Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Effects of Human a3 and a4 Mutations That Result in Osteopetrosis and Distal Renal Tubular Acidosis on Yeast V-ATPase Expression and Activity

2006; Elsevier BV; Volume: 281; Issue: 36 Linguagem: Inglês

10.1074/jbc.m601118200

ISSN

1083-351X

Autores

Noelle Ochotny, Aaron Van Vliet, Nelson C. N. Chan, Yeqi Yao, Mario Morel, Norbert Kartner, Herbert P. von Schroeder, Johan N.M. Heersche, Morris F. Manolson,

Tópico(s)

Metalloenzymes and iron-sulfur proteins

Resumo

V-ATPases are multimeric proton pumps. The 100-kDa "a" subunit is encoded by four isoforms (a1–a4) in mammals and two (Vph1p and Stv1p) in yeast. a3 is enriched in osteoclasts and is essential for bone resorption, whereas a4 is expressed in the distal nephron and acidifies urine. Mutations in human a3 and a4 result in osteopetrosis and distal renal tubular acidosis, respectively. Human a3 (G405R and R444L) and a4 (P524L and G820R) mutations were recreated in the yeast ortholog Vph1p, a3 (G424R and R462L), and a4 (W520L and G812R). Mutations in a3 resulted in wild type vacuolar acidification and growth on media containing 4 mm ZnCl2, 200 mm CaCl2, or buffered to pH 7.5 with V-ATPase hydrolytic and pumping activity decreased by 30–35%. Immunoblots confirmed wild type levels for V-ATPase a, A, and B subunits on vacuolar membranes. a4 G812R resulted in defective growth on selective media with V-ATPase hydrolytic and pumping activity decreased by 83–85% yet with wild type levels of a, A, and B subunits on vacuolar membranes. The a4 W520L mutation had defective growth on selective media with no detectable V-ATPase activity and reduced expression of a, A, and B subunits. The a4 W520L mutation phenotypes were dominant negative, as overexpression of wild type yeast a isoforms, Vph1p, or Stv1p, did not restore growth. However, deletion of endoplasmic reticulum assembly factors (Vma12p, Vma21p, and Vma22p) partially restored a and B expression. That a4 W520L affects both Vo and V1 subunits is a unique phenotype for any V-ATPase subunit mutation and supports the concerted pathway for V-ATPase assembly in vivo. V-ATPases are multimeric proton pumps. The 100-kDa "a" subunit is encoded by four isoforms (a1–a4) in mammals and two (Vph1p and Stv1p) in yeast. a3 is enriched in osteoclasts and is essential for bone resorption, whereas a4 is expressed in the distal nephron and acidifies urine. Mutations in human a3 and a4 result in osteopetrosis and distal renal tubular acidosis, respectively. Human a3 (G405R and R444L) and a4 (P524L and G820R) mutations were recreated in the yeast ortholog Vph1p, a3 (G424R and R462L), and a4 (W520L and G812R). Mutations in a3 resulted in wild type vacuolar acidification and growth on media containing 4 mm ZnCl2, 200 mm CaCl2, or buffered to pH 7.5 with V-ATPase hydrolytic and pumping activity decreased by 30–35%. Immunoblots confirmed wild type levels for V-ATPase a, A, and B subunits on vacuolar membranes. a4 G812R resulted in defective growth on selective media with V-ATPase hydrolytic and pumping activity decreased by 83–85% yet with wild type levels of a, A, and B subunits on vacuolar membranes. The a4 W520L mutation had defective growth on selective media with no detectable V-ATPase activity and reduced expression of a, A, and B subunits. The a4 W520L mutation phenotypes were dominant negative, as overexpression of wild type yeast a isoforms, Vph1p, or Stv1p, did not restore growth. However, deletion of endoplasmic reticulum assembly factors (Vma12p, Vma21p, and Vma22p) partially restored a and B expression. That a4 W520L affects both Vo and V1 subunits is a unique phenotype for any V-ATPase subunit mutation and supports the concerted pathway for V-ATPase assembly in vivo. Eukaryotic cells contain an evolutionarily conserved enzyme, the vacuolar proton pump, V-ATPase 2The abbreviations used are: V-ATPase, vacuolar proton translocating adenosine triphosphatase; Vo, integral membrane domain of V-ATPase; V1, cytosolic membrane domain of V-ATPase; VMA, vacuolar membrane ATPase; VPH1, vacuolar pH 1 (the yeast ortholog of the mammalian V-ATPase a subunit; dRTA, distal renal tubular acidosis; ER, endoplasmic reticulum; MES, 4-morpholineethanesulfonic acid.2The abbreviations used are: V-ATPase, vacuolar proton translocating adenosine triphosphatase; Vo, integral membrane domain of V-ATPase; V1, cytosolic membrane domain of V-ATPase; VMA, vacuolar membrane ATPase; VPH1, vacuolar pH 1 (the yeast ortholog of the mammalian V-ATPase a subunit; dRTA, distal renal tubular acidosis; ER, endoplasmic reticulum; MES, 4-morpholineethanesulfonic acid. that couples the energy of ATP hydrolysis to proton transport across membranes. Intracellular V-ATPases are found in compartments such as clathrin-coated vesicles, Golgi, endosomes, lysosomes, secretory vesicles, and the central vacuoles of yeast as reviewed previously (1Nishi T. Forgac M. Nat. Rev. Mol. Cell Biol. 2002; 3: 94-103Crossref PubMed Scopus (994) Google Scholar). V-ATPases are also present in the plasma membranes of specialized cells such as osteoclasts, renal intercalated cells, spermatids, neutrophils, and macrophages, where they function in such processes as bone resorption, renal acidification, pH homeostasis, and coupled transport (2Sun-Wada G.H. Imai-Senga Y. Yamamoto A. Murata Y. Hirata T. Wada Y. Futai M. J. Biol. Chem. 2002; 277: 18098-18105Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 3Brown D. Breton S. J. Exp. Biol. 2000; 203: 137-145Crossref PubMed Google Scholar, 4Li Y.P. Chen W. Liang Y. Li E. Stashenko P. Nat. Genet. 1999; 23: 447-451Crossref PubMed Scopus (419) Google Scholar, 5Smith A.N. Skaug J. Choate K.A. Nayir A. Bakkaloglu A. Ozen S. Hulton S.A. Sanjad S.A. Al-Sabban E.A. Lifton R.P. Scherer S.W. Karet F.E. Nat. Genet. 2000; 26: 71-75Crossref PubMed Scopus (5) Google Scholar, 6Brisseau G.F. Grinstein S. Hackam D.J. Nordstrom T. Manolson M.F. Khine A.A. Rotstein O.D. J. Biol. Chem. 1996; 271: 2005-2011Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 7Nanda A. Brumell J.H. Nordstrom T. Kjeldsen L. Sengelov H. Borregaard N. Rotstein O.D. Grinstein S. J. Biol. Chem. 1996; 271: 15963-15970Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). V-ATPases are complexes composed of at least 13 different subunits. These subunits are organized into two domains, a cytoplasmic V1 domain that hydrolyzes ATP and an integral membrane Vo domain that translocates protons across membranes. The V1 is composed of eight subunits, A–H, with three copies of the nucleotide binding subunits A and B, and possibly two copies of subunit E, and two copies of subunit G (8Xu T. Vasilyeva E. Forgac M. J. Biol. Chem. 1999; 274: 28909-28915Abstract Full Text Full Text PDF PubMed Scopus (120) Google Scholar, 9Tomashek J.J. Graham L.A. Hutchins M.U. Stevens T.H. Klionsky D.J. J. Biol. Chem. 1997; 272: 26787-26793Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). The yeast Vo is composed of six different subunits, a, c, c′, c″, d, and e, with four copies of subunit c (10Sambade M. Kane P.M. J. Biol. Chem. 2004; 279: 17361-17365Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 11Powell B. Graham L.A. Stevens T.H. J. Biol. Chem. 2000; 275: 23654-23660Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar, 12Hirata R. Graham L.A. Taktsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1997; 272: 4795-4803Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar, 13Manolson M.F. Proteau D. Preston R.A. Stenbit A. Roberts B.T. Hoyt M.A. Preuss D. Mulholland J. Botstein D. Jones E.W. J. Biol. Chem. 1992; 267: 14294-14303Abstract Full Text PDF PubMed Google Scholar). Subunits a, c, c′, and c″ are thought to be responsible for proton translocation, but the functions of subunits d (14Bauerle C. Ho M.N. Lindorfer M.A. Stevens T.H. J. Biol. Chem. 1993; 268: 12749-12757Abstract Full Text PDF PubMed Google Scholar) and e (10Sambade M. Kane P.M. J. Biol. Chem. 2004; 279: 17361-17365Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar) are unknown. Proton translocation through Vo is driven by rotational catalysis of V1 (15Hirata T. Iwamoto-Kihara A. Sun-Wada G.H. Okajima T. Wada Y. Futai M. J. Biol. Chem. 2003; 278: 23714-23719Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar). Yeast V-ATPases fail to assemble when any of the genes that encode subunits are deleted, except for subunits H and c″ (16Whyteside G. Gibson L. Scott M. Finbow M.E. FEBS Lett. 2005; 579: 2981-2985Crossref PubMed Scopus (4) Google Scholar, 17Ho M.N. Hirata R. Umemoto N. Ohya Y. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1993; 268: 18286-18292Abstract Full Text PDF PubMed Google Scholar). Previous studies have revealed that deletion of any Vo subunit, except for the c″ subunit (16Whyteside G. Gibson L. Scott M. Finbow M.E. FEBS Lett. 2005; 579: 2981-2985Crossref PubMed Scopus (4) Google Scholar), results in the loss of all Vo subunits from the vacuole (18Kane P.M. Kuehn M.C. Howald-Stevenson I. Stevens T.H. J. Biol. Chem. 1992; 267: 447-454Abstract Full Text PDF PubMed Google Scholar). The loss of any V1 subunit, with the exception of subunit H (17Ho M.N. Hirata R. Umemoto N. Ohya Y. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1993; 268: 18286-18292Abstract Full Text PDF PubMed Google Scholar), leads to an absence of all V1 subunits at the vacuole (18Kane P.M. Kuehn M.C. Howald-Stevenson I. Stevens T.H. J. Biol. Chem. 1992; 267: 447-454Abstract Full Text PDF PubMed Google Scholar). Without subunit H, the assembled V-ATPase is not active (17Ho M.N. Hirata R. Umemoto N. Ohya Y. Takatsuki A. Stevens T.H. Anraku Y. J. Biol. Chem. 1993; 268: 18286-18292Abstract Full Text PDF PubMed Google Scholar, 19Parra K.J. Keenan K.L. Kane P.M. J. Biol. Chem. 2000; 275: 21761-21767Abstract Full Text Full Text PDF PubMed Scopus (122) Google Scholar), and loss of the c″ subunit results in uncoupling of enzymatic activity (16Whyteside G. Gibson L. Scott M. Finbow M.E. FEBS Lett. 2005; 579: 2981-2985Crossref PubMed Scopus (4) Google Scholar). Vo domain assembly depends on the presence of three assembly factors, Vma12p, Vma21p, and Vma22p (20Hirata R. Umemoto N. Ho M.N. Ohya Y. Stevens T.H. Anraku Y. J. Biol. Chem. 1993; 268: 961-967Abstract Full Text PDF PubMed Google Scholar, 21Hill K.J. Stevens T.H. Mol. Biol. Cell. 1994; 5: 1039-1050Crossref PubMed Scopus (94) Google Scholar, 22Hill K.J. Stevens T.H. J. Biol. Chem. 1995; 270: 22329-22336Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar, 23Jackson D.D. Stevens T.H. J. Biol. Chem. 1997; 272: 25928-25934Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar). Phenotypes of cells that lack Vma12p, Vma21p, or Vma22p resemble those lacking a Vo structural subunit, in that Vo does not assemble properly, Vo subunits are not found at the vacuole, and Vph1p is rapidly degraded (22Hill K.J. Stevens T.H. J. Biol. Chem. 1995; 270: 22329-22336Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar, 24Hill K.J. Cooper A. EMBO J. 2000; 19: 550-561Crossref PubMed Scopus (93) Google Scholar). Two of these proteins, Vma12p and Vma22p, form a complex that binds transiently to Vph1p and aids in Vph1p assembly and maturation (21Hill K.J. Stevens T.H. Mol. Biol. Cell. 1994; 5: 1039-1050Crossref PubMed Scopus (94) Google Scholar, 22Hill K.J. Stevens T.H. J. Biol. Chem. 1995; 270: 22329-22336Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar, 23Jackson D.D. Stevens T.H. J. Biol. Chem. 1997; 272: 25928-25934Abstract Full Text Full Text PDF PubMed Scopus (56) Google Scholar, 25Graham L.A. Hill K.J. Stevens T.H. J. Cell Biol. 1998; 142: 39-49Crossref PubMed Scopus (80) Google Scholar, 26Graham L.A. Flannery A.R. Stevens T.H. J. Bioenerg. Biomembr. 2003; 35: 301-312Crossref PubMed Scopus (84) Google Scholar). A recent study has shown that Vma21p is required for the assembly of the Vo domain (27Malkus P. Graham L.A. Stevens T.H. Schekman R. Mol. Biol. Cell. 2004; 15: 5075-5091Crossref PubMed Scopus (67) Google Scholar). An important question is how V-ATPase can function in the wide variety of locations and physiological processes listed above. In yeast, V-ATPases have two organelle-specific isoforms of the "a" subunit, Vph1p and Stv1p (28Manolson M.F. Wu B. Proteau D. Taillon B.E. Roberts B.T. Hoyt M.A. Jones E.W. J. Biol. Chem. 1994; 269: 14064-14074Abstract Full Text PDF PubMed Google Scholar). Vph1p localizes to the vacuole, whereas Stv1p localizes to the Golgi (28Manolson M.F. Wu B. Proteau D. Taillon B.E. Roberts B.T. Hoyt M.A. Jones E.W. J. Biol. Chem. 1994; 269: 14064-14074Abstract Full Text PDF PubMed Google Scholar, 29Kawasaki-Nishi S. Nishi T. Forgac M. J. Biol. Chem. 2001; 276: 17941-17948Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). In humans, four different a isoforms have been identified, a1 to a4, which are expressed in a tissue- and organelle-specific manner (30Nishi T. Forgac M. J. Biol. Chem. 2000; 275: 6824-6830Abstract Full Text Full Text PDF PubMed Scopus (119) Google Scholar, 31Oka T. Murata Y. Namba M. Yoshimizu T. Toyomura T. Yamamoto A. Sun-Wada G.H. Hamasaki N. Wada Y. Futai M. J. Biol. Chem. 2001; 276: 40050-40054Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). The V1 domain also contains tissue-specific subunit isoforms, including B, C, E, and G (2Sun-Wada G.H. Imai-Senga Y. Yamamoto A. Murata Y. Hirata T. Wada Y. Futai M. J. Biol. Chem. 2002; 277: 18098-18105Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 31Oka T. Murata Y. Namba M. Yoshimizu T. Toyomura T. Yamamoto A. Sun-Wada G.H. Hamasaki N. Wada Y. Futai M. J. Biol. Chem. 2001; 276: 40050-40054Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar, 32Karet F.E. Finberg K.E. Nelson R.D. Nayir A. Mocan H. Sanjad S.A. Rodriguez-Soriano J. Santos F. Cremers C.W. Di Pietro A. Hoffbrand B.I. Winiarski J. Bakkaloglu A. Ozen S. Dusunsel R. Goodyer P. Hulton S.A. Wu D.K. Skvorak A.B. Morton C.C. Cunningham M.J. Jha V. Lifton R.P. Nat. Genet. 1999; 21: 84-90Crossref PubMed Scopus (579) Google Scholar, 33Sun-Wada G.H. Yoshimizu T. Imai-Senga Y. Wada Y. Futai M. Gene (Amst.). 2003; 302: 147-153Crossref PubMed Scopus (81) Google Scholar). Mutations in the a3, a4, and B1 subunits are known to lead to human disease (32Karet F.E. Finberg K.E. Nelson R.D. Nayir A. Mocan H. Sanjad S.A. Rodriguez-Soriano J. Santos F. Cremers C.W. Di Pietro A. Hoffbrand B.I. Winiarski J. Bakkaloglu A. Ozen S. Dusunsel R. Goodyer P. Hulton S.A. Wu D.K. Skvorak A.B. Morton C.C. Cunningham M.J. Jha V. Lifton R.P. Nat. Genet. 1999; 21: 84-90Crossref PubMed Scopus (579) Google Scholar, 34Stehberger P.A. Schulz N. Finberg K.E. Karet F.E. Giebisch G. Lifton R.P. Geibel J.P. Wagner C.A. J. Am. Soc. Nephrol. 2003; 14: 3027-3038Crossref PubMed Scopus (73) Google Scholar, 35Taranta A. Migliaccio S. Recchia I. Caniglia M. Luciani M. De Rossi G. Dionisi-Vici C. Pinto R.M. Francalanci P. Boldrini R. Lanino E. Dini G. Morreale G. Ralston S.H. Villa A. Vezzoni P. Del Principe D. Cassiani F. Palumbo G. Teti A. Am. J. Pathol. 2003; 162: 57-68Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 36Sobacchi C. Frattini A. Orchard P. Porras O. Tezcan I. Andolina M. Babul-Hirji R. Baric I. Canham N. Chitayat D. Dupuis-Girod S. Ellis I. Etzioni A. Fasth A. Fisher A. Gerritsen B. Gulino V. Horwitz E. Klamroth V. Lanino E. Mirolo M. Musio A. Matthijs G. Nonomaya S. Notarangelo L.D. Ochs H.D. Superti Furga A. Valiaho J. Van Hove J.L. Vihinen M. Vujic D. Vezzoni P. Villa A. Hum. Mol. Genet. 2001; 10: 1767-1773Crossref PubMed Scopus (188) Google Scholar, 37Kornak U. Schulz A. Friedrich W. Uhlhaas S. Kremens B. Voit T. Hasan C. Bode U. Jentsch T.J. Kubisch C. Hum. Mol. Genet. 2000; 9: 2059-2063Crossref PubMed Scopus (295) Google Scholar). There are no known human diseases associated with mutations in a1 or a2. The a3 isoform is highly enriched in osteoclasts (38Manolson M.F. Yu H. Chen W. Yao Y. Li K. Lees R.L. Heersche J.N. J. Biol. Chem. 2003; 278: 49271-49278Abstract Full Text Full Text PDF PubMed Scopus (88) Google Scholar), and mutations within a3 result in autosomal recessive osteopetroses (35Taranta A. Migliaccio S. Recchia I. Caniglia M. Luciani M. De Rossi G. Dionisi-Vici C. Pinto R.M. Francalanci P. Boldrini R. Lanino E. Dini G. Morreale G. Ralston S.H. Villa A. Vezzoni P. Del Principe D. Cassiani F. Palumbo G. Teti A. Am. J. Pathol. 2003; 162: 57-68Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar, 36Sobacchi C. Frattini A. Orchard P. Porras O. Tezcan I. Andolina M. Babul-Hirji R. Baric I. Canham N. Chitayat D. Dupuis-Girod S. Ellis I. Etzioni A. Fasth A. Fisher A. Gerritsen B. Gulino V. Horwitz E. Klamroth V. Lanino E. Mirolo M. Musio A. Matthijs G. Nonomaya S. Notarangelo L.D. Ochs H.D. Superti Furga A. Valiaho J. Van Hove J.L. Vihinen M. Vujic D. Vezzoni P. Villa A. Hum. Mol. Genet. 2001; 10: 1767-1773Crossref PubMed Scopus (188) Google Scholar, 37Kornak U. Schulz A. Friedrich W. Uhlhaas S. Kremens B. Voit T. Hasan C. Bode U. Jentsch T.J. Kubisch C. Hum. Mol. Genet. 2000; 9: 2059-2063Crossref PubMed Scopus (295) Google Scholar, 39Michigami T. Kageyama T. Satomura K. Shima M. Yamaoka K. Nakayama M. Ozono K. Bone (Elmsford). 2002; 30: 436-439Crossref PubMed Scopus (43) Google Scholar). The a4 isoform is specific to renal intercalated cells of the kidney (31Oka T. Murata Y. Namba M. Yoshimizu T. Toyomura T. Yamamoto A. Sun-Wada G.H. Hamasaki N. Wada Y. Futai M. J. Biol. Chem. 2001; 276: 40050-40054Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar), and mutations within the a4 gene lead to distal renal tubule acidosis (dRTA) (5Smith A.N. Skaug J. Choate K.A. Nayir A. Bakkaloglu A. Ozen S. Hulton S.A. Sanjad S.A. Al-Sabban E.A. Lifton R.P. Scherer S.W. Karet F.E. Nat. Genet. 2000; 26: 71-75Crossref PubMed Scopus (5) Google Scholar, 34Stehberger P.A. Schulz N. Finberg K.E. Karet F.E. Giebisch G. Lifton R.P. Geibel J.P. Wagner C.A. J. Am. Soc. Nephrol. 2003; 14: 3027-3038Crossref PubMed Scopus (73) Google Scholar, 40Stover E.H. Borthwick K.J. Bavalia C. Eady N. Fritz D.M. Rungroj N. Giersch A.B. Morton C.C. Axon P.R. Akil I. Al-Sabban E.A. Baguley D.M. Bianca S. Bakkaloglu A. Bircan Z. Chauveau D. Clermont M.J. Guala A. Hulton S.A. Kroes H. Li Volti G. Mir S. Mocan H. Nayir A. Ozen S. Rodriguez Soriano J. Sanjad S.A. Tasic V. Taylor C.M. Topaloglu R. Smith A.N. Karet F.E. J. Med. Genet. 2002; 39: 796-803Crossref PubMed Scopus (241) Google Scholar). The bone disease osteopetrosis demonstrates the essential function of V-ATPases in bone resorption. The osteopetroses are a group of heritable conditions characterized by defects in osteoclast bone resorption. Osteoclasts resorb bone by first creating a sealed zone, the resorption lacuna, between the osteoclast ruffled border membrane and the bone surface. The process of V-ATPase-mediated proton transport into resorption lacunae (41Blair H.C. Teitelbaum S.L. Ghiselli R. Gluck S. Science. 1989; 245: 855-857Crossref PubMed Scopus (731) Google Scholar) is an essential component of bone remodeling. The importance of V-ATPase in renal proton secretion is highlighted by inherited dRTA. V-ATPases in the plasma membranes of renal intercalated cells of the distal nephron pump protons from the blood into the urine, an essential step in the removal of metabolic acid. dRTA is characterized by impaired renal acid secretion, resulting in metabolic acidosis. Autosomal recessive dRTA involves mutations to the a4 or the B1 subunit isoforms of V-ATPase. Mutations within the V-ATPase B1 and a4 genes in some cases also result in sensorineural deafness (34Stehberger P.A. Schulz N. Finberg K.E. Karet F.E. Giebisch G. Lifton R.P. Geibel J.P. Wagner C.A. J. Am. Soc. Nephrol. 2003; 14: 3027-3038Crossref PubMed Scopus (73) Google Scholar, 42Ruf R. Rensing C. Topaloglu R. Guay-Woodford L. Klein C. Vollmer M. Otto E. Beekmann F. Haller M. Wiedensohler A. Leumann E. Antignac C. Rizzoni G. Filler G. Brandis M. Weber J.L. Hildebrandt F. Pediatr. Nephrol. 2003; 18: 105-109Crossref PubMed Scopus (51) Google Scholar). In humans, 26 mutations have been identified in a3 that result in autosomal recessive osteopetrosis (36Sobacchi C. Frattini A. Orchard P. Porras O. Tezcan I. Andolina M. Babul-Hirji R. Baric I. Canham N. Chitayat D. Dupuis-Girod S. Ellis I. Etzioni A. Fasth A. Fisher A. Gerritsen B. Gulino V. Horwitz E. Klamroth V. Lanino E. Mirolo M. Musio A. Matthijs G. Nonomaya S. Notarangelo L.D. Ochs H.D. Superti Furga A. Valiaho J. Van Hove J.L. Vihinen M. Vujic D. Vezzoni P. Villa A. Hum. Mol. Genet. 2001; 10: 1767-1773Crossref PubMed Scopus (188) Google Scholar, 37Kornak U. Schulz A. Friedrich W. Uhlhaas S. Kremens B. Voit T. Hasan C. Bode U. Jentsch T.J. Kubisch C. Hum. Mol. Genet. 2000; 9: 2059-2063Crossref PubMed Scopus (295) Google Scholar, 43Frattini A. Orchard P.J. Sobacchi C. Giliani S. Abinun M. Mattsson J.P. Keeling D.J. Andersson A.K. Wallbrandt P. Zecca L. Notarangelo L.D. Vezzoni P. Villa A. Nat. Genet. 2000; 25: 343-346Crossref PubMed Scopus (560) Google Scholar, 44Susani L. Pangrazio A. Sobacchi C. Taranta A. Mortier G. Savarirayan R. Villa A. Orchard P. Vezzoni P. Albertini A. Frattini A. Pagani F. Hum. Mutat. 2004; 24: 225-235Crossref PubMed Scopus (89) Google Scholar), and 21 mutations have been identified in a4 that result in dRTA (5Smith A.N. Skaug J. Choate K.A. Nayir A. Bakkaloglu A. Ozen S. Hulton S.A. Sanjad S.A. Al-Sabban E.A. Lifton R.P. Scherer S.W. Karet F.E. Nat. Genet. 2000; 26: 71-75Crossref PubMed Scopus (5) Google Scholar, 40Stover E.H. Borthwick K.J. Bavalia C. Eady N. Fritz D.M. Rungroj N. Giersch A.B. Morton C.C. Axon P.R. Akil I. Al-Sabban E.A. Baguley D.M. Bianca S. Bakkaloglu A. Bircan Z. Chauveau D. Clermont M.J. Guala A. Hulton S.A. Kroes H. Li Volti G. Mir S. Mocan H. Nayir A. Ozen S. Rodriguez Soriano J. Sanjad S.A. Tasic V. Taylor C.M. Topaloglu R. Smith A.N. Karet F.E. J. Med. Genet. 2002; 39: 796-803Crossref PubMed Scopus (241) Google Scholar). The majority of these mutations result in frameshifts, abnormal splicing, and insertion of stop codons and as such are uninformative, except to further illustrate the essential roles of a3 and a4. However, missense and small deletion mutations were identified that could pinpoint critical domains. Two missense mutations, G405R and R444L, were identified in the V-ATPase a3 subunit isoform that account for all the defects in nine unrelated families in Costa Rica (36Sobacchi C. Frattini A. Orchard P. Porras O. Tezcan I. Andolina M. Babul-Hirji R. Baric I. Canham N. Chitayat D. Dupuis-Girod S. Ellis I. Etzioni A. Fasth A. Fisher A. Gerritsen B. Gulino V. Horwitz E. Klamroth V. Lanino E. Mirolo M. Musio A. Matthijs G. Nonomaya S. Notarangelo L.D. Ochs H.D. Superti Furga A. Valiaho J. Van Hove J.L. Vihinen M. Vujic D. Vezzoni P. Villa A. Hum. Mol. Genet. 2001; 10: 1767-1773Crossref PubMed Scopus (188) Google Scholar, 45Fasth A. Porras O. Pediatr. Transplant. 1999; 3: 102-107Crossref PubMed Scopus (63) Google Scholar). We have recreated these a3 mutations in the yeast a subunit ortholog, Vph1p, as G424R and R462L. Of the 21 a4 mutations, only three were missense mutations. We recreated two of them, P524L and G820R, in Vph1p as W520L and G812R. Characterizing the effect of these missense mutations can identify critical domains within a3 and a4 that are essential for assembly, targeting, or retention and retrieval of V-ATPases to and from the plasma membrane. Technically, it is difficult to characterize these mutations in humans. The only biochemical information is from fibroblast and lymphoblast cell lines from patients with frameshift and abnormal splicing mutations, and those studies confirm the expected null phenotype (37Kornak U. Schulz A. Friedrich W. Uhlhaas S. Kremens B. Voit T. Hasan C. Bode U. Jentsch T.J. Kubisch C. Hum. Mol. Genet. 2000; 9: 2059-2063Crossref PubMed Scopus (295) Google Scholar, 44Susani L. Pangrazio A. Sobacchi C. Taranta A. Mortier G. Savarirayan R. Villa A. Orchard P. Vezzoni P. Albertini A. Frattini A. Pagani F. Hum. Mutat. 2004; 24: 225-235Crossref PubMed Scopus (89) Google Scholar). Yeast V-ATPases are an attractive model for the study of the biochemistry of a3 and a4 mutations because the a subunit is remarkably conserved across species. The subunit sequences of human a3 and a4 isoforms have ∼55% similarity to the yeast ortholog, Vph1p. Characterizing the mechanistic outcome of a3 and a4 mutations in yeast could reveal critical amino acids involved in V-ATPase assembly, targeting, or activity. Here we have recreated four missense mutations, two from a3 and two from a4 mutations in the yeast Vph1p subunit, and report on their respective V-ATPase assembly and activity phenotypes. Materials—Escherichia coli and yeast culture media were purchased from Difco. General chemicals and protease inhibitors were purchased from Sigma. Restriction endonucleases, T4 DNA ligase, and other molecular biology reagents were from Fermentas Life Sciences (Burlington, Canada). Zymolyase 100T was obtained from Seikagaka Corp. (Rockville, MD). The monoclonal antibodies, 8B1-F3 against the yeast V-ATPase 69-kDa A subunit, 13D-11 against the yeast V-ATPase 60-kDa B subunit, and 10D7 against the 100-kDa a subunit, were purchased from Molecular Probes, Inc. (Eugene, OR). A polyclonal serum against Vma12p was the kind gift from Dr. Tom H. Stevens (University of Oregon), and a serum against Vma22p was the kind gift from Dr. Antony A. Cooper (University of Missouri). Standard YPD medium was formulated as 20 g of Difco peptone, 10 g of yeast extract, and 20 g of d-glucose/liter, with the pH adjusted to 5.8. Strains and Plasmids—For strains and plasmids, see Table 1. Mutagenesis—Yeast strain MM53 MATa ura3-52 Δvph1:: LEU2 (28Manolson M.F. Wu B. Proteau D. Taillon B.E. Roberts B.T. Hoyt M.A. Jones E.W. J. Biol. Chem. 1994; 269: 14064-14074Abstract Full Text PDF PubMed Google Scholar) and plasmids MM322 pRS316 + VPH1 SalI SmaI pRS316 + SalI ScaI pVIPI-78 (28Manolson M.F. Wu B. Proteau D. Taillon B.E. Roberts B.T. Hoyt M.A. Jones E.W. J. Biol. Chem. 1994; 269: 14064-14074Abstract Full Text PDF PubMed Google Scholar), and MM623 pRS316 + VPH1 containing a SacI site were used to generate and study VPH1 mutants. A PCR strategy, gene splicing by overlap extension (gene SOEing), was used to create the mutations (46Horton R.M. Cai Z.L. Ho S.N. Pease L.R. BioTechniques. 1990; 8: 528-535PubMed Google Scholar). Mutagenesis was performed on the EcoRI-NotI fragment of pRS316 (MM322) or the SacI fragments of pRS316 (MM623). Primers used for mutagenesis are listed in Table 1, with substitution sites underlined.TABLE 1Yeast genotypes, plasmids, and primersYeast strainGenotypeRef.MM51MATα ura3-52 trp1 ade6 leu2This studyMM53MATα ura3-52 Δvph1::LEU228Manolson M.F. Wu B. Proteau D. Taillon B.E. Roberts B.T. Hoyt M.A. Jones E.W. J. Biol. Chem. 1994; 269: 14064-14074Abstract Full Text PDF PubMed Google ScholarMM57MATα ura3-52 trp1 ade6 his1 Δvph1::LEU2This studyKHY3MATα ura3-52 leu2-3, 112 his4-579 ade6 pep4-3 Δvma21::LEU221Hill K.J. Stevens T.H. Mol. Biol. Cell. 1994; 5: 1039-1050Crossref PubMed Scopus (94) Google ScholarLGY17MATα ura3-52 leu2-3, 112 his4-579 ade6 pep4-3 Δvma12::LEU223Jackson D.D. Stevens T.H. J. Biol. Chem. 1997; 272: 25928-25934Abstract Full Text Full Text PDF PubMed Scopus (56) Google ScholarKHY34MATα ura3-52 leu2-3, 112 his4-579 ade6 pep4-3 Δvma22::LEU222Hill K.J. Stevens T.H. J. Biol. Chem. 1995; 270: 22329-22336Abstract Full Text Full Text PDF PubMed Scopus (53) Google ScholarPlasmid no.DescriptionRef.MM273pRS426_STV1 4.4-kb SalI-NotI fragment of pRS306_STV1::HA (MM224) into the 5.7-kb fragment of SalI-NotI-cut pRS426This studyMM322pRS316_VPH1 CEN-ARS plasmid expressing wild type Vph1p28Manolson M.F. Wu B. Proteau D. Taillon B.E. Roberts B.T. Hoyt M.A. Jones E.W. J. Biol. Chem. 1994; 269: 14064-14074Abstract Full Text PDF PubMed Google ScholarMM623pRS316_VPH1 + SacI CEN-ARS plasmid (pRS316) expressing Vph1p with SacI site inserted at nucleic acid numbers 1696_1701. Phenotypically identical to wild type Vph1pThis studyMM773pRS316_VPH1_G812R (MM322 used as backbone with MO30 and MO155 with MO154 and T7 and MO30 and T7)This studyMM774pRS316_VPH1 + SacI site_R462L (MM623 used as backbone with MO23 and MO157 plus MO156 and T7 and MO23 plus T7)This studyMM775pRS316_VPH1 + SacI site_W520L (MM623 used as backbone MO23 and MO161 and MO160 and T7, plus MO23 and T7)This studyMM776pRS316_VPH1 + SacI site_G424R (MM623 used as backbone MO23 and MO159 and MO158 and T7 plus MO23 and T7)This studyMM826pRS424_VPH1 4-kb SalI-NotI fragment of pRS316 (MM623) into SalI-NotI cut pRS 424This studyMM8272-μm plasmid URA3 pRS426_VPH1 4-kb SalI-NotI fragment of pRS316_Vph1p_SacI (MM623) into SalI-NotI cut pRS426This studyMM828pRS314_VPH1_W520L 4-kb SalI-NotI fragment of pRS316_VPH1_W520L (MM775) into SalI-NotI cut pRS314This studyMM829pRS424_VPH1_W520L 4-kb SalI-NotI fragment of pRS316 (MM775) into SalI-NotI cut pRS424This studyPrimer no.5′-3′ sequence (mutations underscored)MO23CAGTACAGAGAGCTCAATGCTGGMO30CTCATCAAGCAAAGGTCCAAGTGMO154CCAAGTTTTTCGTGCGTGAAGGTTTACMO155GGTAAACCTTCACGCACGAAAAACTTGGMO156GGCCTTCACTGGGTTGTACATTATTTGMO157CAAAATAATGTACAACCCAGTGAAGGCCMO158CATCATGTTTAGGGATATGGGTCMO159CATATCCCTAAACATGATGGCMO160CCTATCGGTCTAGATTTGGCTTGGCATGGMO161CCATGCCAAGCCAAATCTAGACCGATAGGT7TAATACGACTCACTATAGGG Open table in a new tab For VPH1 mutation G812R, first round PCR primers were MO30 and MO155 with MO154 and T7. Primers MO30 and T7 were used for second round PCR. The PCR product was cut with EcoRI and NotI and cloned into pRS316 from MM322 cut with EcoRI and NotI. For VPH1 mutation R462L, first round PCR primers were MO23 and MO157 with T7 and MO156. Primers MO23 and T7 were used for second round PCR. The PCR product was cut with SacI and cloned into pRS316 from MM623 cut with SacI. For VPH1 mutation W520L, first round PCR primers were MO23 and MO161 with T7 and MO160. Primers MO23 and T7 were used for second round PCR. The PCR product was cut with SacI and cloned into pRS316 from MM623 cut with SacI. For VPH1 mutation G424R, first round PCR primers were MO23 and MO159 with T7 and MO158. Primers MO23 and T7 were used for second round PCR. The PCR pr

Referência(s)