Human Apical Sodium-dependent Bile Salt Transporter Gene (SLC10A2) Is Regulated by the Peroxisome Proliferator-activated Receptor α
2002; Elsevier BV; Volume: 277; Issue: 34 Linguagem: Inglês
10.1074/jbc.m203511200
ISSN1083-351X
AutoresDiana Jung, Michael Fried, Gerd A. Kullak‐Ublick,
Tópico(s)Metabolism and Genetic Disorders
ResumoThe apical sodium-dependent bile salt transporter (ASBT/SLC10A2), also called the ileal bile acid transporter, mediates the intestinal absorption of bile salts. The efficiency of this transport process is a determinant of hepatic bile salt synthesis from cholesterol and of serum triglyceride levels. Our aim was to characterize the humanASBT gene promoter with respect to regulatory mechanisms that coordinately affect ASBT expression and hepatic lipid and bile salt metabolism. The minimal construct that confers full promoter activity contains three functional hepatocyte nuclear factor 1α (HNF1α) recognition sites, explaining the dependence ofASBT gene expression upon HNF1α. A nuclear receptor binding site arranged as a direct hexanucleotide repeat (DR1 motif) is localized ∼1.6 kb upstream of the transcription initiation site. Constructs containing this element were transactivated by WY14643 and ciprofibrate, ligands of the peroxisome proliferator-activated receptor α (PPARα), in Caco2 cells. The DR1 element was shown to bind the PPARα/9-cis-retinoic acid receptor heterodimer, and targeted mutagenesis of the DR1 motif abolished PPARα responsiveness. Ciprofibrate treatment of SK-ChA cholangiocytes increased ASBT mRNA levels, suggesting a physiologic role for PPARα-mediatedASBT gene regulation. This study identifies PPARα as a novel link between ileal bile salt absorption and hepatic lipid metabolism. The apical sodium-dependent bile salt transporter (ASBT/SLC10A2), also called the ileal bile acid transporter, mediates the intestinal absorption of bile salts. The efficiency of this transport process is a determinant of hepatic bile salt synthesis from cholesterol and of serum triglyceride levels. Our aim was to characterize the humanASBT gene promoter with respect to regulatory mechanisms that coordinately affect ASBT expression and hepatic lipid and bile salt metabolism. The minimal construct that confers full promoter activity contains three functional hepatocyte nuclear factor 1α (HNF1α) recognition sites, explaining the dependence ofASBT gene expression upon HNF1α. A nuclear receptor binding site arranged as a direct hexanucleotide repeat (DR1 motif) is localized ∼1.6 kb upstream of the transcription initiation site. Constructs containing this element were transactivated by WY14643 and ciprofibrate, ligands of the peroxisome proliferator-activated receptor α (PPARα), in Caco2 cells. The DR1 element was shown to bind the PPARα/9-cis-retinoic acid receptor heterodimer, and targeted mutagenesis of the DR1 motif abolished PPARα responsiveness. Ciprofibrate treatment of SK-ChA cholangiocytes increased ASBT mRNA levels, suggesting a physiologic role for PPARα-mediatedASBT gene regulation. This study identifies PPARα as a novel link between ileal bile salt absorption and hepatic lipid metabolism. ileal bile acid-binding protein cholesterol 7α-hydroxylase farnesoid X receptor apical sodium-dependent bile salt transporter rodent/human solute carrier gene family chenodeoxycholate hepatocyte nuclear factor very low density lipoprotein liver X receptor peroxisome proliferator-activated receptor untranslated region colon carcinoma-derived cells human embryonic kidney-derived cells human cholangiocyte-derived cells 9-cis-retinoic acid [4-chloro-6-(2,3-xylidino)-2-pyrimidinylthio]acetic acid chicken hepatoma cells 9-cis-retinoic acid receptor thymidine kinase organic anion transporting polypeptide nucleotide(s) Bile salts undergo extensive enterohepatic circulation through the coordinated action of several transport systems in the intestine and the liver. In man, the bile salt pool circulates 6–10 times/24 h, resulting in a daily hepatic bile salt excretion of 20–40 g. Only about 0.5 g of bile salts escape intestinal absorption and are lost through fecal excretion. This loss is compensated for by de novo hepatic synthesis. The intrinsic link between intestinal bile salt absorption and hepatic synthesis has become apparent from studies showing that hydrophobic bile salts can transcriptionally induce the ileal bile acid-binding protein (I-BABP)1 and repress hepatic cholesterol 7α-hydroxylase (CYP7A1) through the action of the nuclear bile salt receptor, farnesoid X receptor (FXR) (1Grober J. Zaghini I. Fujii H. Jones S.A. Kliewer S.A. Willson T.M. Ono T. Besnard P. J. Biol. Chem. 1999; 274: 29749-29754Abstract Full Text Full Text PDF PubMed Scopus (286) Google Scholar, 2Goodwin B. Jones S.A. Price R.R. Watson M.A. McKee D.D. Moore L.B. Galardi C. Wilson J.G. Lewis M.C. Roth M.E. Maloney P.R. Willson T.M. Kliewer S.A. Mol. Cell. 2000; 6: 517-526Abstract Full Text Full Text PDF PubMed Scopus (1482) Google Scholar). By this mechanism, bile salts can regulate their own enterohepatic circulation. The chief intestinal bile salt uptake system is the apical sodium-dependent bile salt transporter (ASBT/SLC10A2), also called the ileal bile acid transporter. The human ASBT protein consists of 348 amino acids and is encoded by a major 4.0-kb transcript that has been detected in the ileum, cecum, and kidney by Northern blot analyses (3Craddock A.L. Love M.W. Daniel R.W. Kirby L.C. Walters H.C. Wong M.H. Dawson P.A. Am. J. Physiol. 1998; 274: G157-G169PubMed Google Scholar). Expression on the apical surface of ileal enterocytes, renal proximal tubular cells, and large cholangiocytes has been shown in rat studies (4Shneider B.L. Dawson P.A. Christie D.-M. Hardikar W. Wong M.H. Suchy F.J. J. Clin. Invest. 1995; 95: 745-754Crossref PubMed Google Scholar, 5Lazaridis K.N. Pham L. Tietz P. Marinelli R.A. deGroen P.C. Levine S. Dawson P.A. LaRusso N.F. J. Clin. Invest. 1997; 100: 2714-2721Crossref PubMed Scopus (225) Google Scholar). Human ASBT is an efficient transport system for conjugated and unconjugated bile salts, with a higher affinity for the dihydroxy bile salts chenodeoxycholate (CDCA) and deoxycholate than for the trihydroxy bile salt, taurocholate (3Craddock A.L. Love M.W. Daniel R.W. Kirby L.C. Walters H.C. Wong M.H. Dawson P.A. Am. J. Physiol. 1998; 274: G157-G169PubMed Google Scholar). Intestinal ASBT expression is a critical determinant of the bile salt pool size and activity of the bile salt biosynthetic enzymes CYP7A1 (classic or neutral synthetic pathway) and sterol 27-hydroxylase (alternative or acidic pathway) in the liver (6Xu G. Shneider B.L. Shefer S. Nguyen L.B. Batta A.K. Tint G.S. Arrese M. Thevananther S., Ma, L. Stengelin S. Kramer W. Greenblatt D. Pcolinsky M. Salen G. J. Lipid Res. 2000; 41: 298-304Abstract Full Text Full Text PDF PubMed Google Scholar). The ASBT gene is localized on chromosome 13q33 (7Oelkers P. Kirby L.C. Heubi J.E. Dawson P.A. J. Clin. Invest. 1997; 99: 1880-1887Crossref PubMed Scopus (301) Google Scholar). Several lines of evidence indicate that ASBT gene expression is tightly regulated at the transcriptional level. First, mice with null mutations in the gene coding for hepatocyte nuclear factor 1α (HNF1α) (encoded by Tcf1) have no expression of ASBT in intestine and kidneys, indicating that ASBT gene expression is dependent upon HNF1α (8Shih D.Q. Bussen M. Sehayek E. Ananthanarayanan M. Shneider B.L. Suchy F.J. Shefer S. Bollileni J.S. Gonzalez F.J. Breslow J.L. Stoffel M. Nat. Genet. 2001; 27: 375-382Crossref PubMed Scopus (360) Google Scholar). Second, the rat ASBT gene promoter contains an AP-1 element that binds c-Jun and c-Fos and coexpression of c-Jun enhances promoter activity (9Chen F., Ma, L., Al Ansari N. Shneider B. J. Biol. Chem. 2001; 276: 38703-38714Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Third, intestinal inflammation in rabbits decreases ileal ASBT mRNA levels, whereas glucocorticoid administration in rats leads to up-regulation (10Sundaram U. Wisel S. Stengelin S. Kramer W. Rajendran V. Am. J. Physiol. 1998; 275: G1259-G1265PubMed Google Scholar, 11Nowicki M.J. Shneider B.L. Paul J.M. Heubi J.E. Am. J. Physiol. 1997; 273: G197-G1203PubMed Google Scholar). Whether or not bile salts regulate the ASBT gene remains controversial; a direct involvement of FXR seems unlikely because FXR−/− mice have no obvious alteration in ASBT expression level (12Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1387) Google Scholar). Intestinal bile salt absorption rates have been shown to correlate inversely with serum triglyceride levels, suggesting a connection between ASBT function and lipid metabolism (13Angelin B. Hershon K.S. Brunzell J.D. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 5434-5438Crossref PubMed Scopus (80) Google Scholar, 14Duane W.C. J. Lipid Res. 1995; 36: 96-107Abstract Full Text PDF PubMed Google Scholar). The pharmacologic inhibition of ASBT function and expression could, therefore, have a major impact not only on the amount of potentially carcinogenic bile salts that enter the colon but also on hepatic VLDL synthesis (15Love M.W. Craddock A.L. Angelin B. Brunzell J.D. Duane W.C. Dawson P.A. Arterioscler. Thromb. Vasc. Biol. 2001; 21: 2039-2045Crossref PubMed Scopus (33) Google Scholar), serum triglyceride levels and hepatic breakdown of cholesterol to bile salts (6Xu G. Shneider B.L. Shefer S. Nguyen L.B. Batta A.K. Tint G.S. Arrese M. Thevananther S., Ma, L. Stengelin S. Kramer W. Greenblatt D. Pcolinsky M. Salen G. J. Lipid Res. 2000; 41: 298-304Abstract Full Text Full Text PDF PubMed Google Scholar). The primary aim of this study was to characterize the humanASBT gene promoter and to investigate whether a regulatory pathway exists that could account for the observed correlation between ileal bile salt absorption and hepatic lipid and bile salt metabolism. Specifically, we studied whether the human ASBT gene is regulated by a member of the nuclear receptor superfamily. Prototypic "lipid sensors" within the nuclear receptor superfamily include FXR, which regulates CYP7A1 and bile salt transporter genes (1Grober J. Zaghini I. Fujii H. Jones S.A. Kliewer S.A. Willson T.M. Ono T. Besnard P. J. Biol. Chem. 1999; 274: 29749-29754Abstract Full Text Full Text PDF PubMed Scopus (286) Google Scholar, 2Goodwin B. Jones S.A. Price R.R. Watson M.A. McKee D.D. Moore L.B. Galardi C. Wilson J.G. Lewis M.C. Roth M.E. Maloney P.R. Willson T.M. Kliewer S.A. Mol. Cell. 2000; 6: 517-526Abstract Full Text Full Text PDF PubMed Scopus (1482) Google Scholar, 16Ananthanarayanan M. Balasubramanian N. Makishima M. Mangelsdorf D.J. Suchy F.J. J. Biol. Chem. 2001; 276: 28857-28865Abstract Full Text Full Text PDF PubMed Scopus (645) Google Scholar,17Jung D. Podvinec M. Meyer U.A. Mangelsdorf D.J. Fried M. Meier P.J. Kullak-Ublick G.A. Gastroenterology. 2002; 122: 1954-1966Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar), and the liver X receptor (LXRα), which also regulates CYP7A1 as well as cholesterol and bile salt transport systems including I-BABP (18Repa J.J. Mangelsdorf D.J. Annu. Rev. Cell Dev. Biol. 2000; 16: 459-481Crossref PubMed Scopus (598) Google Scholar, 19Zaghini I. Landrier J.F. Grober J. Krief S. Jones S.A. Monnot M.C. Lefrere I. Watson M.A. Collins J.L. Fujii H. Besnard P. J. Biol. Chem. 2002; 277: 1324-1331Abstract Full Text Full Text PDF PubMed Scopus (28) Google Scholar). The results indicate an important new mechanism ofASBT gene regulation and identify the peroxisome proliferator-activated receptor α (PPARα) as a novel link between ileal bile salt absorption and hepatic lipid metabolism. [γ-32P]Adenosine triphosphate (3000 Ci/mmol) was purchased from Amersham Biosciences. Restriction enzymes were from Roche Molecular Biochemicals, PfuTurbo DNA polymerase from Invitrogen, and T4 polynucleotide kinase from Stratagene. Polyacrylamide was obtained from BioRad. Unless stated otherwise, all chemicals were purchased from Sigma-Aldrich. Three fragments of the 5′-region of the human ASBT gene were PCR-amplified using human genomic DNA as a template, upstream primers ASBT/−1688for or ASBT/+26for, downstream primers ASBT/+21rev or ASBT/+526rev (Table I), and PfuTurbo DNA polymerase. The upstream primers contained an internal SacI restriction site and the downstream primer an internal XhoI site. The resulting PCR products were digested with SacI and ligated into the luciferase reporter gene vector, pGL3-Basic (Promega Catalys AG, Wallisellen, Switzerland), which had been predigested with SacI and SmaI, yielding the following promoter constructs: −1688-Luc, −1688/UTR-Luc, UTR-Luc. The −1492/UTR-Luc construct was generated by excising aStuI/SacI fragment from −1688/UTR-Luc. Additional deletional constructs of the 5′-untranslated region (5′-UTR) of the ASBT gene were constructed by PCR amplification of the 5′-UTR using upstream primers ASBT/+324for or ASBT/+292for and downstream primer ASBT/+539rev (Table I). The upstream primers contained an internal SacI restriction site and the downstream primer a BglII site. The resulting PCR products were digested with SacI and BglII and were ligated into the pGL3-Basic vector predigested with SacI and BglII, resulting in the constructs UTR292–539-Luc and UTR324–539-Luc. UTR26–251-Luc was generated by excising aXhoI fragment from UTR-Luc. The DR1-TK-Luc and mutDR1-TK-Luc plasmids were constructed by ligating a dimerized oligonucleotide (DR1 and mutDR1, respectively, in Table I) containing the DR1 element of theASBT gene and 5′- HindIII and 3′-BamHI overhangs into TK-Luc plasmid predigested with HindIII and BamHI. Sequence identity of all constructs with theASBT gene was verified by sequence analysis. Plasmid DNA was prepared using the Qiagen system (Basel, Switzerland).Table IOligonucleotides used for chimeric plasmid construction and mobility shift assaysOligonucleotideSequence (5′ to 3′)ASBT/+21revGAGCCATAGGAACACATATTGTTCTCGAGTTTCCCASBT/−1688forCCAGCCACAGGAGCTCAGGTGCAGGTGCCCAGGTGASBT/+526revCCCTGGCTCTGCTGCTGCTCGAGTTAAGCAACGTTTACASBT/+26forGGGAAATGGGAGCTCAATATGTGTTCCTATGGASBT/+539revCCCTAGATCTGCTGCTGGTTGAGTTAAGCASBT/+324forGATTAATCGGAGCTCTCTGTCTTGACCASBT/+292forTGGCAGAGCTCATTATCATGCCAATAAATGDR1AGCTCAGAAGTAGGCCAGAGGTCAGTCCCAG1-aMutated residues in the DR1 element (underlined) are indicated in bold.mutDR1AGCTCAGAAGTAGAACAGAGAACAGTCCCAGsdmut-DR1CTCCCGACAGAAGTAGCACAGAGCACAGTCCCAGGAA- ATGCTTGASBTquant-forGCCCCAAAAAGCAAAGATCAASBTquant-revGCTATGAGCACAATGAGGATGG1-a Mutated residues in the DR1 element (underlined) are indicated in bold. Open table in a new tab A −1688/UTR-Luc derived construct containing staggered nicks was generated by PCR using two complementary oligonucleotides mutated in the DR1 binding site (sequence sdmut-DR1 in Table I) and PfuTurbo DNA polymerase. The product was digested with DpnI to remove the parental DNA template and select for DNA containing the mutation. The mutated plasmid was termed mutDR1–1688/UTR-Luc. Caco2 and HEK293 cell lines were purchased from ATCC (Manassas, VA). SK-ChA cells were kindly provided by Dr. M. Strazzabosco (Division of Gastroenterology, Ospedali Riuniti di Bergamo, Bergamo, Italy). SK-ChA cells were maintained in minimum essential medium (α-MEM, Invitrogen), Caco2 and HEK293 in Dulbecco's modified Eagle's medium (Sigma). All media were supplemented with 10% fetal calf serum (20% in the case of Caco2 cells), 100 units/ml penicillin, and 100 μg/ml streptomycin. For transactivation assays, Caco2 cells were grown for 3 days in medium containing 20% charcoal-stripped bovine calf serum and then seeded at 90–95% density in 48-well plates. Caco2 cells were transfected with LipofectAMINE 2000 reagent (Invitrogen) and SK-ChA and HEK293 cells with FuGENE 6 (Roche Molecular Biochemicals). Plasmid DNA for reporter assays comprised 350 ng of luciferase promoter construct, 50 ng of pSV-β-galactosidase plasmid, and 50 ng each of pCMX-hRXRα (kindly provided by Dr. D. J. Mangelsdorf, Howard Hughes Medical Institute and Dept. of Pharmacology, University of Texas Southwestern Medical Center, Dallas, TX) and pSG5-hPPARα (kindly provided by Dr. B. Staels, Département d'Athérosclerose, Institut Pasteur de Lille, Lille, France) expression plasmid or 100 ng of HNF1α/HNF1β expression plasmids (pRSVhumHNF1-correct and pRSV-vHNF1Ahuman, kindly provided by Dr. M. Yaniv, Unité des Virus Oncogènes, Institut Pasteur, Paris, France). To ensure that the total DNA amount transfected remained constant, pBluescript vector (pB-SKII, CLONTECH, Basel, Switzerland) was used as carrier DNA as required. 18 h after transfection, cells were treated with 1 μm 9-cis-retinoic acid (9cRA) and either 10 μm WY14643 (Calbiochem) or 30 μm ciprofibrate (Sigma) as indicated for 24 h. Controls were treated with dimethyl sulfoxide (Me2SO) alone. LMH cells were obtained from ATCC and were grown in William's medium E (Invitrogen) supplemented with 10% fetal calf serum (Invitrogen), 2 mmglutamine, 1× nonessential amino acids, 100 units/ml penicillin, and 100 μg/ml streptomycin on gelatin-coated dishes (Sigma). 48 h before transfection, cells were seeded on to gelatin-coated 24-well plates in medium supplemented with 10% charcoal-stripped bovine calf serum (Sigma) at 75–80% density. Transfections were performed with 1.5 μl of FuGENE 6 transfection reagent (Roche Molecular Biochemicals) and 500 ng plasmid DNA, the latter comprising 450 ng of luciferase construct and 50 ng of pSV-β-galactosidase plasmid (Promega Catalys AG). Six hours after transfection, cells were stimulated with 30 μm ciprofibrate (Sigma), 50 μm CDCA (Sigma), 10 μm22(R)-hydroxycholesterol (22-HC, Sigma), or Me2SO for 24 h. Cells were lysed with passive lysis buffer (Promega Catalys AG) 24 h after transfection (in the absence of ligand) or after treatment with ligand. Luciferase activity was quantified using the luciferase assay system (Promega Catalys AG) in a Lumat LB 9507–2 luminometer (Berthold, Bad Wildbad, Germany). β-Galactosidase activity was quantified with a high sensitivity assay (Stratagene, Amsterdam, Netherlands) in a UVmax kinetic microplate reader (Molecular Devices, Sunnyvale, CA) at 595 nm. Double-stranded oligonucleotide probes were obtained by hybridizing single-stranded complementary oligonucleotides (Microsynth, Balgach, Switzerland). Dimers with the DR1 sequence corresponding to the sequence found in theASBT gene promoter (Table I) were labeled with [γ-32P]ATP using T4 polynucleotide kinase (Stratagene, Amsterdam, Netherlands). In vitro translation was performed with the TnT Quick-coupled transcription/translation system (Promega Catalys AG). For gel mobility shift assays, 5 μl of in vitro translated PPARα or 9-cis-retinoic acid receptor (RXRα) protein were incubated on ice for 20 min with 2–5 fmol of [γ32P]-end-labeled dimerized oligonucleotide and 1 μg of poly(dI)poly(dC) (Amersham Biosciences) in 20 mmHEPES-KOH, pH 7.9, 20% glycerol, 100 mm KCl, 2 mm MgCl2, 0.5 mm dithiothreitol, and 0.5 mm phenylmethylsulfonyl fluoride. For competition assays a 500-fold excess of unlabeled dimerized oligonucleotides was added. Sequence mutDR1 (Table I) corresponded to the wild-type ASBT sequence mutated within the DR1 site. For supershift experiments 2 μl of antibody against PPARα (N-19, sc-1985X, Santa Cruz Biotechnology Inc., Heidelberg, Germany) or RXRα (D-20, sc-553X, Santa Cruz Biotechnology) was added to the reaction mix. Reactions were analyzed by electrophoresis through 3.4% polyacrylamide gels in 0.25× TBE buffer (Tris borate/EDTA) at 120 V for 2 h. 1 μg of total RNA isolated from SK-ChA cholangiocytes was reversed-transcribed (Reverse Transcription System, Promega Catalys AG). Real-time PCR was performed with the ABI PRISM 7700 sequence detection system using one-sixth of the reverse transcription reaction and was analyzed with Applied Biosystems 1.7 software (Rotkreuz, Switzerland). Amplification of the endogenous control was performed with the ribosomal 18 STaqMan PCR master system (Applied Biosystems). ASBT was amplified with the primers ASBTquant-for and ASBTquant-rev (Table I) using cyber green incorporation (SYBR Green PCR-Master Mix, Qiagen). Because validation experiments showed that the amplification efficiencies of the target and the reference were approximately equal, quantitation was performed using the comparative ΔΔCT method. Reporter gene activities are expressed as the mean ± 1 standard error of the mean (S.E.) of 6–10 individual transfection experiments. All data were reproduced at least once using two different preparations of plasmid DNA. As shown in previous studies on the structure of the human ASBT gene (3Craddock A.L. Love M.W. Daniel R.W. Kirby L.C. Walters H.C. Wong M.H. Dawson P.A. Am. J. Physiol. 1998; 274: G157-G169PubMed Google Scholar, 7Oelkers P. Kirby L.C. Heubi J.E. Dawson P.A. J. Clin. Invest. 1997; 99: 1880-1887Crossref PubMed Scopus (301) Google Scholar), the major transcription initiation site (designated +1 in Fig. 1) is separated by a 598-bp untranslated region from the translation start site on exon 1. Because previous studies had indicated the presence of regulatory elements within the 5′-UTR of the ASBT gene (8Shih D.Q. Bussen M. Sehayek E. Ananthanarayanan M. Shneider B.L. Suchy F.J. Shefer S. Bollileni J.S. Gonzalez F.J. Breslow J.L. Stoffel M. Nat. Genet. 2001; 27: 375-382Crossref PubMed Scopus (360) Google Scholar,9Chen F., Ma, L., Al Ansari N. Shneider B. J. Biol. Chem. 2001; 276: 38703-38714Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar) we constructed reporter gene vectors containing the major part of the 5′-UTR and up to 1688 nucleotides of 5′-flanking sequence (plasmids −1688/UTR-Luc and −1492/UTR-Luc in Fig. 1). Additional constructs contained only the 5′-UTR (UTR-Luc) or only 5′-flanking sequence (−1688-Luc). These constructs were used to characterize the basal promoter function of the human ASBT gene. For reporter gene assays, cell lines derived from human intestine (Caco2), embryonic kidney (HEK293), and bile duct epithelium (SK-ChA), tissues that have been shown to express the ASBT mRNA (3Craddock A.L. Love M.W. Daniel R.W. Kirby L.C. Walters H.C. Wong M.H. Dawson P.A. Am. J. Physiol. 1998; 274: G157-G169PubMed Google Scholar, 5Lazaridis K.N. Pham L. Tietz P. Marinelli R.A. deGroen P.C. Levine S. Dawson P.A. LaRusso N.F. J. Clin. Invest. 1997; 100: 2714-2721Crossref PubMed Scopus (225) Google Scholar), were employed. Transfection of cells with plasmids UTR-Luc, −1492/UTR-Luc, and −1688/UTR-Luc produced significant luciferase activity compared with the promoterless pGL3-Basic vector. The degree of activation was 8–12-fold in Caco2 cells, 2–3-fold in HEK293 cells, and up to 1.7-fold in SK-ChA cells (Fig. 1). Thus ASBT promoter activity was strongest in Caco2 cells, in accordance with real-time PCR experiments that showed the highest endogenous ASBT mRNA levels in Caco2 cells (data not shown). The −1688-Luc construct, that contained only the 5′-flanking sequence without the 5′-UTR, produced no luciferase activity, indicating that factors that bind within the 5′-UTR are essential for minimal promoter function. The importance of HNF1α for expression of theASBT gene became evident in Tcf1−/−(HNF1α−/−) mice with a null mutation in theHNF1α gene (8Shih D.Q. Bussen M. Sehayek E. Ananthanarayanan M. Shneider B.L. Suchy F.J. Shefer S. Bollileni J.S. Gonzalez F.J. Breslow J.L. Stoffel M. Nat. Genet. 2001; 27: 375-382Crossref PubMed Scopus (360) Google Scholar). These mice show no expression of the ASBT (Slc10a2) mRNA in the terminal ileum and kidney and a 6-fold elevation of fecal bile salt concentrations. A single HNF1α binding site, corresponding to nt +253 to +267 in the 5′-UTR of the human ASBT gene (Fig. 2, Table II) was described by Shih et al. (8Shih D.Q. Bussen M. Sehayek E. Ananthanarayanan M. Shneider B.L. Suchy F.J. Shefer S. Bollileni J.S. Gonzalez F.J. Breslow J.L. Stoffel M. Nat. Genet. 2001; 27: 375-382Crossref PubMed Scopus (360) Google Scholar). This site conferred inducibility by coexpressed HNF1α in HIT-T15 cells and bound HNF1α in gel shift mobility assays. Although mutagenesis of the site decreased transactivation by HNF1α, the mutated construct was still activated ∼12-fold by coexpressed HNF1α (8Shih D.Q. Bussen M. Sehayek E. Ananthanarayanan M. Shneider B.L. Suchy F.J. Shefer S. Bollileni J.S. Gonzalez F.J. Breslow J.L. Stoffel M. Nat. Genet. 2001; 27: 375-382Crossref PubMed Scopus (360) Google Scholar). This suggested additional HNF1α binding sites in the human ASBT gene.Table IIHNF1 binding sites located in the 5′-UTR of the human ASBT mRNALocation on ASBT mRNAOrientationHNF1 binding sitent 139–125ComplementaryTGTTAATGtTTcAtGnt 267–253ComplementaryCGTTAATGtTTAAtGnt 318–304ComplementaryGaTTAATCATTtAtTConsensus HNF1 sequenceGTTAATNATTAAC Open table in a new tab Sequence analysis of the human ASBT promoter from nt −1688 to +598 using the program Mat Inspector (Genomatix Software, Munich, Germany) identified two additional HNF1 binding sites at nt +125 to +139 and +304 to +318, both also localized in the 5′-UTR (Fig. 2, Table II). The site at nt +125 to +139 is human-specific compared with the rodentASBT gene sequences (9Chen F., Ma, L., Al Ansari N. Shneider B. J. Biol. Chem. 2001; 276: 38703-38714Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). To assess the role of each of the three HNF1 binding sites in activating the ASBT gene, deletional reporter constructs were characterized in cotransfection assays with an HNF1α expression plasmid. The UTR-Luc construct, which contained all three HNF1 binding sites, was induced 13-fold by cotransfection of an HNF1α expression vector compared with carrier DNA in Caco2 cells (Fig. 2). Cotransfection of HNF1β, which binds to the identical sequence as HNF1α and is expressed in the kidney, liver, pancreas, and intestine (20Cereghini S. FASEB J. 1996; 10: 267-282Crossref PubMed Scopus (472) Google Scholar), had no effect on ASBT promoter activity. A 5′-UTR construct containing only the site at nt 304–318 still conferred a 4.4-fold induction by HNF1α (UTR292–539-Luc in Fig. 2), indicating that this HNF1α element is also functional. A minimal construct containing only nt 324–539 of the 5′-UTR but lacking an HNF1 binding site exhibited residual luciferase activity (∼1.8-fold induction compared with the promoterless pGL3-Basic vector) but was not inducible by HNF1α (UTR324–539-Luc in Fig. 2). Finally, a construct extending from nt 26–251, which contained only the human-specific site at nt 125–139, exhibited no basal luciferase activity compared with the pGL3-Basic vector but was induced 3.8-fold by coexpression of HNF1α (UTR26–251-Luc in Fig. 2). The data thus indicate that all three HNF1α sites in the 5′-UTR of the human ASBT gene are functional response elements that act synergistically to induce gene transcription. This may explain why the complete 5′-UTR is required for full ASBT promoter activity. Because the main objective of this study was to investigate whether a transcriptional mechanism exists that coordinately regulates ASBT and genes involved in hepatic bile salt and lipid metabolism, the ASBT promoter sequence was analyzed for potential binding sites of nuclear receptors. Nuclear receptors have also been termed lipid sensors; important candidates known to regulate other bile salt and lipid transporters include FXR, LXRα, and PPARα (21Chawla A. Repa J.J. Evans R.M. Mangelsdorf D.J. Science. 2001; 294: 1866-1870Crossref PubMed Scopus (1677) Google Scholar). To study whether the ASBT gene promoter is regulated by one of these nuclear receptors, we initially transfected LMH chicken hepatoma cells with the −1688/UTR-Luc and UTR-Luc constructs and with the control vector pGL3-Basic. LMH cells have been used extensively as a model for ligand-dependent activation of endogenously expressed nuclear receptors (22Handschin C. Podvinec M. Stöckli J. Hoffmann K. Meyer U.A. Mol. Endocrinol. 2001; 15: 1571-1585Crossref PubMed Scopus (49) Google Scholar, 23Handschin C. Podvinec M. Meyer U.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 10769-10774Crossref PubMed Scopus (110) Google Scholar). ASBT promoter activity in LMH cells was assayed in the presence or absence of the PPARα ligand ciprofibrate, the LXR ligand, 22(R)-hydroxycholesterol, and the FXR ligand, chenodeoxycholic acid. A 1.75-fold activation of the ASBT promoter construct was observed in the presence of ciprofibrate (Fig.3A), suggesting a possible involvement of PPARα. The UTR-Luc construct, lacking the 5′-flanking region of the ASBT gene, was not inducible by ciprofibrate, indicating that the response element is located in the untranscribed 5′-flanking region of the ASBT gene. Nuclear receptor DNA recognition sites contain consensus hexameric repeat motifs (AGAACA or AGGTCA) that can be organized as direct (DR), everted (ER), or inverted (IR) repeats and are spaced by a defined number of nucleotides (24Waxman D.J. Arch. Biochem. Biophys. 1999; 369: 11-23Crossref PubMed Scopus (666) Google Scholar, 25Giguere V. Endocr. Rev. 1999; 20: 689-725Crossref PubMed Scopus (709) Google Scholar). Using a weighted matrix-based computational approach (26Podvinec M. Kaufmann M.R. Handschin C. Meyer U.A. Mol. Endocrinol. 2002; 16: 1269-1279Crossref PubMed Scopus (152) Google Scholar), no obvious binding sites for FXR or LXRα could be identified. However, a highly conserved binding site arranged as a direct hexanucleotide repeat separated by a single base (DR1 motif, AGGCCAgAGGTCA) was found at position −1565 to −1577 of the human ASBT promoter sequence (Fig. 3). No comparable binding site was detected in the rat ASBT promoter (9Chen F., Ma, L., Al Ansari N. Shneider B. J. Biol. Chem. 2001; 276: 38703-38714Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). The DR1 motif has been shown to bind the PPARα/RXRα heterodimer (27Schoonjans K. Staels B. Auwerx J. J. Lipid Res. 1996; 37: 907-925Abstract Full Text PDF PubMed Google Scholar, 28Ijpenberg A. Jeannin E. Wahli W.
Referência(s)