate and 0.1% SDS at room temperature for 10 minutes, 0.2× standard saline citrate and 0.1% SDS at room temperature for 10 minutes, and then 0.2× standard saline citrate and 0.1% SDS at 42°C for 60 minutes. To confirm the amounts of RNA loaded in each lane, the blots were hybridized afterward with a L38 cDNA.14Habelhah H Okada F Kobayashi M Nakai K Choi S Hamada J-I Moriuchi T Kaya M Yoshida K Fijinaga K Hosokawa M Increased E1AF expression in mouse fibrosarcoma promotes metastasis through induction of MT1-MMP expression.Oncogene. 1999; 18: 1771-1776Crossref PubMed Scopus (52) Google Scholar Image analysis was performed with BAS2000II system (FUJIX, Japan). Three hundred ng of total RNA was used for the synthesis of the first-strand cDNA in a 20-μl reaction mixture containing 1× first-strand buffer (GIBCO/BRL), 7.5 mmol/L dithiothreitol, 0.5 mmol/L MgCl2, 0.5 mmol/L dNTO, 100 pg random primer (GIBCO/BRL), and Moloney murine leukemia virus reverse transcriptase (GIBCO/BRL). The reverse transcription was done in a block incubator (Astec, B1-525; Japan) for 50 minutes at 37°C after annealing at 25°C for 10 minutes. PCR was performed at 95°C for 5 minutes and on ice for 5 minutes in a block incubator. PCR was performed in a 20-μl reaction mixture containing 1× native pfu buffer (Stratagene), 200 nmol/L of each primer, 0.2 mmol/L dNTPs, and 0.25 U of native pfu polymerase (Stratagene). Gene-specific primers were designated to span the coding region of mouse thymosin-β4 (5′ to 3′); thymosin-β4 upstream, CCTCATCCTCCTCGTCCTTA; thymosin-β4 downstream, TGATCCAACCTCTTTGCATC. Control studies for RT-PCR were conducted by using aliquots from the same samples and amplifying them with primers to GAPDH gene (5′ to 3′); mouse GAPDH upstream, GGGTGTGAACCACGAGAAAT; mouse GAPDH downstream, GGTCCTCAGTGTAGCCCAAG. RT-PCR of mRNA encoding mouse thymosin-β4 and GAPDH resulted in PCR products of 295-and 442-bp long, respectively. The PCR cycles consisted of 1 minute initial denaturation at 95°C, followed by 35 cycles of 95°C for 40 seconds, 59°C for 40 seconds, and 78°C for 1.5 minutes in a thermal cycler (2400R, Perkin Elmer). Each PCR amplification included a negative control containing all of the reaction products except cDNA. Five μl of each PCR product was separated in 2% agarose (Iwai Chem. Pharm., Japan), and stained with ethidium bromide, and photographed under UV light. Because synthetic full-size peptide of human thymosin-β4 gave no antibody rise on intraperitoneal injections into BALB/c mice, we therefore used the N-terminal half of thymosin-β4 molecule. The synthetic peptide (Thyb4-2: MSDKPDMAEIEKFDKSKLKKTETQEKN) was made with an additional Cys moiety at the C-terminal position for conjugation with KLH. Mice were immunized three times with the Thyb4-2 (20 μg/ml) and Freund's complete adjuvant. Two weeks later, the mice were boosted with Thyb4-2 and Freund's noncomplete adjuvant. After the final immunization, the spleen was fused with myeloma cells (P3U1) and 50% PEG (1500; Boehringer Mannheim Yamanouchi, Tokyo, Japan) with the standard screening method to obtain a desired monoclonal antibody, TB4N1-5. The subclass of the antibody was IgG1 (κ). The established hybridoma cells were injected intraperitoneally into BALB/c mice to produce ascites and the antibody was purified with the use of a protein-A column. For peptide competitive inhibition assay, 96-well plates were coated with synthetic peptide Tyb4-2 (2 μg/ml) of thymosin-β4 for overnight at 4°C. After washing with phosphate-buffered saline (PBS) containing 0.02% Tween 20 (T-PBS), the plates were incubated with 1% skim milk in PBS. Then TB4N1-5 antibody (5 μg/ml) was added to the wells with serially diluted synthetic peptide Tyb4-2 (for thymosin-β4) or Tyb10 (for thymosin-β10, full size) as a control, and the plates were incubated for 3 hours at 37°C. After three washes, anti-mouse immunoglobulins conjugated with horseradish peroxidase were added to the wells and incubated for 1 hour at 37°C. After three washes, an ABTS [2,2′-azino-bis(3-ethylbenzthiazoline-6-sulfonic acid) diammonium salt]/H2O2 solution (0.1%/0.003%) in citrate/phosphate buffer (0.1 mol/L, pH 4.5) was added to each well. After 10 minutes, absorbance was measured at 405 nm. Proteins were extracted from cell lines and Western blot analysis was performed as follows. Briefly, lysates of the cultured cells were prepared in Laemmli's buffer.15Laemmli UK Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature. 1970; 227: 680-685Crossref PubMed Scopus (218068) Google Scholar Then 100 μg of the protein was separated by electrophoresis on a SDS-10% polyacrylamide gel. The gel was incubated in phosphate-buffered saline (PBS) containing 10% glutaraldehyde (Wako Pure Chemical Ind., Japan) for 1 hour, washed three times in PBS for 20 minutes, and further incubated in a blotting buffer for 30 minutes at room temperature. The protein was transferred to a polyvinylidene difluoride membrane (Immobilon-P; Millipore, Japan) by electrotransfer. The membrane was preincubated for 2 hours with 5% skim milk in PBS containing 0.05% T-PBS. The membrane was incubated for 1 hour at room temperature with a monoclonal antibody to thymosin-β4 (TB4N1-5). After five washes with T-PBS, the membrane was incubated with horseradish peroxidase-conjugated sheep anti-mouse immunoglobulin antibody (NA931, Amersham) for 1 hour at room temperature. After five washes of the membrane with T-PBS, the specific protein-antibody reaction was detected by the enhanced chemiluminescence detection system (Amersham). The intensities of individual bands were semiquantified by means of densitometry of autoradiogram with the Kodak Digital Science (IS 440CF). Each membrane was stained with 0.1% Amido Black 10B (161-0402, BioRad) and equivalence of the loading protein was confirmed in each lane. Cells from each cell line were allowed to spread on glass coverslips (22 × 22 mm; Matsunami Glass, Japan) in 6-well plates (no. 3046; Falcon). The cells were fixed with 3.0% paraformaldehyde and then permeabilized with 0.1% Triton X-100 for 5 minutes. The cells were treated with 70% methanol for 5 minutes at −30°C and washed with 0.1% bovine serum albumin in T-PBS (PBT). Then the cells were stained with anti-thymosin-β4 antibody (TB4N1-5, 1 μg/ml) for 1 hour, followed by incubation for 1 hour with Alexa 488 anti-mouse IgG (A-11029, 10 μg/ml; Molecular Probes). Thereafter F-actin staining was done by incubating with 1 U of Texas Red-X phalloidin (T-7471, Molecular Probes) for 1 hour. Cells were mounted and analyzed by confocal microscopy as follows. The confocal scanning laser microscope images were generated on a confocal laser-scanning microscope equipped with an argon laser and ZEISS 63× oil immersion (1.4 n.a.) objective. The condition for confocal imaging was fixed as follows and scanning was done exactly and the same condition at one time. Image collection: speed, normal; collection filter, Kalman, Factor 1; and box and pixel size, 512 × 512 pixels (0.4 μm/pixel). PhotoMultiplier: iris, 2.0; gain, 1500; BLev, 0; emission filter, 605 DF32; and low signal, checked. The final images were volume rendered on a computer (DELL Power Edge 2200) using Bio-Rad Sharp Confocal System (MRC-1024 version 3.2, Bio-Rad). The digital images were subsequently photographed with a digitalized film recorder (Color Video Copy Processor, CP2000; Mitsubishi, Japan) onto a paper sheet (model CK2000L, Mitsubishi Electric). For in vitro cell growth analysis, cells were seeded into a 6-well plate (1 × 105 cells per well). The medium was changed every other day. The cells were harvested and counted every day from day 1 to 7 by trypan blue exclusion test. Doubling time was calculated from the logarithmic phase of the growth curve. For evaluation of plating efficiency, 1 × 103 cells suspended in the medium containing 8% fetal bovine serum were plated into 60-mm dishes (MS-10600; S.B. Medical, Japan) in triplicate. The dishes were incubated for 7 days, and colonies were fixed in Carnoy's fixative, stained with 0.1% crystal violet, and scored. For determination of the soft agar growth (anchorage-independent), 2 × 102 cells were suspended in 1 ml of the medium containing 0.3% agar (GIBCO/BRL) and twice volume of fetal bovine serum, and applied onto the presolidified 0.6% agar (1 ml) in 6-well plates. Triplicate plates were prepared for each cell line. After 3 weeks of incubation, colonies larger than 0.1 mm in diameter were scored. Uniform carpets of gold particles were prepared on glass coverslips (22 × 22 mm) coated with bovine serum albumin as described previously.16Shibata T Kawano T Nagayasu H Okumura K Arisue M Hamada J Takeichi N Hosokawa M Enhancing effects of epidermal growth factor on human squamous cell carcinoma motility and matrix degradation but not growth.Tumor Biol. 1996; 17: 168-175Crossref PubMed Scopus (66) Google Scholar The gold particle on glass coverslips was placed in 35-mm culture dishes (627160, Greiner Labortechnik) containing 2 ml of Eagle's minimum essential medium supplemented with 8% fetal bovine serum. Then 2 × 103 cells were added to each dish. After 48 hours, phagokinetic tracks of 40 cells were visualized under a microscope. The area cleared of gold particles by a cell was quantified by using a microscope analyzer (Cosmozone R500; Nikon, Japan). Confluent tumor-cell monolayers on glass coverslips (22 × 22 mm) in six-well plates were scraped using a pipette tip (MARS, CL-200; Japan) to make a wound 22-mm long. The cells were incubated at 37°C and allowed to migrate into the wound for intervals of several hour, then fixed and stained with 0.1% crystal violet. The numbers of cells that moved into the 22-mm2 area in each line were counted in a microscope. Animal protocols were approved by the Committee of Institute for Animal Experimentation at the Hokkaido University School of Medicine (no. 9910). Female C57BL/6 mice were purchased from Japan SLC and used at 6 to 10 weeks of age. Subcutaneous tumorigenicity was examined by injecting 2 × 105 cells/0.2 ml into the subcutis of the mice. In the study on spontaneous metastasis, moribund mice were sacrificed and the organs were removed, weighed, and the number of metastatic nodules on the surface of lung and the other organs were counted macroscopically. Experimental metastatic potential of the cells was measured by the lung colonization assay as described previously.5Okada F Hosokawa M Hamada J-I Hasegawa J Koto M Mizutani T Ren J Takeichi N Kobayashi H Malignant progression of a mouse fibrosarcoma by host cells reactive to a foreign body (gelatin sponge).Br J Cancer. 1992; 66: 635-639Crossref PubMed Scopus (62) Google Scholar In brief, the cells were injected into the tail vein of mice at the density of 1 × 106 cells/0.2 ml. Twenty-five days later, the mice were sacrificed and the metastatic nodules on the lung surface and the other organs were counted macroscopically. Differences in the subcutaneous tumor and those in spontaneous and experimental metastases were evaluated by chi-square test. Differences in the plating efficiency, the latency periods, the mean survival times, and the motility of tumor cells were calculated by Student's t-test. We have previously found that foreign body-induced inflammation not only promotes the local growth of weakly tumorigenic and nonmetastatic tumor cells (QR-32) but also converts them into more aggressive tumors (QRsP), ie, they acquire enhanced tumorigenicity and metastatic ability.5Okada F Hosokawa M Hamada J-I Hasegawa J Koto M Mizutani T Ren J Takeichi N Kobayashi H Malignant progression of a mouse fibrosarcoma by host cells reactive to a foreign body (gelatin sponge).Br J Cancer. 1992; 66: 635-639Crossref PubMed Scopus (62) Google Scholar Using differential display, we identified 23 genes that were expressed differentially between QR-32 cells and its derivative highly tumorigenic and metastatic fibrosarcoma cell line, QRsP-30. Based on Northern blot analysis of those 23 genes, we further selected 3 genes. To identify these genes, we extracted the differential display bands, reamplified, and sequenced. A search in the BLAST computer database found that these cDNAs were more than 90% homologous to calcyclin, thymosin-β4, and vimentin, respectively (data not shown). Figure 1) illustrates a typical example of differential display (Figure 1A) and a Northern blot (Figure 1B) that confirms the existence of 0.7-kb thymosin-β4 mRNA in the QRsP-30 cells but not in the parental QR-32 cells. Northern blot analysis showed that QR-32 cells expressed an extremely low level of thymosin-β4 mRNA (Figure 1, C and D). We observed high levels of thymosin-β4 mRNA expression in a total of five QR-32 cell-derived highly metastatic tumor cell lines (43- to 70-fold; Figure 1, C and D) and relatively high expression of thymosin-β4 mRNA in the moderately metastatic tumor cell line, QRsP-28 (19-fold; Figure 1, C and D). On the other hand, expression of calcyclin and vimentin was observed equally in QR-32 cells and its derived malignant tumor cell lines (data not shown). Thus thymosin-β4 expression w
Referência(s)