Amino-terminal Determinants of U-type Inactivation of Voltage-gated K+ Channels
2002; Elsevier BV; Volume: 277; Issue: 32 Linguagem: Inglês
10.1074/jbc.m111470200
ISSN1083-351X
AutoresHarley T. Kurata, Gordon S. Soon, Jodene Eldstrom, Grace W.K. Lu, David F. Steele, David Fedida,
Tópico(s)Neuroscience and Neuropharmacology Research
ResumoThe T1 domain is a cytosolic NH2-terminal domain present in all Kv (voltage-dependent potassium) channels, and is highly conserved between Kv channel subfamilies. Our characterization of a truncated form of Kv1.5 (Kv1.5ΔN209) expressed in myocardium demonstrated that deletion of the NH2 terminus of Kv1.5 imparts a U-shaped inactivation-voltage relationship to the channel, and prompted us to investigate the NH2 terminus as a regulatory site for slow inactivation of Kv channels. We examined the macroscopic inactivation properties of several NH2-terminal deletion mutants of Kv1.5 expressed in HEK 293 cells, demonstrating that deletion of residues up to the T1 boundary (Kv1.5ΔN19, Kv1.5ΔN91, and Kv1.5ΔN119) did not alter Kv1.5 inactivation, however, deletion mutants that disrupted the T1 structure consistently exhibited inactivation phenotypes resembling Kv1.5ΔN209. Chimeric constructs between Kv1.5 and the NH2 termini of Kv1.1 and Kv1.3 preserved the inactivation kinetics observed in full-length Kv1.5, again suggesting that the Kv1 T1 domain influences slow inactivation. Furthermore, disruption of intersubunit T1 contacts by mutation of residues Glu131 and Thr132to alanines resulted in channels exhibiting a U-shaped inactivation-voltage relationship. Fusion of the NH2terminus of Kv2.1 to the transmembrane segments of Kv1.5 imparted a U-shaped inactivation-voltage relationship to Kv1.5, whereas fusion of the NH2 terminus of Kv1.5 to the transmembrane core of Kv2.1 decelerated Kv2.1 inactivation and abolished the U-shaped voltage dependence of inactivation normally observed in Kv2.1. These data suggest that intersubunit T1 domain interactions influence U-type inactivation in Kv1 channels, and suggest a generalized influence of the T1 domain on U-type inactivation between Kv channel subfamilies. The T1 domain is a cytosolic NH2-terminal domain present in all Kv (voltage-dependent potassium) channels, and is highly conserved between Kv channel subfamilies. Our characterization of a truncated form of Kv1.5 (Kv1.5ΔN209) expressed in myocardium demonstrated that deletion of the NH2 terminus of Kv1.5 imparts a U-shaped inactivation-voltage relationship to the channel, and prompted us to investigate the NH2 terminus as a regulatory site for slow inactivation of Kv channels. We examined the macroscopic inactivation properties of several NH2-terminal deletion mutants of Kv1.5 expressed in HEK 293 cells, demonstrating that deletion of residues up to the T1 boundary (Kv1.5ΔN19, Kv1.5ΔN91, and Kv1.5ΔN119) did not alter Kv1.5 inactivation, however, deletion mutants that disrupted the T1 structure consistently exhibited inactivation phenotypes resembling Kv1.5ΔN209. Chimeric constructs between Kv1.5 and the NH2 termini of Kv1.1 and Kv1.3 preserved the inactivation kinetics observed in full-length Kv1.5, again suggesting that the Kv1 T1 domain influences slow inactivation. Furthermore, disruption of intersubunit T1 contacts by mutation of residues Glu131 and Thr132to alanines resulted in channels exhibiting a U-shaped inactivation-voltage relationship. Fusion of the NH2terminus of Kv2.1 to the transmembrane segments of Kv1.5 imparted a U-shaped inactivation-voltage relationship to Kv1.5, whereas fusion of the NH2 terminus of Kv1.5 to the transmembrane core of Kv2.1 decelerated Kv2.1 inactivation and abolished the U-shaped voltage dependence of inactivation normally observed in Kv2.1. These data suggest that intersubunit T1 domain interactions influence U-type inactivation in Kv1 channels, and suggest a generalized influence of the T1 domain on U-type inactivation between Kv channel subfamilies. voltage-gated potassium full-length Kv1.5 first transmembrane segment tetraethyl ammonium The inactivation mechanisms exhibited by different voltage-gated potassium (Kv)1 channels provide important physiological means by which the duration of action potentials in many excitable tissues is regulated at different frequencies and potentials. Inactivation of Kv channels has historically been divided into two categories, fast (N-type) inactivation which involves occlusion of the inner pore by an NH2-terminal ball, and slow (C-type) inactivation which involves a concerted constriction of the outer mouth of the channel pore (1Panyi G. Sheng Z. Tu L. Deutsch C. Biophys. J. 1995; 69: 896-903Abstract Full Text PDF PubMed Scopus (155) Google Scholar, 2Ogielska E.M. Aldrich R.W. J. Gen. Physiol. 1998; 112: 243-257Crossref PubMed Scopus (54) Google Scholar, 3Hoshi T. Zagotta W.N. Aldrich R.W. Neuron. 1991; 7: 547-556Abstract Full Text PDF PubMed Scopus (568) Google Scholar). However, recent studies have distinguished a second slow inactivation phenotype termed U-type inactivation, which has been characterized in several voltage-gated K+ channels, including Kv2.1 (4Klemic K.G. Shieh C.C. Kirsch G.E. Jones S.W. Biophys. J. 1998; 74: 1779-1789Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar) and most recently in Shaker and Kv3.1 (5Klemic K.G. Kirsch G.E. Jones S.W. Biophys. J. 2001; 81: 814-826Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). U-type inactivation has been named for its characteristic U-shaped inactivation-voltage relationship, showing maximal inactivation at intermediate potentials where only a fraction of channels are open, and less pronounced inactivation at more positive potentials where channel opening has saturated (5Klemic K.G. Kirsch G.E. Jones S.W. Biophys. J. 2001; 81: 814-826Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). This U-shaped voltage- dependence of inactivation is caused by preferential inactivation from channel closed states, although the conformational changes underlying U-type inactivation remain unclear. Interestingly, whereas C-type inactivation is slowed by elevation of extracellular K+, this condition generally accelerates U-type inactivation, suggesting a distinct mechanism for channel inactivation (4Klemic K.G. Shieh C.C. Kirsch G.E. Jones S.W. Biophys. J. 1998; 74: 1779-1789Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar, 5Klemic K.G. Kirsch G.E. Jones S.W. Biophys. J. 2001; 81: 814-826Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). In addition, our laboratory has recently demonstrated that a naturally occurring NH2-terminal truncated form of the cardiac potassium channel Kv1.5 (Kv1.5ΔN209) exhibits a U-type inactivation phenotype (6Attali B. Lesage F. Ziliani P. Guillemare E. Honoré E. Waldmann R. Hugnot J.-P. Mattéi M.-G. Lazdunski M. Barhanin J. J. Biol. Chem. 1993; 268: 24283-24289Abstract Full Text PDF PubMed Google Scholar, 7Fedida D. Wible B. Wang Z. Fermini B. Faust F. Nattel S. Brown A.M. Circ. Res. 1993; 73: 210-216Crossref PubMed Scopus (308) Google Scholar, 8Kurata H.T. Soon G.S. Fedida D. J. Gen. Physiol. 2001; 118: 315-332Crossref PubMed Scopus (31) Google Scholar). This finding clearly suggests that Kv1.5 possesses machinery to undergo both C-type and U-type inactivation, and directed our attention toward an investigation of the NH2 terminus as a potential regulatory site of U-type inactivation in Kv1.5 and other channels. A number of recent studies have investigated a modular architecture of potassium channel gating machinery, considering the membrane-bound segments of potassium channels as interchangeable pore modules and voltage-sensing modules (9Caprini M. Ferroni S. Planells-Cases R. Rueda J. Rapisarda C. Ferrer-Montiel A. Montal M. J. Biol. Chem. 2001; 276: 21070-21076Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar, 10Lu Z. Klem A.M. Ramu Y. Nature. 2001; 413: 809-813Crossref PubMed Scopus (274) Google Scholar). However, structural and biochemical evidence for modularity within Kv channels is strongest with respect to the NH2-terminal T1 domain, a roughly 120-amino acid cytosolic region that is highly conserved within Kv channel subfamilies. Crystal structures determined for T1 domains of bothShaker and Shaw family channels demonstrate that the T1 domains are arranged as a rotationally symmetrical tetramer which is thought to lie in alignment with the channel pore (11Choe S. Kreusch A. Pfaffinger P.J. Trends Biochem. Sci. 1999; 24: 345-349Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). Despite significant primary sequence differences between different Kv channel subfamilies, the structural scaffold of the T1 domain is common to all Kv channels (12Bixby K.A. Nanao M.H. Shen N.V. Kreusch A. Bellamy H. Pfaffinger P.J. Choe S. Nat. Struct. Biol. 1999; 6: 38-43Crossref PubMed Scopus (144) Google Scholar, 13Gulbis J.M. Zhou M. Mann S. MacKinnon R. Science. 2000; 289: 123-127Crossref PubMed Scopus (284) Google Scholar, 14Kreusch A. Pfaffinger P.J. Stevens C.F. Choe S. Nature. 1998; 392: 945-948Crossref PubMed Scopus (267) Google Scholar). Tetramerization of the T1 domains is an early step in channel biosynthesis, and crystallographic, biochemical, and electrophysiological evidence suggest that the T1 tetramer exists as a module distinct from the transmembrane channel core, adopting a "hanging gondola" structure away from the inner pore of intact Kv channels (13Gulbis J.M. Zhou M. Mann S. MacKinnon R. Science. 2000; 289: 123-127Crossref PubMed Scopus (284) Google Scholar, 15Zhou M. Morais-Cabral J.H. Mann S. MacKinnon R. Nature. 2001; 411: 657-661Crossref PubMed Scopus (493) Google Scholar, 16Lu J.L. Robinson J.M. Edwards D. Deutsch C. Biochemistry. 2001; 40: 10934-10946Crossref PubMed Scopus (70) Google Scholar, 17Sokolova O. Kolmakova-Partensky L. Grigorieff N. Structure (Lond.). 2001; 9: 215-220Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 18Kobertz W.R. Williams C. Miller C. Biochemistry. 2000; 39: 10347-10352Crossref PubMed Scopus (99) Google Scholar). The T1 domain influences numerous fundamental channel functions, including interaction of channels with Kvβ subunits (19Rehm H. Lazdunski M. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 4919-4923Crossref PubMed Scopus (171) Google Scholar, 20Rettig J. Heinemann S.H. Wunder F. Lorra C. Parcej D.N. Dolly J.O. Pongs O. Nature. 1994; 369: 289-294Crossref PubMed Scopus (743) Google Scholar, 21Sewing S. Roeper J. Pongs O. Neuron. 1996; 16: 455-463Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar, 22Pongs O. Leicher T. Berger M. Roeper J. Bähring R. Wray D. Giese K.P. Silva A.J. Storm J.F. Ann. N. Y. Acad. Sci. 1999; 868: 344-355Crossref PubMed Scopus (181) Google Scholar), interaction with many intracellular signaling molecules (23Holmes T.C. Fadool D.A. Ren R. Levitan I.B. Science. 1996; 274: 2089-2091Crossref PubMed Scopus (231) Google Scholar, 24Jing J. Chikvashvili D. Singer-Lahat D. Thornhill W.B. Reuveny E. Lotan I. EMBO J. 1999; 18: 1245-1256Crossref PubMed Google Scholar, 25Huang X.-Y. Morelli A.D. Peralta E.G. Cell. 1993; 75: 1145-1156Abstract Full Text PDF PubMed Scopus (243) Google Scholar), and prevention of heteromultimerization between different Kv channel subfamilies (14Kreusch A. Pfaffinger P.J. Stevens C.F. Choe S. Nature. 1998; 392: 945-948Crossref PubMed Scopus (267) Google Scholar, 18Kobertz W.R. Williams C. Miller C. Biochemistry. 2000; 39: 10347-10352Crossref PubMed Scopus (99) Google Scholar, 26Li M. Jan Y.N. Jan L.Y. Science. 1992; 257: 1225-1230Crossref PubMed Scopus (395) Google Scholar, 27Shen N.V. Pfaffinger P.J. Neuron. 1995; 14: 625-633Abstract Full Text PDF PubMed Scopus (159) Google Scholar, 28Xu J. Yu W.F. Jan Y.N. Jan L.Y. Li M. J. Biol. Chem. 1995; 270: 24761-24768Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). Although the interactions between the T1 domains and gating elements of intact channels have not been identified, a number of recent studies have characterized the influence of the T1 domain on channel gating. Specifically, it has been demonstrated that deletion mutations and point mutations in the T1 domain can substantially alter the voltage dependence and kinetics of activation in Shaker-related channels, suggesting conformational coupling of the T1 domain and the transmembrane segments of the channel (29Cushman S.J. Nanao M.H. Jahng A.W. DeRubeis D. Choe S. Pfaffinger P.J. Nat. Struct. Biol. 2000; 7: 403-407Crossref PubMed Scopus (92) Google Scholar, 30Kobertz W.R. Miller C. Nat. Struct. Biol. 1999; 6: 1122-1125Crossref PubMed Scopus (66) Google Scholar, 31Minor Jr., D.L. Lin Y.F. Mobley B.C. Avelar A. Jan Y.N. Jan L.Y. Berger J.M. Cell. 2000; 102: 657-670Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar). The influence of the T1 domain on channel inactivation has yet to be established. To investigate the molecular basis for the modulation of slow inactivation by the Kv1.5 NH2 terminus, we have characterized the gating properties of a series of NH2-terminal deletions of human Kv1.5, and chimeric constructs that we substituted the NH2 terminus of Kv1.5 with the NH2 terminus of other Kv1 channels. Our study demonstrates that the NH2-terminal region responsible for modulation of slow inactivation in Kv1.5 lies within the T1 domain. Furthermore, we demonstrate that fusion of the NH2 terminus of Kv2.1 to the transmembrane segments of Kv1.5 imparts a U-shaped inactivation-voltage relationship to Kv1.5, whereas the NH2terminus of Kv1.5 attenuates the U-type inactivation properties of Kv2.1. Unless otherwise stated, experiments were carried out on transiently transfected HEK 293 cells grown in minimal essential medium with 10% fetal bovine serum, at 37 °C in an air, 5% CO2 incubator. In a few experiments, mouse ltk− cells were used when expression of a construct in HEK 293 cells proved difficult. One day before transfection, cells were plated on sterile glass coverslips in 35-mm Petri dishes with 20–30% confluence. On the day of transfection, cells were washed once with minimal essential medium with 10% fetal bovine serum. To identify the transfected cells efficiently, channel DNA was co-transfected with the vector pHook-1 (Invitrogen). This plasmid encodes the production of an antibody to the hapten phOX, which was expressed and displayed on the cell surface. Channel DNA was incubated with pHook-1 (1 μg of pHook, 1–3 μg of channel DNA) and 4 μl of LipofectAMINE 2000 (Invitrogen) in 100 μl of serum-free media, then added to the dishes containing HEK 293 cells in 1 ml of minimal essential medium with 10% fetal bovine serum. Cells were allowed to grow overnight before recording. One hour prior to experiments, cells were treated with beads coated with phOX. After 15 min, excess beads were washed off with cell culture medium, and cells that had beads stuck to them were used for electrophysiological recordings. For some experiments, stable HEK 293 cell lines expressing full-length (FL) Kv1.5, Kv1.5ΔN209, or Kv2.1 were employed. These HEK 293 cells were stably transfected with FL Kv1.5, Kv1.5ΔN209, or rKv2.1 cDNAs in pcDNA3 using LipofectACE reagent (Invitrogen). Patch pipettes contained (in mm): NaCl, 5; KCl, 135; Na2ATP, 4; GTP, 0.1; MgCl2, 1; EGTA, 5; HEPES, 10; and was adjusted to pH 7.2 with KOH. The bath solution contained (in mm): NaCl, 135; KCl, 5; HEPES, 10; sodium acetate, 2.8; MgCl2, 1; CaCl2, 1; and was adjusted to pH 7.4 with NaOH. All chemicals were from Sigma. Coverslips containing cells were removed from the incubator before experiments and placed in a superfusion chamber (volume 250 μl) containing the control bath solution at ambient temperature (22–23 °C) and perfused with bathing solution throughout the experiments. Whole cell current recording and data analysis were done using an Axopatch 200A amplifier and pClamp 8 software (Axon Instruments, Foster City, CA). Patch electrodes were fabricated using thin-walled borosilicate glass (World Precision Instruments, Sarasota, FL). Electrodes had resistance of 1–3 MΩ when filled with control filling solution. Capacity compensation and 80% series resistance compensation were used in all whole cell recordings. No leak subtraction was used when recording currents, and zero current levels are denoted by the dotted lines in the current tracings in Figs. 1 C, 2, and6 D. Data were sampled at 10–20 kHz and filtered at 5–10 kHz. Membrane potentials have not been corrected for small junctional potentials between bath and pipette solutions. Throughout the text the data are presented as mean ± S.E.Figure 2Effects of extracellular K+ and TEA + on Kv1.5 and Kv1.5ΔN209 inactivation. A, HEK cells expressing Kv1.5R487T were subjected to 5.5-s depolarizations to +60 mV in the presence or absence of 10 mm TEA in the extracellular bath solution. Traces presented in the left panel were all recorded from the same cell, and have been normalized to the peak current in each recording. Mean data (n = 3) showing the amount of inactivation during 5.5-s depolarizations to +60 mV as a fraction of peak outward current in control and 10 mm extracellular TEA are shown in the right panel. B and C, HEK cells expressing FL Kv1.5 or Kv1.5ΔN209 were subjected to 6-s depolarizations to +60 mV in bath solution containing either 135 mm K+ or 5 mm K+. InB and C, sample traces collected from the same cell have been normalized to the peak outward current from each recording.View Large Image Figure ViewerDownload (PPT)Figure 6The NH2 termini of Kv1.5 and Kv2.1 exert reciprocal influences on Kv channel inactivation. A, schematic diagram of Kv1.5/Kv2.1 chimeric constructs. The amino acid sequence originating from Kv1.5 is illustrated as thin lines and colorless cylinders; the sequence originating from Kv2.1 is illustrated asshaded cylinders and thick lines. Channels were constructed by switching the NH2 terminus up to residue Pro243 in Kv1.5 with NH2-terminal residues up to Pro180 from Kv2.1, and vice versa. B, sequence alignment of the NH2 termini of Kv1.5 and Kv2.1 was performed using the web-based LALIGN sequence alignment tool (37Person W.R. Wood T. Zhang Z. Miller W. Genomics. 1997; 46: 24-36Crossref PubMed Scopus (479) Google Scholar), and demonstrates a segment of the Kv2.1 NH2 terminus exhibiting 36.8% identity with the T1 domain of Kv1.5.C, activation curves were constructed as described in the legend to Fig. 1, yielding activation V 12values of −25.5 ± 1.1 and −9.3 ± 3.3 mV for Kv2.1N/Kv1.5 and Kv1.5N/Kv2.1, respectively. D, the Kv1.5 NH2 terminus decelerates inactivation in Kv2.1. Sample data represent currents elicited from Kv2.1, Kv1.5N/Kv2.1, Kv2.1ΔN101, and T19+163/Kv2.1 expressed in mouse ltk− cells during 5-s pulses to +60 mV. E, inactivation-voltage relationships were derived as described in the legend to Fig. 1, yielding inactivation V 12 values of −30.6 ± 0.5 mV in Kv2.1N/Kv1.5 and −12.1 ± 3.3 mV in Kv1.5N/Kv2.1.View Large Image Figure ViewerDownload (PPT) The mammalian expression vector pcDNA3 was used for expression of all channel constructs used in this study. All primers used were synthesized by Sigma-Genosys (Oakville, Ontario, Canada). All constructs were sequenced to check for sequence errors, and to ensure the correct reading frame. The Kv1.5ΔN19, Kv1.5ΔN91, and Kv1.5ΔN162 mutants were generated by Bal31 exonuclease digestion from the 5′ end of hKv1.5. Resulting fragments were ultimately subcloned into a pcDNA3 vector cut with NcoI (which was blunted to introduce a start codon) and XbaI restriction enzymes. The Kv1.5ΔN119 and Kv1.5ΔN140 mutants were generated by PCR amplification of the cDNA encoding residues 120 or 141 to the COOH terminus of hKv1.5. The 5′ primers used were 5′-CCCAAGCTTATGCAGCGCGTCCACATCAACATC-3′ for Kv1.5ΔN119, and 5′-CCCAAGCTTATGGGCACCCTGGCGCAGTTTCC-3′ for Kv1.5ΔN140 (introduced restriction sites are underlined). The resulting channels were ultimately subcloned in a pcDNA3 vector usingHindIII and NotI restriction sites. The Kv1.5ΔN188 mutant was generated by removal of theNcoI-HincII fragment of Kv1.5. Kv1.5ΔN209 was generated by removal of the NcoI-NcoI fragment of Kv1.5. Kv2.1ΔN101 was generated by removal of sequence up to theNarI restriction site in rKv2.1. For preparation of the Kv1.1N/Kv1.5 and Kv1.3N/Kv1.5 chimeric channels, DNA encoding the Kv1.5 channel core beginning at the NcoI site encoding residue Met210 was subcloned into homologousNcoI sites in pGBT9 vectors encoding the NH2termini of Kv1.1 and Kv1.3 using NcoI and XbaI restriction sites. The resulting fusion protein was then subcloned into pcDNA3 for mammalian expression as anEcoRI/EcoRI fragment, followed by screening for correct orientation of the insert. For preparation of Kv1.5N/Kv2.1 T19+163/Kv2.1, DNA encoding amino acids 180 to the COOH terminus of rKv2.1 were amplified by PCR, such that aBspEI restriction site at Pro180 of rKv2.1, and a XbaI site following the termination codon were introduced. The primers used were: 5′-ATCGTCCGGAGTCGTCGGTGGCCGCCAAG-3′ for the 5′ end, and 5′-GCTCTAGACCCTCTGTGGTAGGGAGC-3′ for the 3′ end (introduced restriction sites are underlined). The resulting fragment was used to replace the analogous region of Kv1.5 encoding amino acids 243 to the COOH terminus of Kv1.5, in a pcDNA3 vector encoding Kv1.5 or Kv1.5T19+163 using BspE1 andXbaI restriction sites. For preparation of Kv2.1N/Kv1.5, the NH2 terminus of rKv2.1 was amplified by PCR, introducing a EcoRI restriction site preceding the start codon, and a BspEI restriction site at 180 of rKv2.1. The primers employed were 5′-CGGAATTCGGCATGACGAAGCATGGC-3′ as the 5′ primer and 5′-GCTGTCCGGATACTCCAGCAGATCCCAGAG-3′ as the 3′ primer (introduced restriction sites are underlined). The resulting fragment was used to replace the analogous Kv1.5 sequence encoding amino acids of the Kv1.5 NH2 terminus up to residue 243, by subcloning into a pcDNA3 vector encoding Kv1.5 using HindIII andBspEI restriction sites. Site-directed mutagenesis of Kv1.5 was performed using the QuikChange method from Stratagene. For preparation of the Kv1.5AAQL mutant, the primers used were GGGCTGCGCTTTGCGGCGGCAGCTGGGCACCCTG and its complement. In intact channels, the T1 domain is thought to be structurally dissociated from the transmembrane segments of the channel, forming a hanging gondola (shown schematically in Fig.1 A). Interestingly, however, disruptions of the NH2 termini of Kv channels can significantly affect the gating properties of the channel. A good example of this phenomenon is Kv1.5ΔN209, the naturally occurring short form of Kv1.5 comprising a deletion of greater than 80% of the cytosolic NH2 terminus of Kv1.5, which exhibits activation and inactivation properties substantially different from the long-form of Kv1.5 (FL Kv1.5) (8Kurata H.T. Soon G.S. Fedida D. J. Gen. Physiol. 2001; 118: 315-332Crossref PubMed Scopus (31) Google Scholar). Throughout this study, we examined the voltage-dependent activation of Kv channels using the double pulse protocol described in Fig. 1 B. Cells were stepped from a holding potential of −80 mV to potentials between −65 mV and +50 mV in 5-mV steps for 200 ms (P1, Fig.1 B), followed by a brief repolarization to −40 mV (P2, Fig. 1 B). The magnitude of the tail currents observed at −40 mV was proportional to the number of channels activated during P1 (Fig. 1 B). Inactivation-voltage relationships were derived using the triple-pulse protocol described in the legend to Fig. 1 C. From a holding potential of −80 mV, cells were given a 100-ms control pulse to 60 mV (P1, Fig.1 C), rested for 2 s at −80 mV, then stepped from voltages between −70 and +60 mV in 10-mV steps for 5 s (P2, Fig. 1 C), followed by a brief test pulse to +60 mV (P3, Fig. 1 C). The current during the P1 pulse serves to control for any rundown of peak current during experiments. The measured amplitude of the test pulse current in P3 is proportional to the number of available (non-inactivated) channels following P2 (Fig. 1 C). FL Kv1.5 channels stably expressed in HEK 293 cells exhibited a half-activation potential of −10.8 ± 0.8 mV (Fig. 1 D), and a half-inactivation potential of −21.0 ± 1.2 mV (Fig. 1 E), which was consistent with previous studies from our laboratory and others (8Kurata H.T. Soon G.S. Fedida D. J. Gen. Physiol. 2001; 118: 315-332Crossref PubMed Scopus (31) Google Scholar, 32Fedida D. Maruoka N.D. Lin S. J. Physiol. (Camb.). 1999; 515: 315-329Crossref PubMed Scopus (59) Google Scholar). In the current study, we were particularly interested in the shape of the inactivation-voltage relationship, with FL Kv1.5 exhibiting a flat voltage dependence of inactivation at positive potentials (Fig.1 E). The activation and inactivation properties of Kv1.5ΔN209 differ substantially from those observed in FL Kv1.5. When stably expressed in HEK 293 cells, Kv1.5ΔN209 exhibited a half-activation potential of −20.3 ± 1.7 mV, which was shifted left-ward by 8 mV relative to the FL Kv1.5 channel (Fig. 1 D). The half-inactivation potential in Kv1.5ΔN209 was −32.8 ± 0.9 mV, which was shifted left-ward by roughly 12 mV relative to FL Kv1.5 (Fig. 1 E). In addition, deletion of the Kv1.5 NH2 terminus appeared to uncover additional pathways for inactivation, as Kv1.5ΔN209 inactivated more completely than FL Kv1.5 over the range of potentials examined. Most importantly, Kv1.5ΔN209 exhibited a U-shaped voltage dependence of inactivation, in which inactivation was maximal at intermediate depolarizations between −20 and 0 mV and significantly less pronounced with more positive depolarizations (Fig.1 E). This shape of the inactivation-voltage relationship contrasts sharply with the flat voltage dependence of inactivation observed in FL Kv1.5, and more closely resembles the U-type inactivation properties of a channel such as Kv2.1 (Fig.1 E). Kv2.1 expressed stably in HEK 293 cells exhibited a half-activation potential of −2.8 ± 1.7 mV (Fig. 1 D) and a half-inactivation potential of −26.3 ± 0.7 mV (Fig.1 E), and again was clearly distinguished from typical C-type inactivation by a marked upturn of its inactivation-voltage relationship. These observations clearly distinguish inactivation in FL Kv1.5 from the U-type inactivation phenotype of Kv1.5ΔN209 and Kv2.1, and suggest that the NH2 terminus of Kv1.5 may influence the inactivation properties of the channel. The shape of the inactivation-voltage relationship in Kv1.5 was consistent with a C-type inactivation mechanism, generally viewed as a voltage-independent inactivation process that is coupled to channel opening (33Olcese R. Latorre R. Toro L. Bezanilla F. Stefani E. J. Gen. Physiol. 1997; 110: 579-589Crossref PubMed Scopus (154) Google Scholar). This observation was also consistent with previous studies of Kv1.5 and other Kv1 channels (32Fedida D. Maruoka N.D. Lin S. J. Physiol. (Camb.). 1999; 515: 315-329Crossref PubMed Scopus (59) Google Scholar, 34Zerr P. Adelman J.P. Maylie J. FEBS Lett. 1998; 431: 461-464Crossref PubMed Scopus (40) Google Scholar, 35Chung I. Schlichter L.C. Am. J. Physiol. 1997; 273: C622-C633Crossref PubMed Google Scholar). Kv1.5 exhibits a number of other features consistent with a C-type inactivation mechanism. First, although residue Arg487 (corresponding to Thr449 in Shaker) renders wild-type Kv1.5 insensitive to extracellular TEA, inactivation in the R487T mutant of Kv1.5 was inhibited by TEA (Fig.2 A). The application of extracellular TEA diminished the peak currents observed through Kv1.5 R487T channels, with 10 mm extracellular TEA resulting in a 51 ± 2% (n = 3) block of peak current. Normalized data demonstrating the effect of 10 mmextracellular TEA on the inactivation time course of Kv1.5R487T are shown in Fig. 2 A. Currents through the R487T mutant channel inactivate by 38 ± 2% during 5-s depolarizations to 60 mV under control conditions, but inactivate by only 25 ± 3% in the presence of 10 mm extracellular TEA. To confirm a C-type mechanism of inactivation in Kv1.5, and to contrast the inactivation mechanisms in Kv1.5 and Kv1.5ΔN209, we also examined the effects of elevation of extracellular K+ on inactivation in both channels. Clearly, elevation of extracellular K+ results in deceleration of Kv1.5 inactivation (Fig. 2 B), which suggests a C-type mechanism of inactivation in FL Kv1.5, and was consistent with previous studies on Kv1.5 and other Shaker homologues (32Fedida D. Maruoka N.D. Lin S. J. Physiol. (Camb.). 1999; 515: 315-329Crossref PubMed Scopus (59) Google Scholar,36Levy D.I. Deutsch C. Biophys. J. 1996; 70: 798-805Abstract Full Text PDF PubMed Scopus (108) Google Scholar). In contrast, Kv1.5ΔN209 exhibits an opposite sensitivity to extracellular K+ (Fig. 2 C), with more rapid inactivation observed in 135 mm extracellular K+. This paradoxical sensitivity of inactivation to extracellular K+ appears to be a common feature of channels which exhibit a U-shaped inactivation-voltage relationship (5Klemic K.G. Kirsch G.E. Jones S.W. Biophys. J. 2001; 81: 814-826Abstract Full Text Full Text PDF PubMed Scopus (64) Google Scholar). To confirm and extend these findings, we attempted to define the NH2-terminal region involved in altering the inactivation phenotype of Kv1.5. We began by constructing a series of NH2-terminal truncated forms of Kv1.5 (Fig.3 A). These were transiently expressed in HEK 293 cells, and their activation and inactivation properties were examined. The activation and inactivation curves of FL Kv1.5 and Kv1.5ΔN209 have been included for comparison. We examined three constructs comprising progressive deletions of the Kv1.5 NH2-terminal residues up to the T1 boundary (Kv1.5ΔN19, Kv1.5ΔN91, and Kv1.5ΔN119, see Fig. 3 A). None of these deletion constructs exhibited any remarkable differences in activation or inactivation gating from FL Kv1.5, although the half-inactivation voltages were slightly right-shifted in these 3 constructs relative to FL Kv1.5 (Fig. 3, B and D). In addition, only very slight differences were observed in the level of inactivation resulting from 5-s inact
Referência(s)