Portal de Periódicos da CAPES

Purification and Characterization of the Bacterial MraY Translocase Catalyzing the First Membrane Step of Peptidoglycan Biosynthesis

2004; Elsevier BV; Volume: 279; Issue: 29 Linguagem: Inglês

10.1074/jbc.m314165200

1083-351X

Ahmed Bouhss, Muriel Crouvoisier, Didier Blanot, Dominique Mengin‐Lecreulx,

RNA and protein synthesis mechanisms

The MraY translocase catalyzes the first membrane step of bacterial cell wall peptidoglycan synthesis (i.e. the transfer of the phospho-N-acetylmuramoyl-pentapeptide motif onto the undecaprenyl phosphate carrier lipid), a reversible reaction yielding undecaprenylpyrophosphoryl-N-acetylmuramoyl-pentapeptide (lipid intermediate I). This essential integral membrane protein, which is considered as a very promising target for the search of new antibacterial compounds, has thus far been clearly underexploited due to its intrinsic refractory nature to overexpression and purification. We here report conditions for the high level overproduction and for the first time the purification to homogeneity of milligram quantities of MraY protein. The kinetic parameters and effects of pH, salts, cations, and detergents on enzyme activity are described, taking the Bacillus subtilis MraY translocase as a model. The MraY translocase catalyzes the first membrane step of bacterial cell wall peptidoglycan synthesis (i.e. the transfer of the phospho-N-acetylmuramoyl-pentapeptide motif onto the undecaprenyl phosphate carrier lipid), a reversible reaction yielding undecaprenylpyrophosphoryl-N-acetylmuramoyl-pentapeptide (lipid intermediate I). This essential integral membrane protein, which is considered as a very promising target for the search of new antibacterial compounds, has thus far been clearly underexploited due to its intrinsic refractory nature to overexpression and purification. We here report conditions for the high level overproduction and for the first time the purification to homogeneity of milligram quantities of MraY protein. The kinetic parameters and effects of pH, salts, cations, and detergents on enzyme activity are described, taking the Bacillus subtilis MraY translocase as a model. The growing emergence of multiresistance of pathogenic bacteria to currently used antibiotics requires the development of new therapeutic compounds and the identification and exploitation of novel targets (1Walsh C. Nature. 2000; 406: 775-781Crossref PubMed Scopus (1188) Google Scholar). The enzymes of the pathway for cell wall peptidoglycan biosynthesis that are essential for bacterial growth and specific to eubacteria constitute such a set of interesting potential targets that should be explored in detail. Indeed, peptidoglycan, the heteropolymeric mesh of the bacterial cell wall, plays a critical role in protecting bacteria against osmotic lysis. It is also responsible for the maintenance of a defined cell shape and is intimately involved in the cell division process (2Nanninga N. Microbiol. Mol. Biol. Rev. 1998; 62: 110-129Crossref PubMed Google Scholar). The peptidoglycan monomer unit, N-acetylglucosaminyl-β-1,4-N-acetylmuramoyl-pentapeptide (GlcNAc-MurNAc 1The abbreviations used are: MurNAc, N-acetylmuramic acid; UDP-MurNAc-pentapeptide, UDP-N-acetylmuramoyl-l-Ala-γ-d-Glu-meso-diaminopimeloyl-d-Ala-d-Ala; GlcNAc-MurNAc-pentapeptide, GlcNAc-MurNAc-l-Ala-γ-d-Glu-meso-diaminopimeloyl-d-Ala-d-Ala; C55-P, undecaprenyl phosphate; DDM, n-dodecyl-β-d-maltoside; HPLC, high performance liquid chromatography; NTA, nitrilotriacetic acid; IPTG, isopropyl-β-d-thiogalactopyranoside; MALDI-TOF, matrix-assisted laser desorption/ionization time-of-flight; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate; bis-Tris, 2-[bis(2-hydroxyethyl)-amino]-2-(hydroxymethyl)propane-1,3-diol.-pentapeptide), is synthesized by enzymes located in the cytoplasm or at the inner side of the cytoplasmic membrane, and its polymerization, occurring at the outer side of the cytoplasmic membrane, is catalyzed by the penicillin-binding proteins, the targets of the β-lactam antibiotics (3van Heijenoort J. Nat. Prod. Rep. 2001; 18: 503-519Crossref PubMed Scopus (359) Google Scholar). This implies the passage of the monomer unit from the cytoplasm to the periplasm through the hydrophobic environment of the membrane, a process involving the transfer of this hydrophilic unit onto a lipid carrier, undecaprenyl phosphate (C55-P) (3van Heijenoort J. Nat. Prod. Rep. 2001; 18: 503-519Crossref PubMed Scopus (359) Google Scholar, 4Rogers H.J. Perkins H.R. Ward J.B. Microbial Cell Walls and Membranes. Chapman and Hall, London1980: 239-297Crossref Google Scholar). The first membrane step is the transfer of the phospho-MurNAc-pentapeptide moiety onto C55-P, yielding C55-PP-MurNAc-pentapeptide (lipid I), a reaction catalyzed by the MraY enzyme (Scheme 1). Since this reaction consists of the translocation of a peptidoglycan precursor moiety from the cytoplasm to the membrane, the latter enzyme has been named MraY "translocase" (5Neuhaus F.C. Acc. Chem. Res. 1971; 4: 297-303Crossref Scopus (28) Google Scholar). This reaction is reversible, but in vivo it is drawn by coupling to the subsequent reaction catalyzed by the MurG transferase (5Neuhaus F.C. Acc. Chem. Res. 1971; 4: 297-303Crossref Scopus (28) Google Scholar, 6Umbreit J.N. Strominger J.L. J. Bacteriol. 1972; 112: 1306-1309Crossref PubMed Google Scholar, 7Pless D.D. Neuhaus F.C. J. Biol. Chem. 1973; 248: 1568-1576Abstract Full Text PDF PubMed Google Scholar, 8Mengin-Lecreulx D. Texier L. van Heijenoort J. Nucleic Acids Res. 1990; 18: 2810Crossref PubMed Scopus (21) Google Scholar). The MraY translocase is an integral membrane protein whose topology has been recently determined (9Bouhss A. Mengin-Lecreulx D. Le Beller D. van Heijenoort J. Mol. Microbiol. 1999; 34: 576-585Crossref PubMed Scopus (125) Google Scholar); it is composed of 10 transmembrane segments, five cytoplasmic domains, and six periplasmic domains, including the N- and C-terminal ends. The latter model has been established with MraY proteins from Escherichia coli and Staphylococcus aureus and thus appears to be conserved in both Gram-negative and Gram-positive bacteria. Alignment of bacterial MraY sequences shows that the five cytoplasmic domains contain many highly conserved amino acid residues. The presence of the MraY translocase exclusively in bacteria, the fact that it is essential for viability (which has been demonstrated in E. coli and Streptococcus pneumoniae (10Boyle D.S. Donachie W.D. J. Bacteriol. 1998; 180: 6429-6432Crossref PubMed Google Scholar, 11Thanassi J.A. Hartman-Neumann S.L. Dougherty T.J. Dougherty B.A. Pucci M.J. Nucleic Acids Res. 2002; 30: 3152-3162Crossref PubMed Scopus (194) Google Scholar)), its accessibility from the periplasmic space, and the recent identification of some natural inhibitors explain the renewed interest for this target. MraY is inhibited by nonclinically used antibiotics such as tunicamycin, amphomycin, mureidomycin, liposidomycin, and muraymycin (12Bugg T.D. Brandish P.E. FEMS Microbiol. Lett. 1994; 119: 255-262Crossref PubMed Scopus (120) Google Scholar, 13Brandish P.E. Kimura K.I. Inukai M. Southgate R. Lonsdale J.T. Bugg T.D. Antimicrob. Agents Chemother. 1996; 40: 1640-1644Crossref PubMed Google Scholar, 14McDonald L.A. Barbieri L.R. Carter G.T. Lenoy E. Lotvin J. Petersen P.J. Siegel M.M. Singh G. Williamson R.T. J. Am. Chem. Soc. 2002; 124: 10260-10261Crossref PubMed Scopus (181) Google Scholar, 15Ikeda M. Wachi M. Jung H.K. Ishino F. Matsuhashi M. J. Bacteriol. 1991; 173: 1021-1026Crossref PubMed Google Scholar). Recently, simplified analogues of liposidomycin, named riburamycins, have been shown to be powerful MraY inhibitors and to possess antibacterial activities against Gram-positive organisms (16Dini C. Collette P. Drochon N. Guillot J.C. Lemoine G. Mauvais P. Aszodi J. Bioorg. Med. Chem. Lett. 2000; 10: 1839-1843Crossref PubMed Scopus (74) Google Scholar, 17Stachyra T. Dini C. Ferrari P. Bouhss A. van Heijenoort J. Mengin-Lecreulx D. Blanot D. Biton J. Le Beller D. Antimicrob. Agents Chemother. 2004; 48: 897-902Crossref PubMed Scopus (66) Google Scholar). Moreover, this protein has been shown to be the target of the lytic protein LysE of phage ϕX174 (18Bernhardt T.G. Roof W.D. Young R. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4297-4302Crossref PubMed Scopus (111) Google Scholar). However, all studies on MraY reported to date only involved crude membrane preparations as the source of this bacterial enzyme. We here describe the significant overexpression and for the first time the purification to homogeneity of the MraY enzyme as well as detailed investigations of its biochemical properties. N-Lauroyl sarcosine was purchased from USB Corporation; Triton X-100, n-octyl-β-d-glucopyranoside, tunicamycin, UDP-GlcNAc, and ATP were from Sigma; CHAPS was from ICN; n-dodecyl-β-d-maltoside (DDM) was from Fluka; Tween 20 was from VWR; and isopropyl-β-d-thiogalactopyranoside (IPTG) was from Eurogentec. C55-P was provided by the Institute of Biochemistry and Biophysics of the Polish Academy of Sciences. UDP-MurNAc was prepared as described by Blanot et al. (19Blanot D. Auger G. Liger D. van Heijenoort J. Carbohydr. Res. 1994; 252: 107-115Crossref Scopus (20) Google Scholar). l-[14C]Ala and UDP-[14C]GlcNAc were purchased from Perkin-Elmer Life Sciences. The enzymes MurC, MurD, MurE, MurF, and MurG were purified according to previously published procedures (20Liger D. Masson A. Blanot D. van Heijenoort J. Parquet C. Eur. J. Biochem. 1995; 230: 80-87Crossref PubMed Scopus (58) Google Scholar, 21Auger G. Martin L. Bertrand J. Ferrari P. Fanchon E. Vaganay S. Petillot Y. van Heijenoort J. Blanot D. Dideberg O. Protein Expression Purif. 1998; 13: 23-29Crossref PubMed Scopus (46) Google Scholar, 22Gordon E. Flouret B. Chantalat L. van Heijenoort J. Mengin-Lecreulx D. Dideberg O. J. Biol. Chem. 2001; 276: 10999-11006Abstract Full Text Full Text PDF PubMed Scopus (113) Google Scholar, 23Dementin S. Bouhss A. Auger G. Parquet C. Mengin-Lecreulx D. Dideberg O. van Heijenoort J. Blanot D. Eur. J. Biochem. 2001; 268: 5800-5807Crossref PubMed Scopus (48) Google Scholar, 24Crouvoisier M. Mengin-Lecreulx D. van Heijenoort J. FEBS Lett. 1999; 449: 289-292Crossref PubMed Scopus (35) Google Scholar). All other materials were reagent grade and obtained from commercial sources. The E. coli strains DH5α (Invitrogen), BL21(DE3) (Promega), and C43(DE3) (Avidis) were used as hosts for plasmids and for the overproduction of the MraY enzyme. 2YT (25Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1972Google Scholar) was used as a rich medium, and growth was monitored at 600 nm with a Shimadzu UV-1601 spectrophotometer. For strains carrying drug resistance genes, ampicillin and kanamycin were used at 100 and 60 μg·ml–1, respectively. Standard procedures for molecular cloning (26Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: a Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) and cell transformation (27Dagert M. Ehrlich S.D. Gene (Amst.). 1979; 6: 23-28Crossref PubMed Scopus (849) Google Scholar) were used. The Bacillus subtilis mraY gene was amplified from strain 168 chromosome using BS1 and BS2 oligonucleotides as PCR primers (see Table I) and the Expand high fidelity polymerase system (Roche Applied Science). The PCR fragment was cut by BspLU11I and BglII and inserted into the pTrc99A (Amersham Biosciences) and pET28b plasmid vectors (Novagen) opened by compatible sites NcoI and BamHI, generating plasmids pTrcYBS62 and pETYBS62, respectively. In these constructs, the mraY gene was expressed under control of a strong IPTG-inducible promoter, and the encoded MraY protein carried an N-terminal His6 extension. The same procedure was used to clone the mraY genes from E. coli, S. aureus, and Thermotoga maritima, using oligonucleotides EC1 and EC2, SA1 and SA2, and TM1 and TM2, respectively (Table I) and the chromosomal DNA of the concerned bacteria as a template. The resulting plasmids were named pETYEC121 and pTrcYEC121 for E. coli, pETYSA21 and pTrcYSA21 for S. aureus, and pETYTM85 and pTrcYTM85 for T. maritima. These different constructions were verified by DNA sequencing (MWG-Biotech).Table IOligonucleotides used in this studyOligonucleotideSequenceaRestriction sites BspLU11I (ACATGT), NcoI (CCATGG), BglII (AGATCT), BspHI (TCATGA), and BamHI (GGATCC) that were introduced in oligonucleotide sequences are indicated in boldface type. The introduced codons for His tag are underlined.BS1CGTTTACATGTCCCATCACCATCACCATCACATGCTTGAGCAAGTCATTCTGTTTACBS2TGATAGATCTCCACTTATAACCACACCTCGEC1AGGAACATGTCCCATCACCATCACCATCACATGTTAGTTTGGCTGGCCGEC2TAGGAGATCTTTAACGTACCTTCAGCGTTGCCSA1CATGCCATGGTTTTTGTATATGCGTTATTAGCGCSA2TAGGAGATCTTTAGTGATGGTGATGGTGATGCACTCCAATCCATAAACCGTM1CACGTCATGATAGCAGCGAATTTTCTCCTGTM2GACTGGATCCTTAGTGATGGTGATGGTGATGTCCTATCACCCCGAAGATCa Restriction sites BspLU11I (ACATGT), NcoI (CCATGG), BglII (AGATCT), BspHI (TCATGA), and BamHI (GGATCC) that were introduced in oligonucleotide sequences are indicated in boldface type. The introduced codons for His tag are underlined. Open table in a new tab E. coli strain C43(DE3) harboring recombinant plasmid pETYBS62 was grown at 37 °C in 2YT-kanamycin medium (5-liter culture). At an A600 of ∼0.7, IPTG was added at a final concentration of 1 mm, and incubation was continued for 16 h at 25 °C with shaking. Cells were harvested by centrifugation (8,000 × g for 20 min at 4 °C), washed in 100 ml of 25 mm Tris-HCl, pH 7.5, and resuspended in 10 ml of the same buffer containing 2 mm 2-mercaptoethanol, 150 mm NaCl, 30% glycerol, and 1 mm MgCl2 (buffer A). Bacteria were broken by sonication (Bioblock Vibracell sonicator model 72412). The resulting suspension was centrifuged at 200,000 × g for 30 min at 4 °C in a Beckman TL100 centrifuge. The pellet consisting of membranes and associated proteins (14 g wet weight, 1.2 g of proteins) was washed three times with buffer A and then subjected to solubilization by detergents as described below. Membrane vesicles containing the overexpressed MraY protein were resuspended in 20 ml of buffer A. DDM was added at a final concentration of 17.8 mm, and the mixture was incubated at 4 °C for 2 h under shaking. After centrifugation (200,000 × g, 30 min at 4 °C), a first supernatant (DM1) was recovered. The insoluble material was then subjected to a new cycle of solubilization in buffer A containing 21.5 mm DDM. Supernatant DM2 was recovered after centrifugation. Two further rounds of solubilization/centrifugation were performed in the same conditions (21.5 mm DDM), generating supernatants DM3 and DM4, respectively. A similar procedure was used for extraction with other detergents. In that case, two successive treatments were performed, and the final concentration of detergent was 68, 41, 32, and 27.3 mm for n-octyl-β-d-glucopyranoside, CHAPS, Triton X-100, and N-lauroyl sarcosine, respectively. Solubilized membrane proteins were mixed and incubated for 2 h at 4 °C with Ni2+-NTA-agarose (Qiagen) (15 mg of proteins/ml of resin) pre-equilibrated in buffer B (20 mm sodium phosphate, pH 7.2, 300 mm NaCl, 30% glycerol, 3.9 mm DDM, 2 mm 2-mercaptoethanol). After incubation, the resin was transferred to an Econo-Pac chromatography column (Bio-Rad) and washed first with 5 column volumes of buffer B. Further washings and protein elution were performed with increasing concentrations of imidazole, from 5 to 300 mm, in buffer B. After assays for translocase activity and SDS-PAGE analysis, pure MraY protein-containing fractions were freed from imidazole and concentrated using a Vivaspin concentrator (Vivascience) in 30 mm Tris-HCl buffer, pH 7.5, containing 150 mm NaCl, 10% glycerol, and 3.9 mm DDM. Protein concentrations were determined using the QuantiProBCA assay kit (Sigma) and bovine serum albumin as the standard and/or by quantitative amino acid analysis with a Hitachi model L8800 analyzer (ScienceTec) after hydrolysis of samples in 6 m HCl for 24 h at 105 °C. The reaction mixtures contained 100 mm Tris-HCl, pH 8.6, 2 mm dithiothreitol, 30 mm MgCl2, 1 mm UDP-MurNAc, 20 mm ATP, 1.2 mm l-Ala (or 1 mm l-[14C]Ala), 1.2 mm each d-Glu, meso-A2pm, and d-Ala-d-Ala, and 200 units each of enzymes MurC, MurD, MurE, and MurF. After 2 h at 37 °C, the formation of UDP-MurNAc-pentapeptide was followed by analytical HPLC on a column of Nucleosil 5C18 (250 × 4.6 mm; Alltech France) using elution with 50 mm ammonium formate, pH 4.3, at a flow rate of 0.6 ml/min (28Flouret B. Mengin-Lecreulx D. van Heijenoort J. Anal. Biochem. 1981; 114: 59-63Crossref PubMed Scopus (64) Google Scholar). A first purification of UDP-MurNAc-pentapeptide from the reaction mixtures was performed by gel filtration on a column of Sephadex G-25, as previously described (29Mengin-Lecreulx D. Flouret B. van Heijenoort J. J. Bacteriol. 1982; 151: 1109-1117Crossref PubMed Google Scholar). Fractions containing these products, as judged by absorbance at 262 nm or radioactivity measurement, were pooled and lyophilized. The purification was completed by HPLC on a column of Vydac 218TP1022 (250 × 22 mm; Touzart & Matignon) using elution with 50 mm ammonium formate, pH 4.3, at a flow rate of 7 ml/min. The purity of UDP-MurNAc-pentapeptide was checked by analytical HPLC and spectral absorbance analysis, and quantitation was obtained by amino acid analysis of a sample after hydrolysis in 6 m HCl for 16 h at 95 °C. Standard MraY Assay—The assay was performed in a final volume of 10 μl containing 100 mm Tris-HCl, pH 7.5, 40 mm MgCl2, 1.1 mm C55-P, 250 mm NaCl, 0.25 mm UDP-MurNAc-[14C]pentapeptide (337 Bq), and 8.4 mm N-lauroyl sarcosine. The reaction was initiated by the addition of MraY enzyme, and the mixture was incubated for 25 min at 37 °C under shaking with a thermomixer (Eppendorf). For the determination of the Km values, the MraY activity was assayed as described above with various concentrations of one substrate (60 μm to 3.7 mm for UDP-MurNAc-pentapeptide, 70 μm to 1.1 mm for C55-P) while maintaining the other at a fixed value (1.1 mm for C55-P, 0.25 mm for UDP-MurNAc-pentapeptide). Data were fitted to the equation v = VA/(K + A) using the MDFitt software developed by M. Desmadril (UMR 8619 CNRS, Orsay, France). Coupled Assay with MurG—The coupled MraY-MurG assay was carried out in a volume of 10 μl containing 100 mm Tris-HCl, pH 7.5, 40 mm MgCl2, 1.1 mm C55-P, 150 mm NaCl, 0.25 mm UDP-MurNAc-pentapeptide, 0.02 mm UDP-[14C]GlcNAc, 10% Me2SO, 0.6 μg of MurG, and 3.6 mm N-lauroyl sarcosine (or 1.95 mm DDM). The reaction was initiated by the addition of 0.2 μg of MraY, and the mixture was incubated for 25 min at 37 °C under shaking. In all cases, the reaction was stopped by heating at 100 °C for 1 min, and the radiolabeled substrates (UDP-MurNAc-pentapeptide or UDP-GlcNAc) and reaction products (C55-PP-MurNAc-pentapeptide (lipid I) or C55-PP-MurNAc(-pentapeptide)-GlcNAc (lipid II)) were separated by TLC on silica gel plates LK6D (Whatman) using 2-propanol/ammonium hydroxide/water (6:3:1; v/v/v) as a mobile phase. The radioactive spots were located and quantified with a radioactivity scanner (model Multi-Tracemaster LB285; EG&G Wallac/Berthold). One unit of MraY activity corresponds to 1 nmol of lipid I produced per min. An MraY standard assay (scaled up to 50 μl) was performed as described above, except that UDP-MurNAc-pentapeptide was unlabeled. The reaction was stopped by the addition of 50 μl of 6 m pyridinium acetate. Then 100 μl of 1-butanol were added, and the mixture was vortexed for 2 min and centrifuged at 10,000 × g for 5 min. The aqueous and organic phases were recovered. The organic phase was evaporated and taken up in 2-propanol/methanol (1:1; v/v) while the aqueous phase was left intact. Both phases were analyzed by mass spectrometry. MALDI-TOF mass spectra were recorded in the linear mode with delayed extraction on a PerSeptive Voyager-DE STR instrument (Applied Biosystems) equipped with a 337-nm nitrogen laser. MraY—The samples were prepared according to Grüber et al. (30Grüber G. Godovac-Zimmermann J. Link T.A. Coskun Ü. Rizzo V.F. Betz C. Bailer S.M. Biochem. Biophys. Res. Commun. 2002; 298: 383-391Crossref PubMed Scopus (65) Google Scholar); 0.5 μl of MraY preparation was deposited on the plate and allowed to dry. Subsequently, 0.5 μl of matrix solution (10 mg/ml α-cyano-4-hydroxycinnamic acid in 50% (v/v) acetonitrile, 0.1% (v/v) trifluoroacetic acid) was applied to the dried sample and again allowed to dry. Spectra were recorded in the positive ion mode at an acceleration voltage of +25 kV and an extraction delay time of 300 ns. The MurC protein was used as an external calibrant. Lipid I and UDP-MurNAc-pentapeptide—One μl of matrix solution (10 mg/ml 6-aza-2-thiothymine in 20 mm diammonium citrate) was deposited on the plate, followed by 0.5 μl of sample (dissolved in 2-propanol/methanol (1:1; v/v) for lipid I and water for UDP-MurNAc-pentapeptide). After evaporation of the solvents, spectra were recorded in the negative ion mode at an acceleration voltage of –20 kV and an extraction delay time of 100 ns. A mixture of UDP-MurNAc, UDP-MurNAc-l-Ala-d-Glu, and UDP-MurNAc-pentapeptide was used as an external calibrant. The MraY translocase catalyzes the first membrane step of peptidoglycan synthesis, an essential step considered as a very promising target for the search of new antibacterial compounds. It has been clearly underexploited to date, most probably because of the refractory nature of this protein to overexpression and purification. Indeed, all previous attempts to overproduce to high levels the MraY translocase, to purify it, or at least to detect it by SDS-polyacrylamide gel electrophoresis were unsuccessful (31Mengin-Lecreulx D. Parquet C. Desviat L.R. Pla J. Flouret B. Ayala J.A. van Heijenoort J. J. Bacteriol. 1989; 171: 6126-6134Crossref PubMed Google Scholar, 32Brandish P.E. Burnham M.K. Lonsdale J.T. Southgate R. Inukai M. Bugg T.D. J. Biol. Chem. 1996; 271: 7609-7614Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar). In fact, only a radiolabeled form of this protein has been detected to date using in vitro translation experiments (9Bouhss A. Mengin-Lecreulx D. Le Beller D. van Heijenoort J. Mol. Microbiol. 1999; 34: 576-585Crossref PubMed Scopus (125) Google Scholar, 10Boyle D.S. Donachie W.D. J. Bacteriol. 1998; 180: 6429-6432Crossref PubMed Google Scholar). We recently investigated the membrane topology of the E. coli MraY protein and showed that its expression as a fusion with β-lactamase was an advantage for its stability and/or production. A significant but moderate 30-fold increase of MraY activity was detected in cells in which the MraY-BlaM fusion was expressed (9Bouhss A. Mengin-Lecreulx D. Le Beller D. van Heijenoort J. Mol. Microbiol. 1999; 34: 576-585Crossref PubMed Scopus (125) Google Scholar), and the solubilized fusion protein was subsequently used for the development of a high throughput screening assay based on fluorescence detection (17Stachyra T. Dini C. Ferrari P. Bouhss A. van Heijenoort J. Mengin-Lecreulx D. Blanot D. Biton J. Le Beller D. Antimicrob. Agents Chemother. 2004; 48: 897-902Crossref PubMed Scopus (66) Google Scholar). A similar (28-fold) overproduction factor was reported by Brandish et al. (32Brandish P.E. Burnham M.K. Lonsdale J.T. Southgate R. Inukai M. Bugg T.D. J. Biol. Chem. 1996; 271: 7609-7614Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar) when the E. coli mraY gene was cloned in the expression vector pTrc99A. Why the levels of overexpression were in all cases so modest was unclear given the well documented strength of the promoters used. We thus decided to revisit this question by performing a complete set of experiments using mraY genes from various bacterial species, different plasmid vectors, and different host strains and conditions for expression. The mraY genes from E. coli, S. aureus, T. maritima, and B. subtilis were amplified by PCR and cloned into the pTrc99A and pET28b expression vectors. In all of these constructs, the mraY gene product was expressed with a His6 tag extension to allow its easy purification on Ni2+-NTA-agarose. Strain C43(DE3), which is particularly well adapted for high level expression of membrane proteins (33Miroux B. Walker J.E. J. Mol. Biol. 1996; 260: 289-298Crossref PubMed Scopus (1578) Google Scholar), was chosen as the host strain, since the extent of MraY overexpression in that strain was systematically about 5-fold higher than that observed in the other E. coli strains tested (DH5α and BL21(DE3)). In the case of B. subtilis MraY, expression from pTrc99A and pET28b vectors resulted in 25- and 145-fold increased levels of translocase activity, respectively, when cells were grown and induced at 37 °C and 5- and 330-fold, respectively, when cells were first grown at 37 °C and then induced at 25 °C. Similar results were obtained with MraY from E. coli, S. aureus, and T. maritima (Table II). We therefore essentially used pET28b-derivative plasmids and induction at 25 °C in all subsequent experiments.Table IIExtent of MraY overexpression in different host strainsHost strainsOverexpression factoraOverexpression factors as compared to the levels of MraY activity detected in membranes of control cells without plasmid: 0.1, 0.21, and 0.19 units/mg of proteins for DH5α, BL21(DE3), and C43(DE3), respectively.B. subtilis MraYT. maritima MraYS. aureus MraYE. coli MraYpET28bpTrc99ApET28bpTrc99ApET28bpTrc99ApET28bpTrc99ADH5α819ND30ND14ND61BL21(DE3)62678ND56ND160NDC43(DE3)3345190ND287ND456NDa Overexpression factors as compared to the levels of MraY activity detected in membranes of control cells without plasmid: 0.1, 0.21, and 0.19 units/mg of proteins for DH5α, BL21(DE3), and C43(DE3), respectively. Open table in a new tab Small scale cultures (50 ml) were then performed to identify the best MraY candidate to purify (i.e. the one, among the aforementioned species, exhibiting the best compromise between overexpression level and enzyme stability during the extraction and purification steps). Membrane proteins of IPTG-induced and noninduced cells were solubilized with DDM and tested for MraY activity. Cells carrying the different mraY-overexpressing plasmids all contained a similar 100–500-fold increased level of MraY activity in membranes when induced with IPTG. At this step, however, no significant increase of a protein band that could correspond to MraY (calculated mass of about 36 kDa) was detected by SDS-PAGE analysis of the extracts (data not shown). Various detergents (N-lauroyl sarcosine, DDM, Triton X-100, n-octyl-β-d-glucopyranoside, and CHAPS) were then tested for their efficiency to extract the MraY proteins from the membranes and to maintain them in an enzymatically active form (Table III). N-Lauroyl sarcosine and DDM appeared more efficient than the other detergents for MraY extraction. However, the ionic detergent N-lauroyl sarcosine did not allow a sufficient binding of MraY on Ni2+-NTA-agarose, the resin used for the final step of purification. Most of the MraY protein was eluted at very low concentrations of imidazole (5–20 mm) and was thus only poorly purified in these conditions. In the case of DDM, the affinity of MraY for the resin was much better, and the purification of a protein eluted at higher concentrations of imidazole, ranging from 20 to 300 mm, was observed. Since the protein yield and purification state appeared significantly higher in the case of the B. subtilis MraY protein coded by the pETYBS62 plasmid (N-terminal His6-tagged form), the latter was chosen for large scale purification and enzyme characterization experiments.Table IIIEfficiency of different detergents to extract various overexpressed MraY orthologs from E. coli membranesExtracted MraY activityMDDMn-Octyl-β-d-glucopyranosideCHAPSTriton X-100N-Lauroyl sarcosine1212121212%%%%%%%%%%%B. subtilis MraY100aThe total MraY activity in the membranes, taken as 100%, was 900, 525, 775, and 1320 units for cells overexpressing the MraY protein from B. subtilis, T. maritima, S. aureus, and E. coli, respectively.339311091318125044T. maritima MraY100156145307534174033S. aureus MraY1008504068628124145E. coli MraY10084730179825135338a The total MraY activity in the membranes, taken as 100%, was 900, 525, 775, and 1320 units for cells overexpressing the MraY protein from B. subtilis, T. maritima, S. aureus, and E. coli, respectively. Open table in a new tab Overproduction and Purification of B. subtilis MraY—The sequence of the B. subtilis mraY gene amplified from strain 168 and cloned into pETYBS62 plasmid showed some minor differences from that found in databases (Pasteur data base, available on the World Wide Web at genolist.pasteur.fr/SubtiList/); the sequence 589CGTGAT594 (coding for RD) repeatedly appeared as GCTCAT (coding for AH) in the products from several independent PCRs using high fidelity polymerase. The molecular mass calculated for the B. subtilis MraY protein was 36,568 Da, taking into account the N-terminal extension tag consisting in Met-Ser-His6. A 5-liter culture of E. coli C43DE3(pETYBS62) was induced with IPTG, and membranes were prepared and tested for MraY activity. As previously observed with 50-ml cultures, the specific activity in this crude membrane extract was about 300-fold higher than that detected in control cells carrying the pET28b vector (66 versus 0.2 units/mg of protein, respectively). The extraction of the MraY protein was achieved by four successive treatments of membranes with DDM: one with 17.8 mm DDM (extract DM1) followed by three with 21.5 mm DDM (extracts DM2–DM4). Table IV recapitulates the levels of MraY activity detected in these different extracts. The differential extraction with DDM allowed us to remove a large amount of proteins but only little of the MraY activity in DM1. About one-third of the total MraY activity was recovered in DM2, with a 20% increase in specific activity. Protein amount