The Orphan Nuclear Receptor, RORα, Regulates Gene Expression That Controls Lipid Metabolism
2008; Elsevier BV; Volume: 283; Issue: 26 Linguagem: Inglês
10.1074/jbc.m710526200
ISSN1083-351X
AutoresPatrick Lau, Rebecca L. Fitzsimmons, Suryaprakash Raichur, Shu-Ching Wang, Adriane Lechtken, George E.O. Muscat,
Tópico(s)Retinoids in leukemia and cellular processes
ResumoHomozygous staggerer mice (sg/sg) display decreased and dysfunctional retinoic acid receptor-related orphan receptor α (RORα) expression. We observed decreases in serum (and liver) triglycerides and total and high density lipoprotein serum cholesterol in sg/sg mice. Moreover, the sg/sg mice were characterized by reduced adiposity (associated with decreased fat pad mass and adipocyte size). Candidate-based expression profiling demonstrated that the dyslipidemia in sg/sg mice is associated with decreased hepatic expression of SREBP-1c, and the reverse cholesterol transporters, ABCA1 and ABCG1. This is consistent with the reduced serum lipids. The molecular mechanism did not involve aberrant expression of LXR and/or ChREBP. However, ChIP and transfection analyses revealed that RORα is recruited to and regulates the activity of the SREBP-1c promoter. Furthermore, the lean phenotype in sg/sg mice is also characterized by significantly increased expression of PGC-1α, PGC-1β, and lipin1 mRNA in liver and white and brown adipose tissue from sg/sg mice. In addition, we observed a significant 4-fold increase in β2-adrenergic receptor mRNA in brown adipose tissue. Finally, dysfunctional RORα expression protects against diet-induced obesity. Following a 10-week high fat diet, wild-type but not sg/sg mice exhibited a ∼20% weight gain, increased hepatic triglycerides, and notable white and brown adipose tissue accumulation. In summary, these changes in gene expression (that modulate lipid homeostasis) in metabolic tissues are involved in decreased adiposity and resistance to diet-induced obesity in the sg/sg mice, despite hyperphagia. In conclusion, we suggest this orphan nuclear receptor is a key modulator of fat accumulation and that selective ROR modulators may have utility in the treatment of obesity. Homozygous staggerer mice (sg/sg) display decreased and dysfunctional retinoic acid receptor-related orphan receptor α (RORα) expression. We observed decreases in serum (and liver) triglycerides and total and high density lipoprotein serum cholesterol in sg/sg mice. Moreover, the sg/sg mice were characterized by reduced adiposity (associated with decreased fat pad mass and adipocyte size). Candidate-based expression profiling demonstrated that the dyslipidemia in sg/sg mice is associated with decreased hepatic expression of SREBP-1c, and the reverse cholesterol transporters, ABCA1 and ABCG1. This is consistent with the reduced serum lipids. The molecular mechanism did not involve aberrant expression of LXR and/or ChREBP. However, ChIP and transfection analyses revealed that RORα is recruited to and regulates the activity of the SREBP-1c promoter. Furthermore, the lean phenotype in sg/sg mice is also characterized by significantly increased expression of PGC-1α, PGC-1β, and lipin1 mRNA in liver and white and brown adipose tissue from sg/sg mice. In addition, we observed a significant 4-fold increase in β2-adrenergic receptor mRNA in brown adipose tissue. Finally, dysfunctional RORα expression protects against diet-induced obesity. Following a 10-week high fat diet, wild-type but not sg/sg mice exhibited a ∼20% weight gain, increased hepatic triglycerides, and notable white and brown adipose tissue accumulation. In summary, these changes in gene expression (that modulate lipid homeostasis) in metabolic tissues are involved in decreased adiposity and resistance to diet-induced obesity in the sg/sg mice, despite hyperphagia. In conclusion, we suggest this orphan nuclear receptor is a key modulator of fat accumulation and that selective ROR modulators may have utility in the treatment of obesity. The spontaneously arising mouse mutant, staggerer (sg), 4The abbreviations used are: sg, staggerer; RORα, retinoic acid receptor-related orphan receptor α; HDL, high density lipoprotein; HDL-c, HCL-cholesterol; ABCA1, ATP-binding cassette, subfamily A, member 1; ABCG1, ATP-binding cassette, subfamily G, member 1; SREBP-1c, sterol regulatory element-binding transcription factor 1, isoform c; FAS, fatty acid synthase; ChIP, chromatin immunoprecipitation; PGC-1β, peroxisome proliferator-activated receptor-γ, coactivator 1β; wt, wild type; ChREBP, carbohydrate response element-binding protein; LXR, liver X receptor; NR, nuclear receptor; NR4A, nuclear receptor subfamily 4, group A; LPL, lipoprotein lipase; ATGL, adipose triglyceride lipase; LUC, luciferase. was initially described and analyzed several decades ago (1Sidman R.L. Lane P.W. Dickie M.M. Science. 1962; 137: 610-612Crossref PubMed Scopus (311) Google Scholar). The homozygous mice display ataxia, cerebellar defects, tremor, and imbalance. Subsequently, the gene encoding retinoic acid receptor-related orphan receptor α (RORα) (2Becker-Andre M. Andre E. DeLamarter J.F. Biochem. Biophys. Res. Commun. 1993; 194: 1371-1379Crossref PubMed Scopus (232) Google Scholar, 3Giguere V. Tini M. Flock G. Ong E. Evans R.M. Otulakowski G. Genes Dev. 1994; 8: 538-553Crossref PubMed Scopus (452) Google Scholar) was mapped to mouse chromosome 9 in the immediacy of the sg locus (4Hamilton B.A. Frankel W.N. Kerrebrock A.W. Hawkins T.L. FitzHugh W. Kusumi K. Russell L.B. Mueller K.L. van Berkel V. Birren B.W. Kruglyak L. Lander E.S. Nature. 1996; 379: 736-739Crossref PubMed Scopus (433) Google Scholar, 5Matysiak-Scholze U. Nehls M. Genomics. 1997; 43: 78-84Crossref PubMed Scopus (65) Google Scholar). RORα is an orphan member of the nuclear receptor superfamily (6Nuclear Receptor Nomenclature CommitteeCell. 1999; 97: 161-163Abstract Full Text Full Text PDF PubMed Scopus (951) Google Scholar). Several studies have identified cholesterol sulfate (and derivatives) as potential ligands for this nuclear receptor (7Kallen J. Schlaeppi J.M. Bitsch F. Delhon I. Fournier B. J. Biol. Chem. 2004; 279: 14033-14038Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar, 8Kallen J.A. Schlaeppi J.M. Bitsch F. Geisse S. Geiser M. Delhon I. Fournier B. Structure. 2002; 10: 1697-1707Abstract Full Text Full Text PDF PubMed Scopus (248) Google Scholar), however, further studies are required to resolve this issue. The sg mutation has been shown to be an intragenic deletion in the coding region of RORα, removing an exon downstream of the DNA binding domain (4Hamilton B.A. Frankel W.N. Kerrebrock A.W. Hawkins T.L. FitzHugh W. Kusumi K. Russell L.B. Mueller K.L. van Berkel V. Birren B.W. Kruglyak L. Lander E.S. Nature. 1996; 379: 736-739Crossref PubMed Scopus (433) Google Scholar, 5Matysiak-Scholze U. Nehls M. Genomics. 1997; 43: 78-84Crossref PubMed Scopus (65) Google Scholar). This results in a frameshift mutation that affects the co-expressed isoforms RORα1 and -α4 (5Matysiak-Scholze U. Nehls M. Genomics. 1997; 43: 78-84Crossref PubMed Scopus (65) Google Scholar). RORα transcript levels are significantly reduced in staggerer (sg/sg) mice, and it has been clearly demonstrated that the sg phenotype is associated with the expression of dysfunctional RORα (9Dussault I. Fawcett D. Matthyssen A. Bader J.A. Giguere V. Mech. Dev. 1998; 70: 147-153Crossref PubMed Scopus (156) Google Scholar). Moreover, RORα-deficient mice display many aspects of the staggerer phenotype (9Dussault I. Fawcett D. Matthyssen A. Bader J.A. Giguere V. Mech. Dev. 1998; 70: 147-153Crossref PubMed Scopus (156) Google Scholar, 10Steinmayr M. Andre E. Conquet F. Rondi-Reig L. Delhaye-Bouchaud N. Auclair N. Daniel H. Crepel F. Mariani J. Sotelo C. Becker-Andre M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 3960-3965Crossref PubMed Scopus (245) Google Scholar). Mamontova et al. (11Mamontova A. Seguret-Mace S. Esposito B. Chaniale C. Bouly M. Delhaye-Bouchaud N. Luc G. Staels B. Duverger N. Mariani J. Tedgui A. Circulation. 1998; 98: 2738-2743Crossref PubMed Scopus (153) Google Scholar) demonstrated that male and female homozygous staggerer (sg/sg) are characterized by hypo-α-lipoproteinemia and decreased serum cholesterol (total and high density lipoprotein (HDL)) consequent to reduced apolipoprotein A-I (apoA1) expression in the intestine, but not in liver. Previously, Vu Dac et al. (12Vu-Dac N. Gervois P. Grotzinger T. De Vos P. Schoonjans K. Fruchart J.C. Auwerx J. Mariani J. Tedgui A. Staels B. J. Biol. Chem. 1997; 272: 22401-22404Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar) established that apoA1 is directly regulated by RORα1-mediated trans-activation. Moreover, sg/sg mice are susceptible to atherosclerosis on an atherogenic diet (11Mamontova A. Seguret-Mace S. Esposito B. Chaniale C. Bouly M. Delhaye-Bouchaud N. Luc G. Staels B. Duverger N. Mariani J. Tedgui A. Circulation. 1998; 98: 2738-2743Crossref PubMed Scopus (153) Google Scholar). These studies indicated that RORα is involved in the regulation of lipoprotein homeostasis in mice. Subsequently, Raspe et al. (13Raspe E. Duez H. Gervois P. Fievet C. Fruchart J.C. Besnard S. Mariani J. Tedgui A. Staels B. J. Biol. Chem. 2001; 276: 2865-2871Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar), showed that female sg/sg mice have reduced plasma triglycerides, coupled to concordant decreases in apolipoprotein C-III (apoCIII) mRNA expression in liver and (proximal and distal) intestine. In this context a study from our laboratory, using an in vitro skeletal muscle cell culture model, demonstrated that overexpression of RORα1 (lacking the ligand binding domain) results in reduced sterol regulatory element-binding transcription factor 1, isoform c (SREBP-1c) mRNA expression (14Lau P. Nixon S.J. Parton R.G. Muscat G.E. J. Biol. Chem. 2004; 279: 36828-36840Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). These studies have underscored the pertinent role of RORα in lipid homeostasis. RORα is abundantly expressed in the liver and the other major mass peripheral metabolic tissues. Moreover, sg/sg mice consume an increased amount of food (per gram bodyweight), but, despite this feeding pattern, they maintain a lower weight (15Bertin R. Guastavino J.M. Portet R. Physiol. Behav. 1990; 47: 377-380Crossref PubMed Scopus (13) Google Scholar, 16Guastavino J.M. Bertin R. Portet R. Physiol. Behav. 1991; 49: 405-409Crossref PubMed Scopus (14) Google Scholar). Surprisingly, no studies have investigated this aspect of the staggerer phenotype. Hence, we were particularly interested in elucidating the functional role of RORα in the control of genes that regulate lipogenesis and fatty acid oxidation in liver, skeletal muscle, and white adipose tissues in homozygous sg/sg mice. We hypothesized, based on our in vitro studies, that SREBP-1c may be a critical component in the metabolic phenotype of sg/sg mice. We observed that sg/sg mice displayed an early onset decrease in weight that was maintained after maturity and associated with decreased adiposity. The mice (expressing dysfunctional RORα) displayed reduced serum and hepatic lipids, consistent with decreased ATP-binding cassette, subfamily A, member 1 (ABCA1), ATP-binding cassette, subfamily G, member 1 (ABCG1), SREBP-1c, and fatty acid synthase (FAS) mRNA expression in the liver. ChIP and transfection analyses showed that RORα mediated trans-activation of the SREBP-1c promoter. Candidate-based expression profiling in sg/sg mice demonstrated increased expression of peroxisome proliferator-activated receptor-γ, coactivator 1 (PGC-1α/β) and lipin1 gene expression in liver and white and brown adipose tissue. These genes increase fatty acid utilization and oxidative metabolism. Interestingly, the sg/sg mice did not accumulate fat and were resistant to diet-induced obesity, despite hyperphagia. In summary, our study suggests RORα is an important factor in the regulation of genes associated with lipid homeostasis and adiposity. Animals and Tissue Collection—Heterozygous +/sg mice, B6.C3(Cg)-Rorasg/J, were obtained from Jackson laboratory (Bar Harbor, ME), and the colony was maintained by backcrossing to C57BL/6J. Identification was carried out by PCR genotyping as described by Jackson laboratory. The mice were housed in Queensland Bioscience Precinct vivarium (University of Queensland, St. Lucia, Queensland, Australia) with a 12-h light-dark cycle and fed a standard diet containing 4.6% total fat or a high fat diet (SF01-028) containing 22.6% fat (both from Specialty Feeds, Glen Forrest, Western Australia). Homozygous sg/sg mice and their wild-type (wt) littermates were obtained by crossing heterozygous male and female breeders. The mice were weaned at 4 weeks of age but were fed with moist mash standard diet ad libitum as described by Guastavino (17Guastavino J.M. C. R. Acad. Sci. Hebd. Seances Acad. Sci. D. 1978; 286: 137-139PubMed Google Scholar) in the final week prior to weaning and thereafter postweaning. High fat fed animals were similarly provided with moist, mashed pellets and diluted, food grade strawberry flavoring to improve palatability. Access to water was facilitated by adding dishes of water and hanging gel packs (Able Scientific, Welshpool, Western Australia) in each cage. Experimental animals were weighed weekly. Mice were fasted for 6 h by transferring to a new food-free holding cage with unrestricted access to water. Blood collection was performed by terminal cardiac puncture, under isoflurane anesthesia. Otherwise animals were euthanized by cervical dislocation at 14 weeks of age. Tissues collected for RNA extraction were immediately frozen in liquid nitrogen and then stored at -80 °C. For histological examination, tissues were fixed in 10% buffered formalin (Sigma-Aldrich), paraffin-embedded, and sections were stained with hematoxylin and eosin. All aspects of animal experimentation were approved by The University of Queensland Animal Ethics Committee. RNA Extraction and cDNA Synthesis—Total RNA extraction and cDNA synthesis were performed as previously described, with minor modifications. Following homogenization with a handheld ultra-turrax homogenizer (IKA, Staufen, Germany), total RNA from liver and quadriceps muscles was extracted using TRI reagent (Sigma-Aldrich) and an RNeasy mini kit (Qiagen) according to the manufacturers' protocol. For epididymal adipose tissue and brown adipose tissue, RNA was extracted with Qiazol and an RNeasy mini kit (Qiagen). Reverse transcription was performed as previously described, using 1 μg of total RNA in each cDNA synthesis reaction (14Lau P. Nixon S.J. Parton R.G. Muscat G.E. J. Biol. Chem. 2004; 279: 36828-36840Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). Primers and Quantitative PCR—Relative expression of genes was determined using the ABI 7500 Real-Time PCR System (ABI, Singapore) as previously described (14Lau P. Nixon S.J. Parton R.G. Muscat G.E. J. Biol. Chem. 2004; 279: 36828-36840Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). Primers for 18S, total mRORα, ABCA1, ABCA8/G1, FAS, LPL, NOR1, NUR77, SREBP-1c, UCP2, MCAD, and CPT1b also have been reported (14Lau P. Nixon S.J. Parton R.G. Muscat G.E. J. Biol. Chem. 2004; 279: 36828-36840Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar, 18Pearen M.A. Ryall J.G. Maxwell M.A. Ohkura N. Lynch G.S. Muscat G.E. Endocrinology. 2006; 147: 5217-5227Crossref PubMed Scopus (101) Google Scholar, 19Maxwell M.A. Muscat G.E. Nucl. Recept. Signal. 2006; 4: e002Crossref PubMed Google Scholar). ADRB1 (Mm00431701_s1), ADRB2 (Mm02524224_s1), ADRB3 (Mm00442669_m1), ATGL (Mm00503040_m1), HSL (Mm00495359_m1), LIPC (Mm00433975_m1), Lipin1 (Mm00550511_m1), GcK (Mm00439129_m1), Nurr1 (Mm00443060_m1), CPT1a (Mm00550438_m1), PGC-1α (Mm00447183_m1), and PGC-1β (Mm00504720_m1) TaqMan Gene Expression Assays were obtained from Applied Biosystems (Foster City, CA). Mus musculus primer sequences (forward and reverse, respectively) used for SYBR assays are as follows: mRORα1, GCGCAGGCAGAGCTATGC and CACGTAATGACACCATAATGGATTC; mRORα4, GCGGCGTAAAGGATGTATTTTG and CCACAGATCTTGCATGGAATAATT; ChREBP, GGACAAGATCCGGCTGAAG and GGCTTCTCGTCCGTTGCA; LXRα, GAAATGCCAGGAGTGTCGAC and GATCTGTTCTTCTGACAGCACACA; LXRβ, TGCAACAAACGATCTTTCTCC and TCTCGGGACTGAGGGTCTG; UCP1, ACAGAAGGATTGCCGAAAC and AGCTGATTTGCCTCTGAATG; UCP3, CTCCCCTAGGCAGGTACCG and CAGAAAGGAGGGCACAAATCC; and leptin, TTCAAGCAGTGCCTATCCAGAA and GGATACCGACTGCGTGTGTG. Primers were obtained from Geneworks (Thebarton, South Australia). Chromatin Immunoprecipitation—Mouse myogenic C2C12 cells were differentiated into post-mitotic multinucleated myotubes by incubation for 5 days in Dulbecco's modified Eagle's medium (supplemented with 2% horse serum). Subsequently, cells were washed twice in ice-cold phosphate-buffered saline and cross-linked in 1% formaldehyde solution. Chromatin immunoprecipitation was performed as described by Li et al. (20Li X. Wong J. Tsai S.Y. Tsai M.J. O'Malley B.W. Mol. Cell. Biol. 2003; 23: 3763-3773Crossref PubMed Scopus (204) Google Scholar) using anti-RORα antibody (sc-6062, Santa Cruz Biotechnology, Santa Cruz, CA). The following SREBP1c quantitative PCR ChIP primers were used: NR1, CTCAGATGTCAGAAGGAGCAGAGTAG and GTTCTGTCCAGCCTGCAAGTG; NR2, CCCCCTCCTTGAAACAAGTGT and GCAGCAAGATTTGCCTACAGTCT; and glyceraldehyde-3-phosphate dehydrogenase, GCTCACTGGCATGGCCTTCCG and GTAGGCCATGAGGTCCACCAC. Transient Transfections—Each well of a 24-well plate of COS-1 or C2C12 cells was transfected with a total of 0.6-0.8 μg of DNA per well using the liposome-mediated transfection procedure. Cells were cotransfected with pGL3-SREBP1c luciferase gene reporter (21Muscat G.E. Wagner B.L. Hou J. Tangirala R.K. Bischoff E.D. Rohde P. Petrowski M. Li J. Shao G. Macondray G. Schulman I.G. J. Biol. Chem. 2002; 277: 40722-40728Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar) and either pSG5-RORα1 (22Lau P. Bailey P. Dowhan D.H. Muscat G.E. Nucleic Acids Res. 1999; 27: 411-420Crossref PubMed Scopus (82) Google Scholar), pSG5-RORα4 (2Becker-Andre M. Andre E. DeLamarter J.F. Biochem. Biophys. Res. Commun. 1993; 194: 1371-1379Crossref PubMed Scopus (232) Google Scholar), or empty vector using an N-[1-(2,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate and Metafectene (Biontex Laboratories GmbH, Munich, Germany) liposome mixture as described previously (14Lau P. Nixon S.J. Parton R.G. Muscat G.E. J. Biol. Chem. 2004; 279: 36828-36840Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). The -fold activation is expressed relative to LUC activity obtained after cotransfection of the empty reporter and pSG5 vector only, arbitrarily set at 1. The mean -fold activation values and standard error were derived from three independent experiments of triplicate wells. Blood and Tissue Analysis—High density lipoprotein cholesterol from whole blood was measured using the Cholestech LDX System (Hayward, CA). Measurements of total cholesterol, triglyceride, and non-esterified fatty acid in heparinized plasma samples were analyzed by Clinical Pathology Laboratory, School of Veterinary Science, The University of Queensland (St. Lucia, Queensland, Australia). To obtain hepatic triglyceride measurements, liver tissue was saponified by digestion with ethanolic KOH, neutralized, and then assayed using Free Glycerol Reagent (Sigma-Aldrich). Statistical Analysis—Data were analyzed (and significance assigned) using the ratio t test in the GraphPad Prism 4 software, unless otherwise indicated. RORα1 and -4 mRNA Expression Is Substantially Attenuated in the Metabolic Tissues from sg/sg Mice—As discussed, a number of studies have implicated RORα in the regulation of lipid homeostasis. We were particularly interested in exploring this further and examining the effect of functional RORα deficiency on the regulation of critical genes involved in anabolic and catabolic lipid metabolism in the major mass metabolic tissues in sg/sg mice. Initially, we investigated RORα1 and -α4 mRNA expression in the skeletal muscle, liver, and white adipose tissue of homozygous sg/sg mice. We demonstrated expression of the mRNAs encoding RORα1 and -α4 was significantly attenuated in the muscle, liver, and adipose tissues of homozygous sg/sg mice (Fig. 1, A and B). This is concordant with previously reported analysis of RORα expression in the cerebellum, liver, and intestine of sg/sg mice (5Matysiak-Scholze U. Nehls M. Genomics. 1997; 43: 78-84Crossref PubMed Scopus (65) Google Scholar, 12Vu-Dac N. Gervois P. Grotzinger T. De Vos P. Schoonjans K. Fruchart J.C. Auwerx J. Mariani J. Tedgui A. Staels B. J. Biol. Chem. 1997; 272: 22401-22404Abstract Full Text Full Text PDF PubMed Scopus (118) Google Scholar, 23Chauvet C. Bois-Joyeux B. Danan J.L. Biochem. J. 2002; 364: 449-456Crossref PubMed Scopus (43) Google Scholar). Staggerer (sg/sg) Mice Display an Early Onset (∼20%) Decrease in Weight That Is Maintained after Maturity and Revealed Reduced Adiposity—Interestingly, as discussed in a very recent report (24Qiu C.H. Shimokawa N. Iwasaki T. Parhar I.S. Koibuchi N. Endocrinology. 2007; 148: 1745-1753Crossref PubMed Scopus (26) Google Scholar), no detailed data (over many weeks) on the specific changes in body weight in sg/sg mice have been reported (relative to wild-type littermates), despite hyperphagia on a regular chow diet (16Guastavino J.M. Bertin R. Portet R. Physiol. Behav. 1991; 49: 405-409Crossref PubMed Scopus (14) Google Scholar). Crucially, our mice were fed a “pasty mix” of crushed food moistened with water and placed on the floor of the cage. Water is supplied in a small dish, and accessible gel packs are provided in each cage. This circumvents any issues associated with access to food due to stretching difficulties in sg/sg mice that effects mortality (17Guastavino J.M. C. R. Acad. Sci. Hebd. Seances Acad. Sci. D. 1978; 286: 137-139PubMed Google Scholar). Subsequently, we ascertained the growth pattern of male sg/sg mice from age 4 weeks to maturity at 14 weeks on a normal chow diet. At weaning, the sg/sg mice are ∼50% smaller than their wt counterparts. As they mature the size difference lessens, and by adulthood male sg/sg mice maintain a body mass that is ∼15-20% decreased relative to wt mice (Figs. 2, A and B). The sg/sg mice displayed reduced adiposity (Fig. 2C). Interestingly, the size of the epididymal white adipose depots (corrected for total body weight) were markedly and significantly decreased in sg/sg mice (Fig. 2D). This correlated with a substantial reduction in adipocyte cell size (Fig. 2E). No significant differences were observed in the heart, quadriceps, and gastrocnemius skeletal muscle tissues, however, a small, but significant decrease in liver weight was observed (Fig. 2D). Decreased Plasma Cholesterol Is Associated with Decreased Expression of mRNAs Encoding the Reverse Cholesterol Transporters ABCA and ABCA8/G1 in the Liver—Mamontova et al. (11Mamontova A. Seguret-Mace S. Esposito B. Chaniale C. Bouly M. Delhaye-Bouchaud N. Luc G. Staels B. Duverger N. Mariani J. Tedgui A. Circulation. 1998; 98: 2738-2743Crossref PubMed Scopus (153) Google Scholar) previously reported decreased serum cholesterol in sg/sg mice that is associated with decreased apoA1 expression in the intestine (not the liver). We similarly observed plasma (total and HDL) cholesterol were decreased in the serum of sg/sg mice on a normal chow diet (Fig. 3, A and B). We utilized candidate-based expression profiling of the liver, and examined several additional genes (and pathways) that could potentially account for reduced plasma cholesterol. We identified significantly reduced expression of the mRNAs encoding the reverse cholesterol transporters, ABCA1, and ABCA8/G1 in the liver of sg/sg mice (Fig. 3, C and D). Many studies have reported the link between impaired hepatic reverse cholesterol transport and HDL cholesterol. Decreased Serum and Liver Triglycerides in sg/sg Mice Are Mediated by Decreased SREBP-1c and FAS mRNA Expression in the Liver—Raspe et al. (13Raspe E. Duez H. Gervois P. Fievet C. Fruchart J.C. Besnard S. Mariani J. Tedgui A. Staels B. J. Biol. Chem. 2001; 276: 2865-2871Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar) demonstrated reduced plasma triglycerides in female sg/sg mice that was associated with reduced apoCIII expression in the liver. Analysis of male sg/sg mice revealed that triglycerides (and non-esterified fatty acids) were decreased (Fig. 4, A and B). Additionally, we examined the total triglyceride content and concentration of the liver. We report that total triglyceride content and the concentration (milligrams/g liver wet weight) are significantly reduced in the hepatic tissue from sg/sg mice, relative to wild-type littermates (Fig. 4C). This is consistent with decreased plasma triglycerides. Subsequently, we utilized candidate-based profiling and examined several genes involved in lipogenesis to identify the underlying changes in gene expression responsible for the dyslipidemia. SREBP-1c is an important hierarchical regulator of lipogenesis (25Horton J.D. Goldstein J.L. Brown M.S. J. Clin. Investig. 2002; 109: 1125-1131Crossref PubMed Scopus (3838) Google Scholar, 26Horton J.D. Shah N.A. Warrington J.A. Anderson N.N. Park S.W. Brown M.S. Goldstein J.L. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 12027-12032Crossref PubMed Scopus (1097) Google Scholar). Changes in SREBP-1c (and target gene expression) in liver, adipose, and muscle are associated with changes in plasma triglycerides (25Horton J.D. Goldstein J.L. Brown M.S. J. Clin. Investig. 2002; 109: 1125-1131Crossref PubMed Scopus (3838) Google Scholar, 27Liang G. Yang J. Horton J.D. Hammer R.E. Goldstein J.L. Brown M.S. J. Biol. Chem. 2002; 277: 9520-9528Abstract Full Text Full Text PDF PubMed Scopus (527) Google Scholar). Interestingly, we observed significantly reduced expression of the mRNA encoding SREBP-1c (Fig. 4D) and the lipogenic enzyme, FAS (Fig. 4E) in the liver, and/or skeletal muscle of sg/sg mice, relative to the littermate wt controls. This is concordant with the observed (and reported) reduction in plasma triglycerides from sg/sg mice (13Raspe E. Duez H. Gervois P. Fievet C. Fruchart J.C. Besnard S. Mariani J. Tedgui A. Staels B. J. Biol. Chem. 2001; 276: 2865-2871Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar). In this context, as discussed above, we also observed reduced expression of the mRNA encoding ABCG1 in the liver of sg/sg mice (Fig. 3D), that is also consistent with reduced serum triglycerides and adiposity in the sg/sg mice. A very recent report (28Buchmann J. Meyer C. Neschen S. Augustin R. Schmolz K. Kluge R. Al-Hasani H. Jurgens H. Eulenberg K. Wehr R. Dohrmann C. Joost H.G. Schurmann A. Endocrinology. 2007; 148: 1561-1573Crossref PubMed Scopus (69) Google Scholar), on the ablation of ABCG1 in mice, identified an unexpected role in adiposity and triglyceride storage. Furthermore, in the context of decreased SREBP-1c expression and downstream target genes, we examined the expression of the mRNA encoding glucokinase in fasted liver and observed significantly reduced expression of GcK mRNA expression in sg/sg mice (Fig. 4F). In summary, decreased SREBP-1c and FAS mRNA expression observed in sg/sg mice account for the decreased serum (and liver) triglycerides and reduced adiposity. RORα Regulates the SREBP-1c Promoter—Liver X receptors (LXRs) and carbohydrate response element-binding protein (ChREBP) (29Cha J.Y. Repa J.J. J. Biol. Chem. 2007; 282: 743-751Abstract Full Text Full Text PDF PubMed Scopus (369) Google Scholar, 30da Silva Xavier G. Rutter G.A. Diraison F. Andreolas C. Leclerc I. J. Lipid Res. 2006; 47: 2482-2491Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar) are critical transcriptional regulators of SREBP-1c, lipogenic gene expression, and fatty acid biosynthesis. Hence, we investigated the expression of LXR (LXRα and LXRβ) and ChREBP in sg/sg mice. We did not detect major changes in the expression of these transcription factors, in the hepatic tissue of sg/sg, relative to wild-type mice (Fig. 4, G-I). The change in LXRβ attained significance, however, the decrease in expression was very small. This suggested that the lower triglyceride levels in the liver and plasma were primarily the result of decreased SREBP-1c expression. SREBP-1c expression is also regulated by insulin, repressed upon fasting, and tightly linked to the nutritional state (31Kim J.B. Sarraf P. Wright M. Yao K.M. Mueller E. Solanes G. Lowell B.B. Spiegelman B.M. J. Clin. Investig. 1998; 101: 1-9Crossref PubMed Scopus (614) Google Scholar, 32Osborne T.F. J. Biol. Chem. 2000; 275: 32379-32382Abstract Full Text Full Text PDF PubMed Scopus (443) Google Scholar, 33Gosmain Y. Dif N. Berbe V. Loizon E. Rieusset J. Vidal H. Lefai E. J. Lipid Res. 2005; 46: 697-705Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar). To date, C. Ron Kahn and colleagues (34Biddinger S.B. Hernandez-Ono A. Rask-Madsen C. Haas J.T. Aleman J.O. Suzuki R. Scapa E.F. Agarwal C. Carey M.C. Stephanopoulos G. Cohen D.E. King G.L. Ginsberg H.N. Kahn C.R. Cell Metab. 2008; 7: 125-134Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar) have recently stated “how these two factors (LXR and insulin) interact in the control of SREBP-1c remains a subject of debate” (35Dif N. Euthine V. Gonnet E. Laville M. Vidal H. Lefai E. Biochem. J. 2006; 400: 179-188Crossref PubMed Scopus (97) Google Scholar, 36Cagen L.M. Deng X. Wilcox H.G. Park E.A. Raghow R. Elam M.B. Biochem. J. 2005; 385: 207-216Crossref PubMed Scopus (128) Google Scholar, 37Hegarty B.D. Bobard A. Hainault I. Ferre P. Bossard P. Foufelle F. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 791-796Crossref PubMed Scopus (162) Google Scholar). In this context, we have observed in the fed versus (6 h) fasted transition that SREBP-1c mRNA expression is very similarly decreased in wt and sg/sg mice (data not shown). This raised the question as to whether dysfunctional RORα expression is responsible for aberrant SREBP-1c expression in sg/sg mice. ChIP analysis (quant
Referência(s)