The FabR (YijC) Transcription Factor Regulates Unsaturated Fatty Acid Biosynthesis in Escherichia coli
2002; Elsevier BV; Volume: 277; Issue: 18 Linguagem: Inglês
10.1074/jbc.m201399200
ISSN1083-351X
AutoresYongmei Zhang, Hédia Marrakchi, Charles O. Rock,
Tópico(s)RNA and protein synthesis mechanisms
ResumoUnsaturated fatty acid biosynthesis is a vital facet of Escherichia coli physiology and requires the expression of two genes, fabA and fabB, in the type II fatty acid synthase system. This study links the FabR (YijC) transcription factor to the regulation of unsaturated fatty acid content through the regulation of fabB gene expression. TheyijC (fabR) gene was deleted by replacement with a selectable cassette, and the resulting strains (fabR::kan) possessed significantly elevated levels of unsaturated fatty acids, particularlycis-vaccenate, in their membrane phospholipids. The altered fatty acid composition was observed in thefabR::kan fabF1 double mutant pinpointing fabB as the condensing enzyme responsible for the increased cis-vaccenate production. ThefabR::kan strains had 4- to 8-fold higher levels of fabB and a 2- to 3-fold increase infabA transcripts as judged by Northern blotting, Affymetrix array analysis, and real-time PCR. FabR did not regulate the enzymes of fatty acid β-oxidation. The elevated level offabB mRNA was reflected by higher condensing enzyme activity in fabR::kan fabF1 double mutants. Thus, FabR functions as a repressor that potently controls the expression of the fabB gene, which in turn, modulates the physical properties of the membrane by altering the level of unsaturated fatty acid production. Unsaturated fatty acid biosynthesis is a vital facet of Escherichia coli physiology and requires the expression of two genes, fabA and fabB, in the type II fatty acid synthase system. This study links the FabR (YijC) transcription factor to the regulation of unsaturated fatty acid content through the regulation of fabB gene expression. TheyijC (fabR) gene was deleted by replacement with a selectable cassette, and the resulting strains (fabR::kan) possessed significantly elevated levels of unsaturated fatty acids, particularlycis-vaccenate, in their membrane phospholipids. The altered fatty acid composition was observed in thefabR::kan fabF1 double mutant pinpointing fabB as the condensing enzyme responsible for the increased cis-vaccenate production. ThefabR::kan strains had 4- to 8-fold higher levels of fabB and a 2- to 3-fold increase infabA transcripts as judged by Northern blotting, Affymetrix array analysis, and real-time PCR. FabR did not regulate the enzymes of fatty acid β-oxidation. The elevated level offabB mRNA was reflected by higher condensing enzyme activity in fabR::kan fabF1 double mutants. Thus, FabR functions as a repressor that potently controls the expression of the fabB gene, which in turn, modulates the physical properties of the membrane by altering the level of unsaturated fatty acid production. acyl carrier protein β-hydroxydecanoyl-ACP dehydratase β-ketoacyl-ACP synthase I β-ketoacyl-ACP synthase II saturated fatty acid unsaturated fatty acid fatty acid degradation regulator fatty acid biosynthesis regulator Unsaturated fatty acid biosynthesis is required to maintain membrane structure and function in Escherichia coli and many other organisms. E. coli possesses a type II fatty acid synthase system, and the double bond is introduced into the growing acyl chain at the ten-carbon β-hydroxydecanoyl-ACP1intermediate (for reviews, see Refs. 1Cronan Jr., J.E. Rock C.O. Neidhardt F.C. Curtis R. Gross C.A. Ingraham J.L. Lin E.C.C. Low K.B. Magasanik B. Reznikoff W. Riley M. Schaechter M. Umbarger H.E. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology, Washington, D. C.1996: 612-636Google Scholar, 2Rock C.O. Cronan Jr., J.E. Biochim. Biophys. Acta. 1996; 1302: 1-16Crossref PubMed Scopus (287) Google Scholar). Early genetic studies identified two genes, fabA and fabB, that were essential for olefin formation. Inactivating mutations in either one of these genes leads to an absolute requirement for unsaturated fatty acids for growth (1Cronan Jr., J.E. Rock C.O. Neidhardt F.C. Curtis R. Gross C.A. Ingraham J.L. Lin E.C.C. Low K.B. Magasanik B. Reznikoff W. Riley M. Schaechter M. Umbarger H.E. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology, Washington, D. C.1996: 612-636Google Scholar). FabA introduces the double bond into the acyl chain through its dual activities as a β-hydroxydecanoyl-ACP dehydratase and a trans-2,cis-3-decanoyl-ACP isomerase (3Bloch K. Boyer P.D. The Enzymes. Academic Press, New York1971: 441-464Google Scholar). Because there is a second β-hydroxyacyl-ACP dehydratase (FabZ) that only produces the trans-2 isomer (4Mohan S. Kelly T.M. Eveland S.S. Raetz C.R.H. Anderson M.S. J. Biol. Chem. 1994; 269: 32896-32903Abstract Full Text PDF PubMed Google Scholar,5Heath R.J. Rock C.O. J. Biol. Chem. 1996; 271: 27795-27801Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar), unsaturated fatty acid formation also depends on the ability of the type II system to efficiently divert the cis-3 intermediate to the unsaturated branch of the elongation pathway. The FabB-condensing enzyme fulfills this function presumably by efficiently catalyzing the elongation of cis-3-decenoyl-ACP (1Cronan Jr., J.E. Rock C.O. Neidhardt F.C. Curtis R. Gross C.A. Ingraham J.L. Lin E.C.C. Low K.B. Magasanik B. Reznikoff W. Riley M. Schaechter M. Umbarger H.E. Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology. American Society for Microbiology, Washington, D. C.1996: 612-636Google Scholar, 2Rock C.O. Cronan Jr., J.E. Biochim. Biophys. Acta. 1996; 1302: 1-16Crossref PubMed Scopus (287) Google Scholar). ThefabA and fabB genes are always found together in bacterial genomes (6Campbell J.W. Cronan Jr., J.E. Annu. Rev. Microbiol. 2001; 55: 305-332Crossref PubMed Scopus (407) Google Scholar), supporting the idea that these two gene products work in tandem to generate unsaturated fatty acids. FadR is a transcriptional regulator that modulates the expression of the fabB and fabA genes. FadR was discovered through the analysis of a mutation that results in the constitutive induction of the β-oxidation enzymes (7Overath P. Pauli G. Schairer H.U. Eur. J. Biochem. 1969; 7: 559-574Crossref PubMed Scopus (192) Google Scholar), and led to its characterization as a repressor of fatty acid β-oxidation genes (8DiRusso C.C. Nunn W.D. J. Bacteriol. 1985; 161: 583-588Crossref PubMed Google Scholar). FadR is released from its DNA binding sites by long-chain acyl-CoAs (9DiRusso C.C. Heimert T.L. Metzger A.K. J. Biol. Chem. 1992; 267: 8685-8691Abstract Full Text PDF PubMed Google Scholar, 10Raman N. DiRusso C.C. J. Biol. Chem. 1995; 270: 1092-1097Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar, 11DiRusso C.C. Tsvetnitsky V. Højrup P. Knudsen J. J. Biol. Chem. 1998; 273: 33652-33659Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 12Cronan Jr., J.E. J. Bacteriol. 1997; 179: 1819-1823Crossref PubMed Google Scholar), which bind to the carboxyl terminus of the protein and release the amino-terminal winged helix domain from the DNA (13van Aalten D.M. DiRusso C.C. Knudsen J. Wierenga R.K. EMBO J. 2000; 19: 5167-5177Crossref PubMed Scopus (108) Google Scholar, 14Xu Y. Li R.J. Heath Z. Rock C.O. White S.W. J. Biol. Chem. 2001; 276: 17373-17379Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 15van Aalten D.M. DiRusso C.C. Knudsen J. EMBO J. 2001; 20: 2041-2050Crossref PubMed Scopus (128) Google Scholar). An interesting twist in the FadR story began with the observation thatfabA(Ts) fadR double mutants were unable to grow at the permissive temperature without an unsaturated fatty acid supplement (16Nunn W.D. Giffin K. Clark D. Cronan Jr., J.E. J. Bacteriol. 1983; 154: 554-560Crossref PubMed Google Scholar). This suggested a positive effect of FadR onfabA expression, and it was soon demonstrated that FadR is a transcriptional activator that binds to the −40 region of thefabA gene, a site common for activators of σ70-responsive promoters (17Henry M.F. Cronan Jr., J.E. J. Mol. Biol. 1991; 222: 843-849Crossref PubMed Scopus (85) Google Scholar, 18Henry M.F. Cronan Jr., J.E. Cell. 1992; 70: 671-679Abstract Full Text PDF PubMed Scopus (122) Google Scholar). FadR is also a positive regulator of the fabB gene, although the changes infabB expression in fadR mutants are not as great as with fabA (19Campbell J.W. Cronan Jr., J.E. J. Bacteriol. 2001; 183: 5982-5990Crossref PubMed Scopus (97) Google Scholar). Thus, FadR acts as a repressor of β-oxidation genes and an activator of the two genes required for unsaturated fatty acid synthesis (20Cronan Jr., J.E. Subrahmanyam S. Mol. Microbiol. 1998; 29: 937-943Crossref PubMed Scopus (101) Google Scholar). The promoter regions of the fabA and fabB genes are highly related, suggesting that their expression is similarly regulated. The FadR binding site is not the only region of sequence similarity in the fabB and fabA promoters, and their alignment is shown in Fig. 1 with the sites of transcription initiation indicated by the arrows for both fabA(18Henry M.F. Cronan Jr., J.E. Cell. 1992; 70: 671-679Abstract Full Text PDF PubMed Scopus (122) Google Scholar) and fabB (21Kauppinen S. Siggaard-Anderson M. van Wettstein-Knowles P. Carlsberg. Res. Commun. 1988; 53: 357-370Crossref PubMed Scopus (118) Google Scholar). Recently, McCue et al. (22McCue L. Thompson W. Carmack C. Ryan M.P. Liu J.S. Derbyshire V. Lawrence C.E. Nucleic Acids Res. 2001; 29: 774-782Crossref PubMed Scopus (210) Google Scholar) used a bioinformatic "phylogenetic footprinting" method to identify putative transcription factor binding sites in bacterial genomes and located a strongly predicted site in the promoter regions of thefabA and fabB genes. They went on to show that a protein, YijC, specifically bound to a DNA affinity column carrying the predicted transcription factor palindrome (Fig. 1). The oligonucleotide 5′-GGCGTACAAGTGTACGCT was used to isolate YijC protein from E. coli cell-free extracts (22McCue L. Thompson W. Carmack C. Ryan M.P. Liu J.S. Derbyshire V. Lawrence C.E. Nucleic Acids Res. 2001; 29: 774-782Crossref PubMed Scopus (210) Google Scholar). The YijC binding sequence onfabB consists of a central CGTACAXXTGTACG palindrome, whereas the predicted site in fabA has a 2-bp mismatch (Fig. 1). Based on the location of these binding sites, McCue et al. (22McCue L. Thompson W. Carmack C. Ryan M.P. Liu J.S. Derbyshire V. Lawrence C.E. Nucleic Acids Res. 2001; 29: 774-782Crossref PubMed Scopus (210) Google Scholar) proposed renaming the yijC gene fabR for FattyAcid Biosynthesis Regulator. However, there are no direct data demonstrating that FabR actually influences the levels of fabA or fabB mRNA or alters the production of unsaturated fatty acids by the pathway. The goal of this study was to determine whether FabR (YijC) regulates unsaturated fatty acid formation by examining the effects of deleting this gene on fatty acid metabolism. [α-32P]dCTP (3000 Ci/mmol) and [2-14C]malonyl-CoA (55 mCi/mmol) were purchased from Amersham Biosciences, Inc.. Restriction enzymes and other molecular biology reagents were from Promega Life Science, Invitrogen, and New England BioLabs. ACP was purchased from Sigma Chemical Co., and myristoyl-ACP was prepared using the acyl-ACP synthetase method (23Rock C.O. Garwin J.L. Cronan Jr., J.E. Methods Enzymol. 1981; 72: 397-403Crossref PubMed Scopus (44) Google Scholar). The E. coli strains that we use in this study and their relevant genotypes are listed in TableI. Plasmid pDM4 (24de Mendoza D. Klages Ulrich A. Cronan Jr., J.E. J. Biol. Chem. 1983; 258: 2098-2101Abstract Full Text PDF PubMed Google Scholar), expressing thefabB gene, was constructed by cloning fabB with its promoter into pBR322, and plasmid pSJ21, expressing thefabA gene, was constructed by cloning the fabAinto pBluescript. Transductions with P1 phage were performed as described previously by Miller (25Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1972Google Scholar). DNA sequencing, Affymetrix microarray analysis, and oligonucleotide synthesis were performed by the Hartwell Center at St. Jude.Table IBacterial strains used in this studyStrainRelevant genotype/plasmidSourceUB1005metB1 relA1 spoT1 gyrA216λ− λr F−(41)PDJ1recD::Tn10P1(CAG12135) × UB1005ANS8fabR::kanP1(MWF1) × UB1005MWF1fabR::kan recD::Tn10"Experimental Procedures"JT10UB1005/pDM4"Experimental Procedures"MWF2recD::Tn10/pSJ21(fabB)"Experimental Procedures"SJ109fabF1P1(CY288)1-aStrain CY288 is described in Ref. 31. × UB1005ANS7fabR::kan fabF1P1(MWF1) × SJ109PDJ14fadR::Tn10P1(RW11) × UB1005ANS4fabR::kan fadR::Tn10P1(MWF1) × PDJ141-a Strain CY288 is described in Ref. 31Garwin J.L. Klages A.L. Cronan Jr., J.E. J. Biol. Chem. 1980; 255: 11949-11956Abstract Full Text PDF PubMed Google Scholar. Open table in a new tab The gene targeting strategy shown in Fig. 2A was used to generate afabR deletion strain of E. coli. The 813-bp fragment upstream of fabR was amplified by PCR with primers PS (5′-CGCGAGCTCACATCTGTTGGATGATATGG, aSacI site is underlined) and PBr(5′-CGCGGATCCCATCACGATGTCTGAATCC, a BamHI site is underlined). The SacI-BamHI-digested 813-bp fragment was cloned into SacI-BamHI site of pUC19. The 788-bp fragment downstream of fabR was amplified similarly by PCR with primers PBf(5′-CGCGGATCCATGTGAAGGACGAGTAATG, a BamHI site is underlined) and PH (5′- CCCAAGCTTATACAACATCGCAGCTAAC, a HindIII site is underlined). Then the BamHI-HindIII-digested 788-bp fragment was inserted into theBamHI-HindIII site of the plasmid harboring the 813-bp upstream fragment. The BamHI-digested kanamycin-resistant gene fragment was cloned into the BamHI site of the plasmid harboring both the upstream (813-bp) and downstream (788-bp) PCR fragments, yielding plasmid pUCFabRK. This plasmid was digested with SacI and AflIII. The 3.3-kb fragment, containing both PCR fragments, kanamycin gene-replacingfabR and a 350-bp fragment of pUC19, was purified from 1% agarose gel. The 3.3-kb linear DNA (25 ng) was transformed into strain PDJ1 (recD) by electroporation, and kanamycin-resistant transformants were isolated. ThefabR::kan strain grew with the same doubling time as the wild type on both rich and minimal media. PCR and Southern blot analyses were used to confirm the genotype of the fabRdeletion strain. PCR experiments were performed with a primer pair, P1 (5′-GATCACTCCAGCACCATAG) and P2 (5′-TTACTGGAGCTGTACTGCG), to amplify a fragment encompassing 1 kb both upstream and downstream offabR. The PCR products from both wild type andfabR::kan strains were digested with enzymes NcoI, BamHI, and HindIII individually. Two other primer pairs, P1 and PK1(5′-ATCTTGTGCAATGTAACATCAGAG), PK2(5′-AGTCAGCAACACCTTCTTCACG) and P2, were used to amplify two 1-kb fragments in fabR::kan strain. The PCR products were purified from 1% agarose gel, and DNA sequencing was performed in the Hartwell Center with ABI Prism 3700 DNA analyzer. Southern blots were performed on genomic DNA isolated from both wild type and fabR::kan strains by the phenol/chloroform/isoamyl alcohol extraction method (26Murray M.G. Thompson W.F. Nucleic Acids Res. 1980; 8: 4321-4325Crossref PubMed Scopus (9099) Google Scholar). Three different restriction enzymes, NdeI, EcoRI, andScaI, were used to digest 5 μg of genomic DNA. The digested genomic DNA was separated by electrophoresis on a 0.8% agarose gel. The probe was the 230-bp ClaI-ScaI fragment downstream of fabR (Fig. 2A), and was labeled with [α-32P]dCTP. Southern transfer, hybridization, and washing were carried out by standard procedures (27Brown T. Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Current Protocols in Molecular Biology. John Wiley & Sons, Inc., New York1994: 2.9.1-2.10.16Google Scholar). Bands were detected with a Molecular Dynamics Storm 860 imager, and their intensity was determined using the ImageQuaNT 5.1 program. Total RNA was isolated from exponentially growing cells, both wild type andfabR::kan, using a MasterPure RNA purification kit (Epicentre Technologies). The same RNA sample was used for Northern blot, Affymetrix array, and TaqMan RT-PCR analyses. Briefly, cell pellets from 40-ml cultures were resuspended in lysis buffer (containing 0.17 mg/ml proteinase K) and incubated at 65 °C for 15 min. After removing the debris and proteins by centrifugation, the RNA was precipitated with isopropanol. The remaining DNA was removed by treating RNA preparations with DNase I (0.025 unit/μl) at 37 °C for 20 min. RNA samples were isopropanol-precipitated, washed twice with 75% ethanol, and redissolved in TE. Northern blots were performed with 10 μg of total RNA separated by electrophoresis on a 1% agarose formaldehyde gel. The probes were the 320-bp HincII-MunI fragment of plasmid pSJ21 (forfabA) and the 280-bp EcoRI-ClaI fragment of pDM4 (for fabB). Northern transfer, hybridization, and washing were performed using standard procedures (28Brown T. Mackey K. Ausubel F.M. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Current Protocols in Molecular Biology. John Wiley & Sons, New York1994: 4.9.2-4.9.8Google Scholar). Detection and quantitation of the blot was performed using a Molecular Dynamics Storm 860 imager. Staining the membrane with methylene blue assessed equal loading of the samples, and the intensity of the bands was consistent in all lanes. Affymetrix array analyses were performed using messenger RNA species enriched by the specific degradation of the 16 S and 23 S ribosomal RNAs, which constitute 90% of the total prokaryotic RNA population. Moloney murine leukemia virus reverse transcriptase (Epicentre Technologies) and primers specific to 16 S and 23 S rRNA were used to synthesize the complementary cDNAs. Then rRNAs were removed enzymatically by treatment with RNase H. The cDNA molecules were degraded by DNase I digestion, and the enriched mRNAs were purified using Qiagen RNeasy columns. The RNA was fragmented by heat and ion-mediated hydrolysis, and the 5′-end RNA termini were enzymatically modified by T4 polynucleotide kinase and ATPγS. A biotin group was then conjugated to the thiolated RNA. After purification of the product (using the RNA/DNA mini kit, Qiagen), the efficiency of the labeling was assessed using a gel-shift assay based on the retardation of the biotinylated RNA upon addition of NeutrAvidin molecules. 1.5–4.0 μg of fragmented RNA (biotin-labeled target) was hybridized for 16 h at 45 °C to E. coli oligonucleotide arrays (Affymetrix) containing all known E. coli genes together with more than 2700 probe sets designed to intergenic sequences. Arrays were washed at 25 °C with 6 × SSPE (0.9 m NaCl, 60 mmNaH2PO4, 6 mm EDTA, and 0.01% Tween 20) followed by a stringent wash at 50 °C with 100 mm MES, 0.1 m NaCl, 0.01% Tween 20. The arrays were then stained with phycoerythrin-conjugated streptavidin (Molecular Probes), and the fluorescence intensities were determined using a laser confocal scanner (Hewlett-Packard). The scanned images were analyzed using Microarray software (Affymetrix). Sample loading and variations in staining were standardized by scaling the average of the fluorescence intensities of all genes on an array to a constant target intensity for all arrays used. The expression data were analyzed as previously described (29Lockhart D.J. Dong H. Byrne M.C. Follettie M.T. Gallo M.V. Chee M.S. Mittmann M. Wang C. Kobayashi M. Horton H. Brown E.L. Nat. Biotechnol. 1996; 14: 1675-1680Crossref PubMed Scopus (2786) Google Scholar). The signal intensity for each gene was calculated as the average intensity difference, represented by the formula, ∑(PM − MM)/number of probe pairs, where PM and MM denote perfect-match and mismatch probes. Oligonucleotide primers and probes for real-time RT-PCR were designed with Primer Express 1.0 software (ABI Prism, PerkinElmer Life Sciences/Applied Biosystems), and the probes were purchased from Applied Biosystems. The probes consisted of an oligonucleotide labeled at the 5′-ends with the reporter dyes, 3FAM or VIC, and at the 3′-ends with the quencher dye TAMRA (PE Applied Biosystems) and are listed in Table II.Table IITaqMan primers and probes (5′ → 3′)GeneForward primerProbe, 5′-VIC or FAM and 3′-TAMRAReverse primeracpPAGCTGGTAATGGCTCTGGAAGAVIC-AGTTTGATACTGAGATTCCGGACGAAGACTGAACGGTGGTGATTTTCTCAfabACTCTGGTCGCGGTGAACTGTFAM-TGGCGCTAAAGGCCCGCAATTGGGTCCATCATCAGCATGTTCGfabBCTGGCGCGTGGTGCTCFAM-TGAAATCGTTGGCTACGGCGCAACAACCATGTCTGCACCATCAG Open table in a new tab The reverse transcription was performed on total RNA prepared as above after a second step of DNase I treatment (DNA-free, AMBION). The reverse transcription mixture (20 μl) contained 500 ng of total RNA, 10 ng/μl random hexamers (Invitrogen), 33 units of RNAguard Ribonuclease inhibitor (Amersham Biosciences, Inc.), and 20 units/μl Superscript II reverse transcriptase (Invitrogen). Aliquots (1 μl) of the reverse transcription reaction were added to the real-time PCR reaction (30 μl) containing 600 nm of each forward and reverse primer and 166 nm of probe. Amplification and detection of specific products was performed with the ABI Prism 7700 sequence detection system (PE Applied Biosystems) with the following profile: 1 cycle at 50 °C, 1 cycle at 95 °C for 10 min, 40 cycles at 95 °C for 15 s, and 60 °C for 1 min. The critical threshold cycle (CT) is defined as the cycle at which the fluorescence becomes detectable above background and is inversely proportional to the logarithm of the initial template molecules. The CT values were used to calculate the relative number of fabA and fabB cDNA molecules in wild type and fabR::kanmutant. The quantity of cDNA for each experimental gene was normalized to the quantity of acpP cDNA in each sample. Cultures (10 ml) ofE. coli strains were grown to mid-log phase in M9 minimal medium (25Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1972Google Scholar) supplemented with 0.4% glucose, 0.01% methionine, 0.0005% thiamin, and harvested by centrifugation. The cell pellet was suspended in 1 ml of water, and the lipids were extracted as described by Bligh and Dyer (30Bligh E.G. Dyer W.J. Can. J. Biochem. Physiol. 1959; 37: 911-917Crossref PubMed Scopus (41848) Google Scholar) and fatty acid methyl esters were prepared by the addition of 2 ml of HCl/methanol to the dry extract. The fatty acid methyl esters were fractionated using a Hewlett-Packard Model 5890 gas chromatograph equipped with a flame ionization detector and a glass column (2 m by 4 mm, internal diameter) containing 3% SP2100 coated on Supelcoport (100/120 mesh) operated at 190 °C. Fatty acid methyl esters were identified by comparing their retention times with standards (Matreya). The condensing enzyme activity assay was essentially the same as described previously (31Garwin J.L. Klages A.L. Cronan Jr., J.E. J. Biol. Chem. 1980; 255: 11949-11956Abstract Full Text PDF PubMed Google Scholar). Cultures (20 ml) of E. coli strains (fabF1 andfabR::kan fabF1) were grown to mid-log phase in M9 minimal medium (25Miller J.H. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1972Google Scholar) supplemented with 0.4% glucose, 0.01% methionine, 0.0005% thiamin, and harvested by centrifugation. The cell pellet was suspended in 5 ml of 20 mm Tris-HCl, pH 7.6, containing 1 mm EDTA and 1 mm dithiothreitol. Cells were lysed by two passages through a French press cell at 20,000 p.s.i. The total cell lysate was centrifuged at 50,000 rpm at 4 °C for 1 h. The cell-free extract, a supernatant from ultracentrifugation, was saved for the assay. Protein content in the cell-free extract was determined with the Bradford assay using γ-globulin as the standard (32Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (211983) Google Scholar). The condensation assay contained 45 μm myristoyl-ACP, 50 μm[2-14C]malonyl-CoA, 100 μm ACP, 25 ng of FabD (malonyl-CoA:ACP transacylase) and the indicated concentrations of cell-free extract (0.1–1 μg) in a final volume of 40 μl. The mixtures were incubated at 37 °C for 15 min and then reduced with borohydride, extracted into toluene, and quantitated by scintillation counting. One unit of condensing enzyme activity corresponds to the formation of 1 μmol of β-[14C]ketohexadecanoyl-ACP per minute. A targeting construct was prepared that replaced the fabR(yijC) gene with a kanamycin-resistance cassette as described under "Experimental Procedures," and the linearized fragment was transformed into strain PDJ1 (recD). Kanamycin-resistant transformants were selected, and a combination of PCR and Southern blot analysis were used to verify that the kanamycin gene was inserted in place of fabR in the correct position in the genome. Primers P1 and P2 were designed outside the sequence that was used in the targeting construct for linear transformation (Fig. 2A). Substitution of the kanamycin gene for fabR increased the size of the PCR product from these two primers by 600 bp. Thus, the PCR product from the fabR::kan strain with P1 and P2 was 3 kb in length (Fig. 2B, lane 2) compared with the 2.4-kb product from wild type cells (Fig. 2B, lane 1). When these two PCR products were digested with three restriction enzymes (Fig. 2B, lanes 3 and6, NcoI; lanes 4 and 7,BamHI; and lanes 5 and 8,HindIII), the products were of the predicted sizes (Fig.2B). Sequence results of the PCR products read through the junction regions where the kanamycin gene was inserted (data not shown). PK1 and PK2 were designed from sequence of the kanamycin gene. PCR reactions with the two primer pairs, P1 and PK1, PK2 and P2, produced products of the correct size (1 kb) in the fabR::kanstrain indicating the presence of the kanamycin gene in the correct locations, whereas no products were detected with these two primer sets in wild type cells (data not shown). Results from Southern blot analysis with the 230-bpClaI-ScaI fragment corroborated the PCR results confirming that the kanamycin gene-replaced fabR gene in strain MWF1 was in the correct location without compromising the neighboring genes. The probe hybridized with a 650-bp fragment of wild type genomic DNA digested with NdeI (Fig. 2C,lane 5). The NdeI restriction site in thefabR gene disappeared in the fabR deletion strain, resulting in the probe hybridizing with a 3.2-kb fragment (Fig.2C, lane 6). The probe also recognized bands of the correct sizes in the EcoRI and ScaI digests (Fig. 2C). In the case of thefabR::kan strain, the fragments were larger by 600 bp due to the presence of the kanamycin gene in place offabR. The effect of FabR deletion on the production of the major membrane fatty acids of E. coli was determined. Strain PDJ1 synthesized slightly more saturated fatty acids (SFA) than unsaturated fatty acids (UFA). The UFA:SFA ratio was 0.87, and the amount ofcis-vaccenate (C18:1Δ11) and palmitoleate (C16:1Δ9) was approximately the same (TableIII). 2The fatty acids are abbreviated as: 18:1Δ11, number of carbon atoms:number of double bonds; Δ, the location of the double bond.Strain MWF1 (fabR::kan) produced significantly more UFA increasing the UFA/SFA ratio to 1.77. Unlike the wild type cells, C18:1Δ11 was the predominant UFA species in thefabR::kan strain. A similar alteration of fatty acid composition was observed in cells that expressedfabB from a multicopy plasmid (pDM4) (Table III). In both cases, the 18:1/16:1 ratio was significantly increased (Table III). The similarity between the fatty acid composition alterations due to FabB overexpression (Table III and Ref. 24de Mendoza D. Klages Ulrich A. Cronan Jr., J.E. J. Biol. Chem. 1983; 258: 2098-2101Abstract Full Text PDF PubMed Google Scholar) and the composition of thefabR::kan strain pointed to an increased level of fabB expression as the underlying cause for the increased UFA and altered 18:1/16:1 ratio in strain MWF1. In contrast, increased expression of the fabA gene actually slightly elevated the amounts of SFA in the membranes (Table III) consistent with previously reported results (33Clark D.P. de Mendoza D. Polacco M.L. Cronan Jr., J.E. Biochemistry. 1983; 22: 5897-5902Crossref PubMed Scopus (58) Google Scholar). The activity of FabF regulates the cellular content of 18:1Δ11 (24de Mendoza D. Klages Ulrich A. Cronan Jr., J.E. J. Biol. Chem. 1983; 258: 2098-2101Abstract Full Text PDF PubMed Google Scholar, 34Garwin J.L. Klages A.L. Cronan Jr., J.E. J. Biol. Chem. 1980; 255: 3263-3265Abstract Full Text PDF PubMed Google Scholar, 35de Mendoza D. Cronan Jr., J.E. Trends Biochem. Sci. 1983; 8: 49-52Abstract Full Text PDF Scopus (131) Google Scholar), therefore, we transduced the fabR::kan allele into strain SJ109 (fabF1) and examined the fatty acid composition to test if the regulation of FabB alone was responsible for the elevation in UFA. As expected, the fabF1 mutant had reduced amounts of C18:1Δ11. The 18:1Δ11 levels in thefabR::kan fabF1 double mutant were elevated compared with the fabF control and were similar to the amount of C18:1Δ11 in the wild type cells (Table III). These compositional data strongly support the conclusion that FabR acts as a repressor of fabB, which in turn, modifies the membrane fatty acid composition.Table IIIFabR regulation of fatty acid compositionStrain (genotype)/plasmidC16:03-aFatty acids that comprised less than 1.5% of the total are not listed.C18:0C16:13-bThe contributions of the respective cyclopropane derivatives were included in these percentages.C18:13-bThe contributions of the respective cyclopropane derivatives were included in these percentages.UFA/SFA18:1/16:1PDJ148.41.923.220.60.870.89MWF1 (fabR::kan)32.02.215.045.41.773.03JT10 (UB1005/pDM4(fabB))31.44.913.045.11.603.47MWF2/pSJ21 (f
Referência(s)