Molecular Cloning of a Novel Human CC Chemokine EBI1-ligand Chemokine That Is a Specific Functional Ligand for EBI1, CCR7
1997; Elsevier BV; Volume: 272; Issue: 21 Linguagem: Inglês
10.1074/jbc.272.21.13803
ISSN1083-351X
AutoresRyu Yoshida, Toshio Imai, Kunio Hieshima, Jun Kusuda, Masataka Baba, Motoji Kitaura, Miyuki Nishimura, Mayumi Kakizaki, Hisayuki Nomiyama, Osamu Yoshie,
Tópico(s)T-cell and B-cell Immunology
ResumoBy searching the expressedsequence tag (EST) data base, we identified partial cDNA sequences encoding a novel human CC chemokine. We determined the complete cDNA sequence that encodes a highly basic polypeptide of a total 98 amino acids with 20 to 30% identity to other human CC chemokines. We termed this novel chemokine fromEBI1-Ligand Chemokine as ELC (see below). The ELC mRNA was most strongly expressed in the thymus and lymph nodes. Recombinant ELC protein was expressed as a fusion protein with the Flag tag (ELC-Flag). For receptor-binding assays, recombinant ELC protein fused with the secreted form of alkaline phosphatase (SEAP) was used. By stably expressing five CC chemokine receptors (CCR1 to 5) and five orphan receptors, ELC-SEAP was found to bind specifically to an orphan receptor EBI1. Only ELC-Flag, but not MCP-1, MCP-2, MCP-3, eotaxin, MIP-1α, MIP-1β, RANTES (regulated on activation normal T cell expressed and secreted), thymus and activation-regulated chemokine (TARC), or liver and activation-regulated chemokine (LARC), competed with ELC-SEAP for EBI1. ELC-Flag-induced transient calcium mobilization and chemotactic responses in EBI1-transfected cells. ELC-Flag also induced chemotaxis in HUT78 cells expressing endogenous EBI1 at high levels. By somatic hybrid and radiation hybrid analyses, the gene for ELC (SCYA19) was mapped to chromosome 9p13 instead of chromosome 17q11.2 where the genes for CC chemokines are clustered. Taken together, ELC is a highly specific ligand for EBI1, which is known to be expressed in activated B and T lymphocytes and strongly up-regulated in B cells infected with Epstein-Barr virus and T cells infected with herpesvirus 6 or 7. ELC and EBI1 may thus play roles in migration and homing of normal lymphocytes, as well as in pathophysiology of lymphocytes infected with these herpesviruses. We propose EBI1 to be designated as CCR7. By searching the expressedsequence tag (EST) data base, we identified partial cDNA sequences encoding a novel human CC chemokine. We determined the complete cDNA sequence that encodes a highly basic polypeptide of a total 98 amino acids with 20 to 30% identity to other human CC chemokines. We termed this novel chemokine fromEBI1-Ligand Chemokine as ELC (see below). The ELC mRNA was most strongly expressed in the thymus and lymph nodes. Recombinant ELC protein was expressed as a fusion protein with the Flag tag (ELC-Flag). For receptor-binding assays, recombinant ELC protein fused with the secreted form of alkaline phosphatase (SEAP) was used. By stably expressing five CC chemokine receptors (CCR1 to 5) and five orphan receptors, ELC-SEAP was found to bind specifically to an orphan receptor EBI1. Only ELC-Flag, but not MCP-1, MCP-2, MCP-3, eotaxin, MIP-1α, MIP-1β, RANTES (regulated on activation normal T cell expressed and secreted), thymus and activation-regulated chemokine (TARC), or liver and activation-regulated chemokine (LARC), competed with ELC-SEAP for EBI1. ELC-Flag-induced transient calcium mobilization and chemotactic responses in EBI1-transfected cells. ELC-Flag also induced chemotaxis in HUT78 cells expressing endogenous EBI1 at high levels. By somatic hybrid and radiation hybrid analyses, the gene for ELC (SCYA19) was mapped to chromosome 9p13 instead of chromosome 17q11.2 where the genes for CC chemokines are clustered. Taken together, ELC is a highly specific ligand for EBI1, which is known to be expressed in activated B and T lymphocytes and strongly up-regulated in B cells infected with Epstein-Barr virus and T cells infected with herpesvirus 6 or 7. ELC and EBI1 may thus play roles in migration and homing of normal lymphocytes, as well as in pathophysiology of lymphocytes infected with these herpesviruses. We propose EBI1 to be designated as CCR7. The chemokines are a group of approximately 70–90 amino acid structurally related polypeptides that play important roles in inflammatory and immunological responses primarily by virtue of their ability to recruit selective leukocyte subsets (1Baggiolini M. Dewald B. Moser B. Adv. Immunol. 1994; 55: 97-179Google Scholar, 2Ben-Baruch A. Michiel D.F. Oppenheim J.J. J. Biol. Chem. 1995; 270: 11703-11706Google Scholar). Some chemokines may also play roles in normal lymphocyte recirculation and homing (3Nagasawa T. Hirota S. Tachibana K. Takakura N. Nishikawa S. Kitamura Y. Yoshida N. Kikutani H. Kishimoto T. Nature. 1996; 382: 635-638Google Scholar,4Forster R. Mattis A.E. Kremmer E. Wolf E. Brem G. Lipp M. Cell. 1996; 87: 1037-1047Google Scholar). Furthermore, certain chemokines have been shown to have other biological activities such as suppression of hematopoiesis (5Graham G.J. Wright E.G. Hewick R. Wolpe S.D. Wilkie N.M. Donaldson D. Lorimore S. Pragnell I.B. Nature. 1990; 344: 442-444Google Scholar, 6Broxmeyer H.E. Sherry B. Lu L. Cooper S. Oh K.-O. Tekamp-Olson P. Kwon B.S. Cerami A. Blood. 1990; 76: 1110-1116Google Scholar, 7Sarris A.H. Broxmeyer H.E. Wirthmueller U. Karasavvas N. Cooper S. Lu L. Krueger J. Ravetch J.V. J. Exp. Med. 1993; 178: 1127-1132Google Scholar), stimulation of angiogenesis (8Koch A.E. Polverini P.J. Kunkel S.L. Harlow L.A. DiPietro L.A. Elner V.M. Elner S.G. Strieter R.M. Science. 1992; 258: 1798-1801Google Scholar), suppression of angiogenesis (9Strieter R.M. Kunkel S.L. Arenberg D.A. Burdick M.D. Polverini P.J. Biochem. Biophys. Res. Commun. 1995; 210: 51-57Google Scholar, 10Cao Y. Chen C. Weatherbee J.A. Tsang M. Folkman J. J. Exp. Med. 1995; 182: 2069-2077Google Scholar), suppression of apoptosis (11Van Snick J. Houssiau F. Proost P. Van Damme J. Renauld J.-C. J. Immunol. 1996; 157: 2570-2576Google Scholar), and suppression of human immunodeficiency virus infection (12Cocchi F. DeVico A.L. Garzino-Demo A. Arya S.K. Gallo R.C. Lusso P. Science. 1995; 270: 1811-1815Google Scholar, 13Bleul C.C. Farzan M. Choe H. Parolin C. Clark-Lewis I. Sodroski J. Springer T.A. Nature. 1996; 382: 829-833Google Scholar, 14Oberlin E. Amara A. Bachelerie F. Bessia C. Virelizier J.-L. Arenzana-Seisdedos F. Schwartz O. Heard J.-M. Clark-Lewis I. Legler D.F. Loetscher M. Baggiolini M. Moser B. Nature. 1996; 382: 833-835Google Scholar). The chemokines are grouped into the CXC and CC subfamilies on the basis of the arrangement of the two NH2-terminal cysteine residues. One amino acid separates the two cysteine residues in the CXC chemokines, whereas the two cysteines are adjacent in the CC chemokines. Most CXC chemokines are potent attractants for neutrophils, whereas most CC chemokines are able to recruit monocytes, and also lymphocytes, basophils, and/or eosinophils with variable selectivity (1Baggiolini M. Dewald B. Moser B. Adv. Immunol. 1994; 55: 97-179Google Scholar, 2Ben-Baruch A. Michiel D.F. Oppenheim J.J. J. Biol. Chem. 1995; 270: 11703-11706Google Scholar). Recently, a novel chemokine-like cytokine lymphotactin/SCM-1 1The abbreviations and other trivial names used are: SCM, single C motif; G-protein, heterotrimeric guanine nucleotide-binding regulatory protein; CXCR, CXC chemokine receptor; CCR, CC chemokine receptor; IL-8, interleukin 8; IP-10, interferon-γ inducible protein 10; MIG, monokine induced by interferon-γ; SDF, stroma-derived factor; PBSF, pre-B cell stimulatory factor; MIP, macrophage inflammatory protein; RANTES, regulated on activation normal T cell expressed and secreted; MCP, monocyte chemoattractant protein; TARC, thymus and activation-regulated chemokine; LARC, liver and activation-regulated chemokine; EBI, EBV-induced gene; HHV, human herpesvirus; EST, expressed sequence tag; RACE, rapid amplification of cDNA end; PCR, polymerase chain reaction; BSA, bovine serum albumin; BLR, Burkitt's lymphoma receptor; ELC, EBI1-ligand chemokine; SEAP, secreted form of alkaline phosphatase; EBV, Epstein-Barr virus; EBNA, EBV-encoded nuclear antigen; PBS, phosphate-buffered saline. has been reported, which carries only the second and the fourth of the four cysteine residues conserved in the chemokines and seems to act specifically on lymphocytes (15Kelner G.S. Kennedy J. Bacon K.B. Kleyensteuber S. Largaespada D.A. Jenkins N.A. Copeland N.G. Bazan J.F. Moore K.W. Schall T.J. Zlotnik A. Science. 1994; 266: 1395-1399Google Scholar, 16Yoshida T. Imai T. Kakizaki M. Nishimura M. Yoshie O. FEBS Lett. 1995; 360: 155-159Google Scholar). This may suggest the existence of the C-type chemokine subfamily. The specific effects of chemokines are mediated by a family of 7-transmembrane G-protein coupled receptors (17Murphy P.M. Annu. Rev. Immunol. 1994; 12: 593-633Google Scholar, 18Premack B.A. Schall T.J. Nat. Med. 1996; 2: 1174-1178Google Scholar). In humans, four CXC chemokine receptors (CXCR1 to 4) and five CC chemokine receptors (CCR1 to 5) have been defined for their ligand specificity: CXCR1 for IL-8 (19Holmes W.E. Lee J. Kuang W.-J. Rice G.C. Wood W.I. Science. 1991; 253: 1278-1280Google Scholar); CXCR2 for IL-8 and other CXC chemokines with the ELR motif (20Murphy P.M. Tiffany H.L. Science. 1991; 253: 1280-1283Google Scholar, 21Lee J. Horuk R. Rice G.C. Bennett G.L. Camerato T. Wood W.I. J. Biol. Chem. 1992; 267: 16283-16287Google Scholar, 22Geiser T. Dewald B. Ehrengruber M.U. Clark-Lewis I. Baggiolini M. J. Biol. Chem. 1993; 268: 15419-15424Google Scholar); CXCR3 for IP-10 and MIG (23Loetscher M. Gerber B. Loetscher P. Jones S.A. Piali L. Clark-Lewis I. Baggiolini M. Moser B. J. Exp. Med. 1996; 184: 963-969Google Scholar); CXCR4 for SDF-1/PBSF (13Bleul C.C. Farzan M. Choe H. Parolin C. Clark-Lewis I. Sodroski J. Springer T.A. Nature. 1996; 382: 829-833Google Scholar, 14Oberlin E. Amara A. Bachelerie F. Bessia C. Virelizier J.-L. Arenzana-Seisdedos F. Schwartz O. Heard J.-M. Clark-Lewis I. Legler D.F. Loetscher M. Baggiolini M. Moser B. Nature. 1996; 382: 833-835Google Scholar); CCR1 for MIP-1α, RANTES and MCP-3 (24Neote K. DiGregorio D. Mak J.Y. Horuk R. Schall T.J. Cell. 1993; 72: 415-425Google Scholar, 25Gao J.-L. Kuhns D.B. Tiffany H.L. McDermott D. Li X. Francke U. Murphy P.M. J. Exp. Med. 1993; 177: 1421-1427Google Scholar, 26Ben-Baruch A. Xu L. Young P.R. Bengali K. Oppenheim J.J. Wang J.M. J. Biol. Chem. 1995; 270: 22123-22128Google Scholar, 27Combadiere C. Ahuja S.K. Van Damme J. Tiffany H.L. Gao J.-L. Murphy P.M. J. Biol. Chem. 1995; 270: 29671-29675Google Scholar); CCR2 for MCP-1 and MCP-3 (27Combadiere C. Ahuja S.K. Van Damme J. Tiffany H.L. Gao J.-L. Murphy P.M. J. Biol. Chem. 1995; 270: 29671-29675Google Scholar, 28Charo I.F. Myers S.J. Herman A. Franci C. Connolly A.J. Coughlin S.R. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2752-2756Google Scholar, 29Franci C. Wong L.M. Van Damme J. Proost P. Charo I.F. J. Immunol. 1995; 154: 6511-6517Google Scholar); CCR3 for eotaxin, RANTES, MCP-3 and MCP-4 (30Kitaura M. Nakajima T. Imai T. Harada S. Combadiere C. Tiffany H.L. Murphy P.M. Yoshie O. J. Biol. Chem. 1996; 271: 7725-7730Google Scholar, 31Daugherty B.L. Siciliano S.J. DeMartino J.A. Malkowitz L. Sirotina A. Springer M.S. J. Exp. Med. 1996; 183: 2349-2354Google Scholar, 32Ponath P.D. Qin S. Post T.W. Wang J. Wu L. Gerard N.P. Newman W. Gerard C. Mackay C.R. J. Exp. Med. 1996; 183: 2437-2448Google Scholar, 33Uguccioni M. Loetscher P. Forssmann U. Dewald B. Li H. Lima S.H. Li Y. Kreider B. Garotta G. Thelen M. Baggiolini M. J. Exp. Med. 1996; 183: 2379-2384Google Scholar); CCR4 for TARC (34Imai, T., Baba, M., Nishimura, M., Kakizaki, M., Takagi, S., and Yoshie, O. (1997) J. Biol. Chem., in press.Google Scholar); CCR5 for RANTES, MIP-1α, and MIP-1β (35Samson M. Labbe O. Mollereau C. Vassart G. Parmentier M. Biochemistry. 1996; 35: 3362-3367Google Scholar, 36Raport C.J. Gosling J. Schweickart V.L. Gray P.W. Charo I.F. J. Biol. Chem. 1996; 271: 17161-17166Google Scholar). Furthermore, there are a growing number of putative chemokine receptors whose ligands remain to be identified. In this regard, we have recently demonstrated that an orphan receptor GPR-CY4 2Deposited by L. L. Lautens, W. Modi, and T. I. Bonner with accession number U45984. /DRY6 3Deposited by R. McCoy, and D. H. Perlmutter, with accession number U60000. /CKR-L3 (37Zaballos A. Varona R. Gutierrez J. Lind P. Marquez G. Biochem. Biophys. Res. Commun. 1996; 227: 846-853Google Scholar) is the specific receptor for a novel human CC chemokine LARC (38Hieshima K. Imai T. Opdenakker G. Van Damme J. Kusuda J. Tei H. Sakaki Y. Takatsuki K. Miura R. Yoshie O. Nomiyama H. J. Biol. Chem. 1997; 272: 5846-5853Google Scholar) and, thus, have proposed CCR6 for its designation (39Baba, M., Imai, T., Nishimura, M., Kakizaki, M., Takagi, S., Hieshima, K., Nomiyama, H., and Yoshie, O. (1997) J. Biol. Chem., in press.Google Scholar). Among the known orphan receptors, EBI1, being designated from Epstein-Barr virus (EBV)-induced gene 1 (40Birkenbach M. Josefsen K. Yalamanchili R. Lenoir G. Kieff E. J. Virol. 1993; 67: 2209-2220Google Scholar), is expressed in various lymphoid tissues and activate B and T lymphocytes (40Birkenbach M. Josefsen K. Yalamanchili R. Lenoir G. Kieff E. J. Virol. 1993; 67: 2209-2220Google Scholar, 41Schweickart V.L. Raport C.J. Godiska R. Byers M.G. Eddy Jr., R.L. Shows T.B. Gray P.W. Genomics. 1994; 23: 643-650Google Scholar). EBI1 is notable because it is strongly up-regulated in B cells upon infection with EBV (40Birkenbach M. Josefsen K. Yalamanchili R. Lenoir G. Kieff E. J. Virol. 1993; 67: 2209-2220Google Scholar, 42Burgstahler R. Kempkes B. Steube K. Lipp M. Biochem. Biophys. Res. Commun. 1995; 215: 737-743Google Scholar), is transactivated by EBV-encoded nuclear antigen 2 (EBNA-2) (42Burgstahler R. Kempkes B. Steube K. Lipp M. Biochem. Biophys. Res. Commun. 1995; 215: 737-743Google Scholar) and is also up-regulated in CD4+ T cells upon infection with human herpesvirus 6 (HHV-6) and HHV-7 (43Hasegawa H. Utsunomiya Y. Yasukawa M. Yanagisawa K. Fujita S. J. Virol. 1994; 68: 5326-5329Google Scholar). The expressed sequence tags (ESTs) consist of partial "single pass" cDNA sequences from various tissues (44Boguski M.S. Lowe T.M.J. Tolstoshev C.M. Nat. Med. 1993; 4: 332-333Google Scholar). Analysis of the EST data bases is becoming a powerful approach to look for new members of gene families. Recently, we have identified a number of novel human CC chemokines by initially searching the EST data bases for homology with known CC chemokine members (38Hieshima K. Imai T. Opdenakker G. Van Damme J. Kusuda J. Tei H. Sakaki Y. Takatsuki K. Miura R. Yoshie O. Nomiyama H. J. Biol. Chem. 1997; 272: 5846-5853Google Scholar, 45Naruse K. Ueno M. Satoh T. Nomiyama H. Tei H. Takeda M. Ledbetter D.H. Van Coillie E. Opdenakker G. Gunge N. Sakaki Y. Iio M. Miura R. Genomics. 1996; 34: 236-240Google Scholar). Here we report a novel human CC chemokine that is expressed in various lymphoid tissues and turns out to be a specific high-affinity functional ligand for EBI1 (40Birkenbach M. Josefsen K. Yalamanchili R. Lenoir G. Kieff E. J. Virol. 1993; 67: 2209-2220Google Scholar). Thus, we have designated this novel CC chemokine ELC from EBI1-ligand chemokine. The ELC gene is mapped to chromosome 9p13 instead of 17q11.2 where the genes for most other CC chemokines are clustered. We now propose EBI1 to be designated as CCR7. Human hematopoietic cell lines were maintained in RPMI 1640 supplemented with 10% fetal calf serum. 293/EBNA-1 cells were purchased from Invitrogen (San Diego, CA) and maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. K562 cells and 293/EBNA-1 cells stably expressing CCR1 (24Neote K. DiGregorio D. Mak J.Y. Horuk R. Schall T.J. Cell. 1993; 72: 415-425Google Scholar, 25Gao J.-L. Kuhns D.B. Tiffany H.L. McDermott D. Li X. Francke U. Murphy P.M. J. Exp. Med. 1993; 177: 1421-1427Google Scholar, 26Ben-Baruch A. Xu L. Young P.R. Bengali K. Oppenheim J.J. Wang J.M. J. Biol. Chem. 1995; 270: 22123-22128Google Scholar, 27Combadiere C. Ahuja S.K. Van Damme J. Tiffany H.L. Gao J.-L. Murphy P.M. J. Biol. Chem. 1995; 270: 29671-29675Google Scholar), CCR2B (27Combadiere C. Ahuja S.K. Van Damme J. Tiffany H.L. Gao J.-L. Murphy P.M. J. Biol. Chem. 1995; 270: 29671-29675Google Scholar, 28Charo I.F. Myers S.J. Herman A. Franci C. Connolly A.J. Coughlin S.R. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2752-2756Google Scholar, 29Franci C. Wong L.M. Van Damme J. Proost P. Charo I.F. J. Immunol. 1995; 154: 6511-6517Google Scholar), CCR3 (30Kitaura M. Nakajima T. Imai T. Harada S. Combadiere C. Tiffany H.L. Murphy P.M. Yoshie O. J. Biol. Chem. 1996; 271: 7725-7730Google Scholar, 31Daugherty B.L. Siciliano S.J. DeMartino J.A. Malkowitz L. Sirotina A. Springer M.S. J. Exp. Med. 1996; 183: 2349-2354Google Scholar, 32Ponath P.D. Qin S. Post T.W. Wang J. Wu L. Gerard N.P. Newman W. Gerard C. Mackay C.R. J. Exp. Med. 1996; 183: 2437-2448Google Scholar, 33Uguccioni M. Loetscher P. Forssmann U. Dewald B. Li H. Lima S.H. Li Y. Kreider B. Garotta G. Thelen M. Baggiolini M. J. Exp. Med. 1996; 183: 2379-2384Google Scholar), CCR4 (46Power C.A. Meyer A. Nemeth K. Bacon K.B. Hoogewerf A.J. Proudfoot A.E.I. Wells T.N.C. J. Biol. Chem. 1995; 270: 19495-19500Google Scholar), CCR5 (35Samson M. Labbe O. Mollereau C. Vassart G. Parmentier M. Biochemistry. 1996; 35: 3362-3367Google Scholar, 36Raport C.J. Gosling J. Schweickart V.L. Gray P.W. Charo I.F. J. Biol. Chem. 1996; 271: 17161-17166Google Scholar), V28/CMKBLR1 (47Raport C.J. Schweickart V.L. Eddy Jr., R.L. Shows T.B. Gray P.W. Gene. 1995; 163: 295-299Google Scholar, 48Combadiere C. Ahuja S.K. Murphy P.M. DNA Cell Biol. 1995; 14: 673-680Google Scholar), GPR-CY42 (GenBankTM accession numberU45984), GPR-9–6 4Deposited by L. L. Lautens, H. L. Tiffany, J.-L. Gao, W. Modi, P. M. Murphy, and T. I. Bonner with accession numberU45982. (GenBankTM accession number U45982), EBI1 (40Birkenbach M. Josefsen K. Yalamanchili R. Lenoir G. Kieff E. J. Virol. 1993; 67: 2209-2220Google Scholar), and Burkitt's lymphoma receptor 1 (BLR1) (49Dobner T. Wolf I. Emrich T. Lipp M. Eur. J. Immunol. 1992; 22: 2795-2799Google Scholar) were described previously (34Imai, T., Baba, M., Nishimura, M., Kakizaki, M., Takagi, S., and Yoshie, O. (1997) J. Biol. Chem., in press.Google Scholar). The dbEST (44Boguski M.S. Lowe T.M.J. Tolstoshev C.M. Nat. Med. 1993; 4: 332-333Google Scholar) was searched with various CC chemokine nucleotide sequences or amino acid sequences as queries using the data base search and analysis service Search Launcher (50Smith R.F. Wiese B.A. Wojzynski M.K. Davison D.B. Worley K.C. Genomic Res. 1996; 6: 454-462Google Scholar) available on the World Wide Web. The program used was Basic Local Alignment Search Tool (51Altschul S.F. Gish W. Miller W. Myers E.W. Lipman D.J. J. Mol. Biol. 1990; 215: 403-410Google Scholar). The full-length cDNA sequence was obtained by the rapid amplification of cDNA ends (RACE) method (52Frohman M.A. Methods Enzymol. 1993; 218: 340-356Google Scholar). In brief, 5′ and 3′ RACE polymerase chain reactions (PCR) were carried out using human fetal lung cDNA commercially available for RACE-PCR (CLONTECH, Palo Alto, CA). The cDNA was amplified by PCR with one of the gene-specific primers based on an EST sequence (GenBankTMaccession number N71167) (5′ RACE-primer, CTCTGACCACACTCACCCTCTCGCT; 3′ RACE-primer, GAGCCCGGAGTCCGAGTCAAGCATT) and an AP1 primer (CLONTECH), which is complementary to part of the cDNA adaptor ligated at both ends of the cDNA. PCR was performed in a 50-μl reaction mixture containing 0.2 mmeach of dNTPs, 10 pmol of each of the primers, 2.5 units of TAKARA LATaq (Takara, Kyoto, Japan), 1 × buffer supplied with the polymerase, and 0.55 μg of TaqStart antibody (CLONTECH). The PCR conditions were 5 cycles of 94 °C for 30 s and 72 °C for 4 min, 5 cycles of 94 °C for 30 s and 70 °C for 4 min, and then 25 cycles of 94 °C for 30 s and 68 °C for 4 min. The amplification products were cloned into pCR-II vector (Stratagene, La Jolla, CA) by T-A ligation and sequenced on both strands using gene-specific and commercial primers. This was carried out as described previously (53Imai T. Yoshida T. Baba M. Nishimura M. Kakizaki M. Yoshie O. J. Biol. Chem. 1996; 271: 21514-21521Google Scholar). In brief, multiple tissue blots, and immune blots were purchased from CLONTECH. Filters were hybridized with the 32P-labeled ELC cDNA probe at 65 °C for 1 h in QuikHyb Hybridization Solution (Stratagene) containing denatured 100 μg/ml salmon sperm DNA. After washing at 65 °C for 30 min in 0.2 × SSC and 0.1% SDS, filters were exposed to x-ray films at −80 °C with an intensifying screen. ELC was expressed as a fusion protein with the Flag tag (54Hopp T.P. Prickett K.S. Libby R.T. March C.J. Ceretti D.T. Urdal D.L. Conlon P.J. Bio/Technology. 1988; 6: 1204-1210Google Scholar). We originally constructed the pBluescriptKS-MCP1-Flag, encoding MCP-1 fused with the Flag tag, as follows. The SalI-MCP1-XbaI-Flag fragment was amplified from pCRScript-MCP1 by PCR using the LacZα-B primer (5′AAAGGGGGATGTGCTGCAAGGCG) and the MCP1-XbaI-GG-Flag primer (5′-GTCCTTGTAGTCGCCGCCTCTAGAAGTCTTCGGAGTTTGGGT). Then, theSalI-MCP1-XbaI-Flag-NotI fragment was amplified from the first PCR products by using the LacZα-B primer and the GG-Flag-NotI primer (5′-CGCGCGGCCGCTCACTTGTCATCGTCGTCCTTGTAGTCGCCGCC). After digestion with SalI and NotI, the fragment was ligated into the SalI and NotI site of pBluescript KS vector. The MCP-1 coding sequence was removed from this vector by SalI and XbaI, and the ELC cDNA was subcloned in place of the MCP-1 cDNA. Then the DNA fragment encoding ELC-Flag was liberated by SalI and NotI, and inserted into pDREF-Hyg (53Imai T. Yoshida T. Baba M. Nishimura M. Kakizaki M. Yoshie O. J. Biol. Chem. 1996; 271: 21514-21521Google Scholar) to prepare the expression vector pDREF-ELC-Flag that expressed ELC fused at the COOH terminus with a 5 amino acid-linker (Ser-Arg-Ser-Ser-Gly) and the Flag tag (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys) (54Hopp T.P. Prickett K.S. Libby R.T. March C.J. Ceretti D.T. Urdal D.L. Conlon P.J. Bio/Technology. 1988; 6: 1204-1210Google Scholar). To produce the ELC-Flag protein, 293/EBNA-1 cells were transfected with pDREF-ELC-Flag using Lipofectamine (Life Technologies, Inc., Gaithersburg, MD) and cultured for 3–4 days. The culture supernatants were collected by centrifugation, filtered (0.22 μm), and applied to Anti-FLAG® M2 Affinity gel (Eastman Kodak Company, New Haven, CT) 2 times. After washing with 5 bed volumes of phosphate-buffered saline (PBS), proteins were eluted with 100 mm glycine-HCl, pH 3.0. Eluted fractions were immediately neutralized by adding 1/10 volume of 1 m Tris-HCl, pH 8.0, and analyzed by SDS-polyacrylamide electrophoresis and silver staining. The fractions containing the ELC-Flag protein were pooled, dialyzed against 20 mm Tris-HCl, pH 8.0, and injected into a reverse-phase high performance liquid chromatography column (4.6 × 250 mm Cosmocil 5C4-AR-300)(Cosmo Bio, Tokyo, Japan) equilibrated with 0.05% trifluoroacetic acid. Proteins were eluted with a 0–60% gradient of acetonitrile in 0.05% trifluoroacetic acid at a flow rate of 1 ml/min. Fractions containing ELC-Flag were pooled and lyophilized. Protein concentrations were determined by the BCA kit (Pierce, Rodkford, IL). NH2-terminal sequence analysis was performed on a protein sequencer (Shimazu, Tokyo, Japan). ELC was expressed as a fusion protein with the secreted form of alkaline phosphatase (SEAP) with a COOH terminus tag of 6 histidine residue, the (His)6tag, as described previously (38Hieshima K. Imai T. Opdenakker G. Van Damme J. Kusuda J. Tei H. Sakaki Y. Takatsuki K. Miura R. Yoshie O. Nomiyama H. J. Biol. Chem. 1997; 272: 5846-5853Google Scholar). In brief, the ELC cDNA was subcloned into pDREF-SEAP(His)6-Hyg (38Hieshima K. Imai T. Opdenakker G. Van Damme J. Kusuda J. Tei H. Sakaki Y. Takatsuki K. Miura R. Yoshie O. Nomiyama H. J. Biol. Chem. 1997; 272: 5846-5853Google Scholar) so that ELC was fused through a 5 amino acid linker (Ser-Arg-Ser-Ser-Gly) to SEAP with the (His)6 tag. To produce the ELC-SEAP fusion protein, 293/EBNA-1 cells (Invitrogen) were transfected with pDREF-ELC-SEAP(His)6-Hyg by using Lipofectamine (Life Technologies, Inc.). After 3–4 days, the culture supernatants were collected by centrifugation, filtered (0.22 μm), and added to 20 mm HEPES, pH 7.4, and 0.02% sodium azide. For the NH2-terminal sequence analysis, the fusion protein was affinity purified by nickel-agarose chromatography (QIAGEN, Hilden, Germany). The concentration of ELC-SEAP was determined by a sandwich-type enzyme-linked immunosorbent assay as described previously (38Hieshima K. Imai T. Opdenakker G. Van Damme J. Kusuda J. Tei H. Sakaki Y. Takatsuki K. Miura R. Yoshie O. Nomiyama H. J. Biol. Chem. 1997; 272: 5846-5853Google Scholar). Briefly, 96-well microtiter plates (Maxsorb, Nunc, Roskilde, Denmark) were coated with 2 μg/ml of monoclonal anti-placental alkaline phosphatase antibody (Medix Biotech, Foster City, CA) in 50 mm Tris-HCl, pH 9.5. After blocking nonspecific binding sites with 1 mg/ml bovine serum albumin (BSA) in PBS, the samples were titrated in PBS with 0.02% Tween-20. After incubation for 1 h at room temperature, the plates were washed, incubated with biotinylated rabbit anti-placental alkaline phosphatase antibody diluted 1:500 for 1 h at room temperature, washed again, and incubated for 30 min with peroxidase-conjugated streptavidin (Vector Laboratories, Burlingam, CA). After washing, bound peroxidase was detected by 3,3′-5,5′-tetramethylbenzidine. The reaction was stopped by adding H2SO4, and the absorbance at 450 nm was read. The enzymatic activity of SEAP and ELC-SEAP were determined by a chemiluminescence assay using the Great EscApe Detection kit (CLONTECH). Purified placental alkaline phosphatase (Cosmo Bio, Tokyo, Japan) was used to generate the standard curve. Alkaline phosphatase activity was expressed as relative light units, and 1 pmol of SEAP and ELC-SEAP employed in the present study corresponded to 1.45 × 108 and 1.99 × 108 relative light units, respectively. This was carried out as described previously (38Hieshima K. Imai T. Opdenakker G. Van Damme J. Kusuda J. Tei H. Sakaki Y. Takatsuki K. Miura R. Yoshie O. Nomiyama H. J. Biol. Chem. 1997; 272: 5846-5853Google Scholar). In brief, 2 × 105 cells were incubated for 1 h at 16 °C with 1 μm of SEAP or ELC-SEAP without or with increasing concentrations of unlabeled chemokines in 200 μl of RPMI 1640 containing 20 mm HEPES, pH 7.4, 1% BSA, and 0.02% sodium azide. MCP-1, eotaxin, LARC, and TARC were prepared as described previously (30Kitaura M. Nakajima T. Imai T. Harada S. Combadiere C. Tiffany H.L. Murphy P.M. Yoshie O. J. Biol. Chem. 1996; 271: 7725-7730Google Scholar, 38Hieshima K. Imai T. Opdenakker G. Van Damme J. Kusuda J. Tei H. Sakaki Y. Takatsuki K. Miura R. Yoshie O. Nomiyama H. J. Biol. Chem. 1997; 272: 5846-5853Google Scholar, 53Imai T. Yoshida T. Baba M. Nishimura M. Kakizaki M. Yoshie O. J. Biol. Chem. 1996; 271: 21514-21521Google Scholar). MIP-1α, MIP-1β, MCP-2, MCP-3, and RANTES were purchased from Pepro Tech (Rocky Hill, NJ). After that, cells were washed 5 times and lysed in 50 μl of 10 mm Tris-HCl, pH 8.0, and 1% Triton X-100. Samples were heated at 65 °C for 10 min to inactivate cellular phosphatases and centrifuged to remove cell debris. AP activity in 10 μl of lysate was determined by the chemiluminescence assay as described above. All samples were determined in duplicate. The binding data were analyzed by the LIGAND program (55Munson P. Rodbard D. Anal. Biochem. 1980; 107: 220-239Google Scholar). K562 cells stably expressing cloned chemokine receptors were suspended at 3 × 106cells/ml in Hank's balanced salt solution supplemented with 1 mg/ml BSA and 10 mm HEPES, pH 7.4, and loaded with 1 μm Fura-PE3-AM (Texas Fluorescence Labs) by incubation for 1 h at room temperature in the dark. Loaded cells were washed twice with Hank's balanced salt solution-BSA and resuspended in the same buffer at 2.5 × 106 cells/ml. To measure intracellular calcium, 2 ml of the cell suspension was placed in a quartz cuvette in a Perkin-Elmer LS 50B spectrofluorimeter and stimulated with chemokines at 37 °C. Fluorescence was monitored at 340 nm (λex1), 380 nm (λex2), and 510 nm (λem) every 200 ms. To determine EC50 for calcium mobilization, a dose-response curve was generated in each experiment by plotting percent maximum responses. The cell migration assay was performed using a 48-well microchemotaxis chamber as described previously (53Imai T. Yoshida T. Baba M. Nishimura M. Kakizaki M. Yoshie O. J. Biol. Chem. 1996; 271: 21514-21521Google Scholar). In brief, chemokines were diluted in Hepes-buffered RPMI 1640 supplemented with 1% BSA and placed in lower wells (30 μl/well). Cells suspended in RPMI 1640, 1% BSA at 2 × 106/ml (293/EBNA-1 cells) or at 8 × 106/ml (HUT78) were added to upper wells (50 μl/well) that were separated from lower wells by a polyvinylpyrrolidone-free polycarbonate filter with 5- or 8-μm pores precoated with type IV collagen. The chamber was incubated for 2 or 4 h at 37 °C in 5% CO2, 95% air. Filters were removed and stained with Diff-Quik (Harleco, Gibbstown, NJ). Migrated cell were counted in five randomly selected high-power fields (× 400) per well. All assays were done in triplicate. DNAs of the human × rodent somatic cell hybrids containing human monochromosomes (National Institute of General Medical Science Mapping Panel No. 2, Version 2, Coriell Cell Repositories, Camden, NJ) and of 93 radiation hybrids (56Gyapay G. Schmitt K. Fizames C. Jones H. Vega-Czarny N. Spillett D. Muselet D. Prud'Homme J.-F. Dib C. Auffray C. Morissette J. Weissenbach J. Goodfellow P.N. Human Mol. Genet. 1996; 5: 339-346Google Scholar) (Gene Bridge 4 Mapping Panel, Reseach Genetics, Huntsville, AL) were analyzed by PCR using ELC primers (5′-GAGCCCGGAGTCCGAGTCAAGCATT and 5′-CTCTGACCACACTCACCCTCTCGCT). The PCR conditions were 35 cycles of 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 1 min in a 25-μl reactio
Referência(s)