Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Secreted Cyclophilin A, a Peptidylprolyl cis-trans Isomerase, Mediates Matrix Assembly of Hensin, a Protein Implicated in Epithelial Differentiation

2008; Elsevier BV; Volume: 284; Issue: 10 Linguagem: Inglês

10.1074/jbc.m808964200

ISSN

1083-351X

Autores

Peng Hu, Soundarapandian Vijayakumar, Cordelia Schiene‐Fischer, Hui Li, Jeffrey M. Purkerson, Miroslav Malešević, Jürgen Liebscher, Qais Al‐Awqati, George J. Schwartz,

Tópico(s)

Peptidase Inhibition and Analysis

Resumo

Hensin is a rabbit ortholog of DMBT1, a multifunctional, multidomain protein implicated in the regulation of epithelial differentiation, innate immunity, and tumorigenesis. Hensin in the extracellular matrix (ECM) induced morphological changes characteristic of terminal differentiation in a clonal cell line (clone C) of rabbit kidney intercalated cells. Although hensin is secreted in monomeric and various oligomeric forms, only the polymerized ECM form is able to induce these phenotypic changes. Here we report that hensin secretion and matrix assembly were inhibited by the peptidylprolyl cis-trans isomerase (PPIase) inhibitors cyclosporin A (CsA) and a derivative of cyclosporin A with modifications in the d-Ser side chain (Cs9) but not by the calcineurin pathway inhibitor FK506. PPIase inhibition led to failure of hensin polymerization in the medium and ECM, plus the loss of apical cytoskeleton, apical microvilli, and the columnar epithelial shape of clone C cells. Cyclophilin A was produced and secreted into the media to a much greater extent than cyclophilins B and C. Our results also identified the direct CsA-sensitive interaction of cyclophilin A with hensin, suggesting that cyclophilin A is the PPIase that mediates the polymerization and matrix assembly of hensin. These results are significant because this is the first time a direct role of peptidylprolyl cis-trans isomerase activity has been implicated in the process of epithelial differentiation. Hensin is a rabbit ortholog of DMBT1, a multifunctional, multidomain protein implicated in the regulation of epithelial differentiation, innate immunity, and tumorigenesis. Hensin in the extracellular matrix (ECM) induced morphological changes characteristic of terminal differentiation in a clonal cell line (clone C) of rabbit kidney intercalated cells. Although hensin is secreted in monomeric and various oligomeric forms, only the polymerized ECM form is able to induce these phenotypic changes. Here we report that hensin secretion and matrix assembly were inhibited by the peptidylprolyl cis-trans isomerase (PPIase) inhibitors cyclosporin A (CsA) and a derivative of cyclosporin A with modifications in the d-Ser side chain (Cs9) but not by the calcineurin pathway inhibitor FK506. PPIase inhibition led to failure of hensin polymerization in the medium and ECM, plus the loss of apical cytoskeleton, apical microvilli, and the columnar epithelial shape of clone C cells. Cyclophilin A was produced and secreted into the media to a much greater extent than cyclophilins B and C. Our results also identified the direct CsA-sensitive interaction of cyclophilin A with hensin, suggesting that cyclophilin A is the PPIase that mediates the polymerization and matrix assembly of hensin. These results are significant because this is the first time a direct role of peptidylprolyl cis-trans isomerase activity has been implicated in the process of epithelial differentiation. Hensin is a rabbit ortholog of the human DMBT1 gene, which has been implicated in the etiology of many cancer forms and in innate immune defense (1Takito J. Yan L. Ma J. Hikita C. Vijayakumar S. Warburton D. Al-Awqati Q. Am. J. Physiol. 1999; 277: F277-F289PubMed Google Scholar, 2Kang W. Reid K.B. FEBS Lett. 2003; 540: 21-25Crossref PubMed Scopus (77) Google Scholar, 3Mollenhauer J. Herbertz S. Holmskov U. Tolnay M. Krebs I. Merlo A. Schroder H.D. Maier D. Breitling F. Wiemann S. Grone H.J. Poustka A. Cancer Res. 2000; 60: 1704-1710PubMed Google Scholar). We previously established that the extracellular matrix (ECM) 3The abbreviations used are: ECM, extracellular matrix; SRCR, scavenger receptor cysteine-rich; SID, SRCR-interspersed domain; ZP, zona pellucida; PPIase, peptidylprolyl cis-trans isomerase; CsA, cyclosporin A; Cyp, cyclophilin; LiE, 6-(3,4-dichlorophenyl)-4-(N,N-dimethylaminoethylthio)-2-phenylpyriidine; Fmoc, N-(9-fluorenyl)methoxycarbonyl; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; CHAPS, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid; RT, reverse transcription; Ni-NTA, nickel-nitrilotriacetic acid; ANOVA, analysis of variance; HD, high density; FKBP, FK506 (tacrolimus)-binding protein. form of hensin induces, in a clonal cell line of rabbit kidney intercalated cells, terminal differentiation-like features including remodeling of the apical cytoskeleton, induction of apical endocytosis, and columnarization of the cell shape (1Takito J. Yan L. Ma J. Hikita C. Vijayakumar S. Warburton D. Al-Awqati Q. Am. J. Physiol. 1999; 277: F277-F289PubMed Google Scholar). In addition, hensin is present in a pattern compatible with ECM deposition in the mature columnar epithelia of the intestinal villus and prostate luminal cells but not in the less differentiated epithelia of the crypt of the small intestine and basal cells of the prostate, suggesting a general role for ECM hensin in terminal differentiation of epithelia. ECM hensin is critical for the adaptation of the cortical collecting duct to metabolic acidosis, during which an increase in the number of acid-secreting α-intercalated cells is observed (4Schwartz G.J. Tsuruoka S. Vijayakumar S. Petrovic S. Mian A. Al-Awqati Q. J. Clin. Investig. 2002; 109: 89-99Crossref PubMed Scopus (98) Google Scholar). Hensin is a modular protein containing a signal peptide, SRCR (scavenger receptor, cysteine-rich) domains, SIDs (SRCR-interspersed domains), CUB (C1r/C1s Uegf Bmp1) domains, and a ZP (zona pellucida) domain (supplemental Fig. 1). SIDs are short (20Dornan J. Taylor P. Walkinshaw M.D. Curr. Top. Med. Chem. 2003; 3: 1392-1409Crossref PubMed Scopus (101) Google Scholar, 21Friedman J. Weissman I. Friedman J. Alpert S. Am. J. Pathol. 1994; 144: 1247-1256PubMed Google Scholar, 22Pastorino L. Sun A. Lu P.J. Zhou X.Z. Balastik M. Finn G. Wulf G. Lim J. Li S.H. Li X. Xia W. Nicholson L.K. Lu K.P. Nature. 2006; 440: 528-534Crossref PubMed Scopus (409) Google Scholar, 23Yurchenko V. Zybarth G. O'Connor M. Dai W.W. Franchin G. Hao T. Guo H. Hung H.-C. Toole B. Gallay P. Sherry B. Bukrinsky M. J. Biol. Chem. 2002; 277: 22959-22965Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar, 24Wang P. Heitman J. Genome Biol. 2005; 6: 226.1-226.6Crossref Scopus (498) Google Scholar, 25Bukrinsky M.I. Trends Immunol. 2002; 23: 323-325Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar, 26Mi Z. Oliver T. Guo H. Gao C. Kuo P.C. Cancer Res. 2007; 67: 4088-4097Crossref PubMed Scopus (48) Google Scholar, 27Yang F. Robotham J.M. Nelson H.B. Irsigler A. Kenworthy R. Tang H. J. Virol. 2008; 82: 5269-5278Crossref PubMed Scopus (201) Google Scholar, 28Jin Z.-G. Melaragno M.G. Liao D.-F. Yan C. Haendeler J. Suh Y.-A. Lambeth J.D. Berk B.C. Circ. Res. 2000; 87: 789-796Crossref PubMed Scopus (334) Google Scholar, 29Yang H. Li M. Chai H. Yan S. Lin P. Lumsden A.B. Yao Q. Chen C. J. Surg. Res. 2005; 123: 312-319Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar, 30Jovine L. Qi H. Williams Z. Litscher E. Wassarman P.M. Nat. Cell Biol. 2002; 4: 457-461Crossref PubMed Scopus (265) Google Scholar residues long) stretches that are rich in proline and threonine residues (5Mollenhauer J. Muller H. Kollender G. Lyer S. Diedrichs L. Helmke B. Holmskov U. Ligtenberg T. Herbertz S. Krebs I. Madsen J. Bikker F. Schmitt L. Wiemann S. Scheurlen W. Otto H.F. von Deimling A. Poustka A. Genes Chromosomes Cancer. 2002; 35: 242-255Crossref PubMed Scopus (40) Google Scholar). Hensin is expressed in most epithelia in various alternately spliced forms. Its deletion in mice leads to embryonic lethality at the time of generation of the first columnar epithelium, the visceral endoderm (6Takito J. Al-Awqati Q. J. Cell Biol. 2004; 166: 1093-1102Crossref PubMed Scopus (54) Google Scholar). We discovered that although hensin is secreted in monomeric form in the intercalated cell line when seeded at low density, it is found in many higher order oligomeric forms in the conditioned medium of the same cell line when seeded at superconfluent density (7Hikita C. Takito J. Vijayakumar S. Al-Awqati Q. J. Biol. Chem. 1999; 274: 17671-17676Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). Moreover, the high density cells deposited a polymeric detergent-insoluble form of hensin in the ECM. Only this ECM form of hensin was found to be functionally active in the development of fully differentiated phenotype of this cell line. Galectin-3, a lectin that binds to β-galactoside, interacts with ECM hensin through protein-protein interactions and was implicated as playing a key role in the functional assembly of ECM hensin (8Hikita C. Vijayakumar S. Takito J. Erdjument-Bromage H. Tempst P. Al-Awqati Q. J. Cell Biol. 2000; 151: 1235-1246Crossref PubMed Scopus (130) Google Scholar). However, the soluble monomeric and other oligomeric forms of hensin found in the conditioned medium were not associated with galectin-3, suggesting that other mechanisms are involved in the oligomerization and proper folding of hensin. In many proteins containing proline, both de novo protein folding and the refolding processes following cellular membrane traffic necessitate isomerization of the preceding peptide bond to the cis form with side chains adjacent to each other instead of the sterically favored trans form with side chains opposite each other. Spontaneous isomerization of peptidylprolyl bonds is a slow process, which not only constitutes a rate-limiting step in protein folding but also occurs during the assembly of multidomain proteins (9Fischer G. Aumuller T. Rev. Physiol. Biochem. Pharmacol. 2003; 148: 105-150Crossref PubMed Scopus (205) Google Scholar). In addition to FKBP and parvulins, cyclophilins constitute a family of the enzyme class of peptidylprolyl cis-trans isomerases (PPIases) that accelerate peptidylprolyl cis-trans isomerization (10Fanghanel J. Fischer G. Front. Biosci. 2004; 9: 3453-3478Crossref PubMed Scopus (198) Google Scholar). A possible role of peptidylprolyl cis-trans isomerase activity in the extracellular matrix assembly of hensin came to light when we were investigating the role of cyclosporin A (CsA), a widely used immunosuppressant, in causing distal renal tubular acidosis (11Watanabe S. Tsuruoka S. Vijayakumar S. Fischer G. Zhang Y. Fujimura A. Al-Awqati Q. Schwartz G.J. Am. J. Physiol. 2005; 288: F40-F47Crossref PubMed Scopus (57) Google Scholar, 12Tsuruoka S. Schwartz G.J. Wakaumi M. Nishiki K. Yamamoto H. Purkerson J.M. Fujimura A. J. Pharmacol. Exp. Ther. 2003; 305: 840-845Crossref PubMed Scopus (19) Google Scholar). Although the immunosuppressive property of CsA is attributed to its interaction with its cytosolic receptor cyclophilin A (CypA) to inhibit calcineurin, a serine-threonine phosphatase required for cytokine induction in response to stimulation of T cells, CsA also inhibits the PPIase activity of cyclophilins. Using microperfused rabbit kidney collecting tubules, we observed that treatment with CsA but not FK506 (a FKBP PPIase activity inhibitor that inhibits calcineurin in complex with FKBP) caused a form of distal renal tubular acidosis in these tubules concomitant with a decrease in the deposition of hensin in the ECM of these tubules, suggesting the role of PPIase activity in this process (11Watanabe S. Tsuruoka S. Vijayakumar S. Fischer G. Zhang Y. Fujimura A. Al-Awqati Q. Schwartz G.J. Am. J. Physiol. 2005; 288: F40-F47Crossref PubMed Scopus (57) Google Scholar). In this study, using cell lines derived from rabbit kidney collecting ducts, we show that CsA regulates the extracellular matrix assembly of hensin and the differentiation features of kidney intercalated cells by inhibiting PPIase activity. In addition, our study demonstrates that CypA is the candidate peptidylprolyl cis-trans isomerase responsible for this activity in these cell lines. Our results, establish for the first time a direct role of cyclophilin-mediated PPIase activity in epithelial differentiation. Cell Culture-Stock cultures of clone C of β-intercalated cells established from rabbit kidney cortex were maintained at 32 °C (13van Adelsberg J. Edwards J.C. Takito J. Kiss B. Al-Awqati Q. Cell. 1994; 76: 1053-1061Abstract Full Text PDF PubMed Scopus (81) Google Scholar, 14van Adelsberg J. Edwards J.C. Herzlinger D. Cannon C. Rater M. Al-Awqati Q. Am. J. Physiol. 1989; 256: C1004-C1011Crossref PubMed Google Scholar). The cells were trypsinized and seeded on polycarbonate filters (pore size, 0.4 μm; Costar Corp.) at a density of 2 × 104 cells/cm2 (low density) or 5 × 105 cells/cm2 (high density) and transferred to 40 °C to inactivate the T antigen. Immunocytochemistry-Clone C cells were plated at high density and cultured in the presence or absence of the reagent CsA, Cs9, FK506, or 6-(3,4-dichlorophenyl)-4-(N,N-dimethylaminoethylthio)-2-phenylpyriidine (LiE) for 2-5 days at 40 °C on Transwell filters. For F-actin staining, monolayers were fixed in 4% paraformaldehyde and stained with rhodaminephalloidin (R-415; Molecular Probes, Inc.). Stained monolayers were viewed using an LSM 510 Meta laser-scanning microscope equipped with Axiovert 200M (Carl Zeiss). Images were collected in 0.6-1-μm-thick optical sections and analyzed using a Zeiss LSM5 image browser and LSM-PC (LSM 410) software. The final images were processed with Adobe Photoshop® 6.0 software (Adobe Systems Inc.). In Fig. 1A, which shows apical versus basal actin staining, the top three apical sections and bottom three basal sections (0.6 μm each) were projected together. Guinea pig anti-hensin antibodies were obtained by immunizing fusion protein containing SRCR domains 5 and 6 of hensin as described previously (15Takito J. Hikita C. Al-Awqati Q. J. Clin. Investig. 1996; 98: 2324-2331Crossref PubMed Scopus (88) Google Scholar). For visualization of extracellular matrix hensin staining, cells were incubated with guinea pig anti-hensin sera (1:50) followed by rhodamine-conjugated antiguinea pig antibody (Jackson ImmunoResearch, West Grove, PA), washed, and then fixed with cold methanol. Nuclear staining with SYTOX green dye (Molecular Probes) was performed after fixation, and the filters were then viewed using confocal microscopy as described above. A projection of three to four basal 0.6-μm sections is depicted in Fig. 2A. Scanning Electron Microscopy-Filters were washed in phosphate-buffered saline and fixed with 2.5% glutaraldehyde in 100 mm phosphate buffer. The filters were postfixed for 1 h in 1% osmium tetroxide, 1.5% potassium ferricyanide and dehydrated through a graded ethanol series (50, 70, 85, 95, 100, 100, and 100%) for 10 min at each concentration. Afterward, cells underwent critical point drying using CO2 in an Omar SPC-1500 critical point dryer. The filters were cut from their holders and mounted on copper specimen supports, sputter-coated with ∼11 nm of gold-palladium in a sputtering unit (Pelco 91000; Ted Pella Inc.), and viewed at 20 kV in an electron microscope (JEOL 100 CX-II; JEOL USA, Inc.) equipped with an analytical scanning imaging device scanning unit. Images were recorded on Polaroid Type 55 positive/negative film. Analysis of Shape and Height of Clone C Cells-All analyses of cell size and height were performed with a Microsoft Windows®-based version of Zeiss 410 laser-scanning microscope software (Carl Zeiss GmbH). For size measurements, individual cell boundaries of the merged phalloidin-SYTOX image from a field of view from each specific sample (i.e. HD + CsA, etc.) were delineated using a mouse-driven marker (via the Mark Area subfunction of the Area Measure function of this software), and the area obtained in μm2 was recorded. For measuring the height of the cells, the X/Z section of a sequence of images was used. 10-15 individual measurements on three different fields of view were recorded for each sample; the experiments were repeated five times. Conditioned Media Preparation and Density Gradient Analysis-Clone C cells were seeded at high density and cultured in the presence or absence of 10 μm CsA, 20 μm Cs9, or 500 nm FK506 for 2 days at 40 °C and then washed with phosphate-buffered saline and cultured in serum-free culture medium for another 6 h. Conditioned medium from both the apical and basal compartments of the Transwell® filters from each sample was collected after 6 h and concentrated with Centricon® centrifugal filter units (Millipore, Billerica, MA), and protein concentration was determined using a BCA assay (Pierce). Concentrated conditioned media were loaded on 12 ml of 5-30% sucrose gradients (7Hikita C. Takito J. Vijayakumar S. Al-Awqati Q. J. Biol. Chem. 1999; 274: 17671-17676Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar) and ultracentrifuged at 100,000 × g for 16 h at 4 °C. Proteins in each fraction (1 ml) were precipitated by 10% trichloroacetic acid, dissolved in a sample buffer, and subjected to 10% SDS-PAGE followed by Western blotting with anti-hensin antibody. Preparation of Extracellular Matrix-Clone C cells seeded at high density and cultured in the presence or absence of 10 μm CsA, 20 μm Cs9, or 500 nm FK506 for 2 days at 40 °C were extracted with lysis buffer (1% Triton X-100 and 1 mm calcium chloride) for 1 h at 4 °C in a rotary shaker. Filters were scraped in this solution with a cell scraper to remove cell extracts and loosely attached materials. The filters were then washed thoroughly with the same solution for another hour at 4 °C. Insoluble material remaining on these filters was extracted with ECM extraction buffer (4 m guanidine hydrochloride, 50 mm sodium acetate, pH 6.5, 5 mm EDTA, and 0.5% CHAPS) at 4 °C overnight (7Hikita C. Takito J. Vijayakumar S. Al-Awqati Q. J. Biol. Chem. 1999; 274: 17671-17676Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar, 16Vijayakumar S. Takito J. Hikita C. Al-Awqati Q. J. Cell Biol. 1999; 144: 1057-1067Crossref PubMed Scopus (81) Google Scholar). ECM extracts were then dialyzed against 50 mm Tris-HCl, pH 8.0, at 4 °C overnight. 35S Labeling, Pulse-Chase, and Immunoprecipitation-Clone C cells were seeded at high density and cultured in the presence or absence of CsA, Cs9 and FK506 overnight at 40 °C. After cells were cultured in methionine- and cysteine-free minimum Eagle's medium (with or without inhibitors) for 3 h, they were pulse-labeled with 100 μCi/ml 35S (Expre35S35S protein labeling mix, PerkinElmer Life Sciences) in culture medium for 2 h. Pulse labeling was followed by chase with regular medium supplemented with 10 mm l-methionine. All Transwell® filters were incubated with exactly 3 ml of medium, and all 3 ml of medium were collected and mixed with 300 μl of cell lysis buffer (see below) at the indicated chase periods for immunoprecipitation. Cells were lysed in 1% SDS, 1 mm EDTA, 1% Triton X-100, and 10 mm Tris-HCl, pH 8.0, and boiled for 3 min. Insoluble materials were removed by a brief centrifugation (14,000 × g for 5 min at room temperature), and the total cell lysate from each sample was diluted 10-fold with 10 mm Tris-HCl, pH 8.0, and used for immunoprecipitation. Conditioned medium and cell lysate samples were incubated with guinea pig anti-hensin serum (1:500 dilution) at 4 °C for 1 h followed by the addition of protein A-Sepharose CL-4B (Amersham Biosciences) at 4 °C for another 1 h. Beads were washed three times with a buffer containing 0.1% SDS, 0.1 mm EDTA, 0.1% Triton X-100, and 10 mm Tris-HCl, pH 8.0, boiled in sample buffer for 3 min, and then subjected to SDS-PAGE. Gels were fixed with 10% acetic acid, 10% methanol, soaked in Amplify™ solution (Amersham Biosciences), dried, and exposed to x-ray film at -80 °C for 2 days. The autoradiographs were scanned using an HP Scanjet 8300, and densitometry was performed using ImageJ (National Institutes of Health) software. The values were normalized to the highest densitometric value for high density control, set to 100. Statistical analysis of these normalized densitometric results was performed using GraphPad Instat3 (La Jolla, CA) software. Cell Number Analysis-High density cells were cultured in the presence and absence of CsA, Cs9, and FK506 for 2 days and stained with SYTOX green nuclear stain. The stained cells were observed visually either in a fluorescent microscope or in a confocal microscope, and cells from each Transwell filter that occupied a 10,000 square μ area of eight different fields of view were counted. This procedure was repeated in six different filters obtained from at least three independent experiments. His-tagged Recombinant CypA Cloning, Expression, and Purification in pET System-Total RNA was extracted from rabbit kidney cortex with an RNeasy Mini Kit (Qiagen, Inc., Valencia, CA). The cloning primers were designed based on the GenBank™ sequence data base (GenBank™ accession number AF139893). 5′-GGAATTCCATATGGTCAACCCCA-3′ and 5′-CCGCTCGAGTTGACACCTGTTGAG-3′ were used as the sense and antisense CypA primers, respectively. The full-length rabbit CypA cDNA was generated with the SuperScript™ III One-step RT-PCR system with Platinum Taq High Fidelity (Invitrogen) and cloned into Escherichia coli expression vector pET26b (Novagen, Madison, WI) by using NdeI and XhoI cloning sites. After the construct was confirmed by DNA sequencing, it was transformed into E. coli Rosetta 2(DE3) strain (Qiagen) and induced with 1 mm isopropyl-1-thio-d-galactopyranoside for 4 to 6 h. Protein was extracted from these cultures using standard methods and purified using Ni-NTA-agarose. Ni-NTA eluate was characterized with 15% SDS-polyacrylamide gels, and CypA identity was confirmed by immunoblotting with anti-CypA and anti-His tag antibody. Hensin-recombinant CypA Binding Assay-Purified recombinant C-terminal His-tagged CypA (100 μg) was dialyzed against Tris-buffered saline to remove imidazole and immobilized on equilibrated Ni-NTA beads with a gentle rocking motion on a rotating platform for 1 h at 4 °C. After extensive washes with Tris-buffered saline, the Ni-NTA beads were incubated with or without 10 μm CsA for 1 h. Conditioned media from high density cultures (400 μg of total protein) were then added to these beads and incubated with gentle rocking on a platform at 4 °C for 1 h. After the beads were washed with Tris-buffered saline to remove nonspecific binding partners, CypA-binding proteins were eluted with elution buffer (50 mm NaH2PO4, 300 mm NaCl, 250 mm imidazole buffer, pH 8.0). The samples were examined by electrophoresis on 10% SDS-polyacrylamide gels followed by immunoblot with anti-hensin antibody. Real-time PCR Assay-Total RNA was extracted from high density clone C cells cultured for 2 days in the presence or absence of CsA (10 μm), Cs9 (20 μm), or FK506 (500 nm) using the RNeasy® Mini Kit (Qiagen). After the RNA integrity was verified, first-strand cDNA was synthesized from 500 ng of total RNA utilizing a SuperScript® III first-strand cDNA synthesis kit (Invitrogen). Forward/reverse primers and fluorogenic probes (TaqMan®, fluorogenic 5′-nuclease chemistry) shown in Table 1 were designed using PrimerExpress™ software (Applied Biosystems, Foster City, CA) and were synthesized by Integrated DNA Technologies (IDT, Coralville, IA). The relative abundance of β-actin, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), Cyp isoforms, and hensin mRNA was determined by quantitative real-time PCR using the respective primer/probe sets and the ABI Prism 7000 Sequence Detection System and software. Plasmids containing a gene-specific sequence for rabbit β-actin, GAPDH, Cyp isoforms, or hensin were used to generate standard curves from which the relative mRNA copy number was calculated.TABLE 1TaqMan real-time PCR primers and probes developed in this studySequence 5′ to 3′β-ActinForward primer GACCGACTACCTCATGAAGATCCTReverse primer TGATGTCCCGCACGATCTCProbe TACAGCTTCACCACCACGGCCGGAPDHForward primer TGCACCACCACCAACTGCTTAGReverse primer GGTCTTCTGGGTGGCAGTGTGAProbe TCATCCACGACCACTTCGGCATTGTHensinForward primer AACCACTGTAGGGCCCTCTTCAAAReverse primer AGGTAACCAGAAGGCACGGCTATTProbe CCCAACAATGCCCTCTGTGTCTGGGACypAForward primer CACCTGACCATTCCTCTAGCTCAReverse primer ACAATTCAGGGCGTCACGAProbe AGCGCCCTCCGCCCCCATCTCypBForward primer CAGTTCTTCATCACCACAGTCAAGAReverse primer CCTCCAGAACTTTGCCAAACAProbe CTGGCTGGACGGCAAGCACGTCypCForward primer TTGATGTGAGGATCGGAGACAAReverse primer CTTGGGCACGACTTTTCCAAProbe TGTCGGCAGAATTGTGATTGCCTT Open table in a new tab Electroblot Analysis of Cellulose-bound Hensin Peptides-The cellulose-bound peptide scan of the entire hensin sequence consisted of 12-mer peptides overlapping by 9 amino acids and anchored via a C-terminal (β-Ala)2 spacer on the membrane. The cellulose-bound peptide scan was prepared by standard automated spot synthesis (17Hilpert K. Winkler D.F. Hancock R.E. Nat. Protoc. 2007; 2: 1333-1349Crossref PubMed Scopus (221) Google Scholar, 18Frank R. J. Immunol. Methods. 2002; 267: 13-26Crossref PubMed Scopus (616) Google Scholar) using a pipetting robot (Abimed GmbH, Langenfeld, Germany). The standard SPOT synthesis protocol included coupling of Fmoc amino acids, preactivated as pentafluorophenyl esters. Fmoc protective groups were cleaved with 20% piperidine in dimethylformamide. The side chains of the amino acids were protected as follows: Pbf (arginine), Trt (asparagine, glutamine, histidine, cysteine), tBu (threonine, tyrosine serine), OtBu (aspartic and glutamic acids), Boc (lysine and tryptophan). After coupling, all unreacted amino groups were blocked with acetic anhydride. For analysis of CypA binding, 2 μm recombinant CypA in 20 mm Tris buffer, pH 8.2, was incubated with the membrane for 3 h. Bound protein was transferred to nitrocellulose membrane via electroblotting with a semidry blotter using a constant current of 0.8 mm/cm2. Protein transferred to the nitrocellulose was visualized by polyclonal rabbit antiserum raised against CypA using enhanced chemiluminescence detection (Amersham Biosciences). For studies of specific CsA effects, 30 μm CsA was added to 2 μm CypA in 20 mm Tris buffer, pH 8.2, and preincubated for 30 min prior to incubation of the blot. Statistics-One-way ANOVA statistics (Instat3 GraphPad, La Jolla, CA) were applied to multiple group comparisons (e.g. comparing high density (HD) against HD + CsA, HD + Cs9, HD + FK506) with respect to height, area, and cell numbers. The Tukey-Kramer multiple comparisons test was used if the F value of the ANOVA was significant. Significance was asserted if the p value was less than 0.05. For nonparametric data, the Kruskal-Wallis test was used to compare multiple groups. Inhibitors of PPIase Activity Prevent the Development of Differentiated Phenotype in Clone C Cells-We showed previously that an immortalized clonal cell line (clone C) derived from β-intercalated cells of the rabbit kidney exhibits distinctly different phenotypes when seeded at subconfluent density and superconfluent density (7Hikita C. Takito J. Vijayakumar S. Al-Awqati Q. J. Biol. Chem. 1999; 274: 17671-17676Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). Low density cells (Fig. 1A, top row) exhibited basal actin stress fibers and no subapical actin cytoskeleton, whereas the high density (second row) cells had a subapical actin cytoskeleton and very few basal stress fibers. Scanning electron microscopy showed that the low density cells had sparse microvilli, whereas high density cells had exuberant apical surface infolding and microvilli. The cell shape of these two phenotypes was also different with high density cells being tall with a small cross-sectional area, whereas low density cells were low and flat. This columnarization and the remodeling of the apical cytoplasm was hensin-dependent; it could be induced by seeding low density cells on filters conditioned by high density cells and prevented by an antibody to hensin (7Hikita C. Takito J. Vijayakumar S. Al-Awqati Q. J. Biol. Chem. 1999; 274: 17671-17676Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). However, only the polymerized ECM hensin induced the development of terminal differentiation-like features. We tested whether CsA inhibited the development of ECM hensin-mediated actin cytoskeleton remodeling by culturing cells seeded at high density in the presence of 2, 5, and 10 μm CsA. We assayed their effect on actin cytoskeleton remodeling by performing rhodamine phalloidin (F-actin) staining on the monolayers after 4 days in culture and analyzing the results by scanning serial images of the monolayers from top to bottom using confocal microscopy. The cells cultured in the presence of 10 μm CsA almost resembled the low density phenotypes, with exuberant basal stress fibers but no apical actin cytoskeleton (Fig. 1A, third row), whereas the control high density cells had pronounced an apical actin cytoskeleton and very few basal stress fibers. High density cells treated with 2 and 5 μm CsA also had similar but weaker effects (data not shown). As CsA inhibits both PPIase activity and the calcineurin pathway, we tested whether or not the observed inhibition in proper phenotype development of high density cells were due to the inhibition of PPIase activity by performing the following experiments. High density cells were cultured in the presence of 10 and 20 μm Cs9 (derivative 9 of CsA with modifications in the d-Ser side chain (O-[NH2(CH2)5NHC(O)CH2-]-d-Ser)2-CsA), a reagent that has been demonstrated to have a specific effect to inhibit only the PPIase activity of cyclophilins) (19Zhang Y. Erdmann F. Baumgrass R. Schutkowski M. Fischer G. J. Biol. Chem. 2005; 280: 4842-4850Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). High density cells cultured in the presence of 20 μm Cs9 had a dramatic reduction in their apical actin cytoskeleton and a pronounced increase in basal stress fibers (Fig. 1A, fourth row). Concentrations of Cs9 higher than 20 μm were toxic to the cells, and

Referência(s)