Identification and Biochemical Characterization of a Werner's Syndrome Protein Complex with Ku70/80 and Poly(ADP-ribose) Polymerase-1
2004; Elsevier BV; Volume: 279; Issue: 14 Linguagem: Inglês
10.1074/jbc.m311606200
ISSN1083-351X
AutoresBaomin Li, Sonia Navarro, Noriyuki Kasahara, Lucio Comai,
Tópico(s)Cell death mechanisms and regulation
ResumoWerner's syndrome (WS) is an inherited disease characterized by genomic instability and premature aging. The WS gene encodes a protein (WRN) with helicase and exonuclease activities. We have previously reported that WRN interacts with Ku70/80 and this interaction strongly stimulates WRN exonuclease activity. To gain further insight on the function of WRN and its relationship with the Ku heterodimer, we established a cell line expressing tagged WRNH, a WRN point mutant lacking helicase activity, and used affinity purification, immunoblot analysis and mass spectroscopy to identify WRN-associated proteins. To this end, we identified three proteins that are stably associated with WRN in nuclear extracts. Two of these proteins, Ku70 and Ku80, were identified by immunoblot analysis. The third polypeptide, which was identified by mass spectrometry analysis, is identical to poly(ADP-ribose) polymerase-1(PARP-1), a 113-kDa enzyme that functions as a sensor of DNA damage. Biochemical fractionation studies and immunoprecipitation assays and studies confirmed that endogenous WRN is associated with subpopulations of PARP-1 and Ku70/80 in the cell. Protein interaction assays with purified proteins further indicated that PARP-1 binds directly to WRN and assembles in a complex with WRN and Ku70/80. In the presence of DNA and NAD+, PARP-1 poly(ADP-ribosyl)ates itself and Ku70/80 but not WRN, and gel-shift assays showed that poly-(ADP-ribosyl)ation of Ku70/80 decreases the DNA-binding affinity of this factor. Significantly, (ADP-ribosyl)ation of Ku70/80 reduces the ability of this factor to stimulate WRN exonuclease, suggesting that covalent modification of Ku70/80 by PARP-1 may play a role in the regulation of the exonucleolytic activity of WRN. Werner's syndrome (WS) is an inherited disease characterized by genomic instability and premature aging. The WS gene encodes a protein (WRN) with helicase and exonuclease activities. We have previously reported that WRN interacts with Ku70/80 and this interaction strongly stimulates WRN exonuclease activity. To gain further insight on the function of WRN and its relationship with the Ku heterodimer, we established a cell line expressing tagged WRNH, a WRN point mutant lacking helicase activity, and used affinity purification, immunoblot analysis and mass spectroscopy to identify WRN-associated proteins. To this end, we identified three proteins that are stably associated with WRN in nuclear extracts. Two of these proteins, Ku70 and Ku80, were identified by immunoblot analysis. The third polypeptide, which was identified by mass spectrometry analysis, is identical to poly(ADP-ribose) polymerase-1(PARP-1), a 113-kDa enzyme that functions as a sensor of DNA damage. Biochemical fractionation studies and immunoprecipitation assays and studies confirmed that endogenous WRN is associated with subpopulations of PARP-1 and Ku70/80 in the cell. Protein interaction assays with purified proteins further indicated that PARP-1 binds directly to WRN and assembles in a complex with WRN and Ku70/80. In the presence of DNA and NAD+, PARP-1 poly(ADP-ribosyl)ates itself and Ku70/80 but not WRN, and gel-shift assays showed that poly-(ADP-ribosyl)ation of Ku70/80 decreases the DNA-binding affinity of this factor. Significantly, (ADP-ribosyl)ation of Ku70/80 reduces the ability of this factor to stimulate WRN exonuclease, suggesting that covalent modification of Ku70/80 by PARP-1 may play a role in the regulation of the exonucleolytic activity of WRN. Werner's syndrome (WS) 1The abbreviations used are: WS, Werner's syndrome; WRN, Werner's syndrome protein; Ku, Ku70/80 heterodimer; PARP-1, poly(ADP-ribose) polymerase-1; IRES-GFP, internal ribosome entry site-green fluorescent protein. 1The abbreviations used are: WS, Werner's syndrome; WRN, Werner's syndrome protein; Ku, Ku70/80 heterodimer; PARP-1, poly(ADP-ribose) polymerase-1; IRES-GFP, internal ribosome entry site-green fluorescent protein. is a human genetic disease with many features of premature aging (1Epstein C.J. Martin G.M. Schultz A.L. Motulsky A.G. Medicine. 1966; 45: 177-221Google Scholar, 2Dyer C. Sinclair A. Age and Ageing. 1998; 27: 73-80Google Scholar). The first signs of this disorder appear soon after puberty, with the symptoms becoming fully evident in individuals between 20 and 30 years old. Individuals with WS display a high incidence of diseases associated with normal aging, including atherosclerosis, osteoporosis, type II diabetes mellitus, and cancer. Myocardial infarction and cancer are the most common causes of death among WS patients. The median age of death is ∼47 years (1Epstein C.J. Martin G.M. Schultz A.L. Motulsky A.G. Medicine. 1966; 45: 177-221Google Scholar, 3Matsumoto T. Shimamoto A. Goto M. Furuichi Y. Nat. Genet. 1997; 16: 335-336Google Scholar). Cells isolated from WS patients show genomic instability and a shorter replicative life span (4Shen J.C. Loeb L.A. Trends Genet. 2000; 16: 213-220Google Scholar). The genomic instability is characterized by an elevated rate of chromosomal translocations and extensive genomic deletions (5Fukuchi K. Martin G.M. Monnat R.J. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 5893-5897Google Scholar). These findings suggest that genomic instability underlies the development of the diseases associated with WS. Cultured cells from WS patients are also hypersensitive to some DNA damaging agents (4Shen J.C. Loeb L.A. Trends Genet. 2000; 16: 213-220Google Scholar), suggestive of a defect in the repair of specific DNA lesions. Werner's syndrome is caused by mutations within a single gene, which is located on chromosome 8 (6Yu C.E. Oshima J. Fu Y.H. Wijsman E. Hisama F. Alisch R. Matthews S. Nakura J. Miki T. Ouais S. Martin G. Mulligan J. Schellenberg G. Science. 1996; 272: 258-262Google Scholar). The cDNA encodes a protein (Werner's syndrome protein, WRN) with strong homology to a class of enzymes called RecQ helicases (7Karow J.K. Wu L. Hickson I.D. Curr. Opin. Genet. Dev. 2000; 10: 32-38Google Scholar). In addition, the amino-terminal region of WRN is highly homologous to the nuclease domain of Escherichia coli DNA polymerase I and ribonuclease D (8Moser M.J. Holley W.R. Chatterjee A. Mian I.S. Nucleic Acids Res. 1997; 25: 5110-5118Google Scholar). Helicase and exonuclease activities with a 3′ to 5′ directionality have been demonstrated in vitro using recombinant WRN (9Gray M.D. Wang L. Youssoufian H. Martin G.M. Oshima J. Exp. Cell Res. 1998; 242: 487-494Google Scholar, 10Huang S. Li B. Gray M. Oshima J. Mian I.S. Campisi J. Nat. Genet. 1998; 20: 114-116Google Scholar, 11Kamath-Loeb A.S. Johansson E. Burgers P.M. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4603-4608Google Scholar, 12Shen J.C. Gray M. Oshima J. Kamath-Loeb A. Fry M. Loeb L. J. Biol. Chem. 1998; 273: 34139-34144Google Scholar, 13Shen J.C. Gray M. Oshima J. Loeb L. Nucleic Acids Res. 1998; 26: 2879-2885Google Scholar, 14Suzuki N. Shiratori M. Goto M. Furuichi Y. Nucleic Acids Res. 1999; 27: 2361-2368Google Scholar). A nuclear localization signal is found near the carboxyl-terminal end of WRN (4Shen J.C. Loeb L.A. Trends Genet. 2000; 16: 213-220Google Scholar). All of the WRN mutations in individuals with Werner's syndrome result in non-sense mutations or frameshifts leading to truncated proteins. The prevailing hypothesis is that the aberrant proteins do not enter the nucleus and are rapidly degraded. Consistent with this idea, cell lines from WS patients show no detectable WRN polypeptide (15Moser M.J. Kamath-Loeb A.S. Jacob J.E. Bennett S.E. Oshima J. Monnat Jr., R.J. Nucleic Acids Res. 2000; 28: 648-654Google Scholar). A number of studies have indicated that WRN binds to proteins that are involved in DNA replication and repair, such as the replication protein A, topoisomerase I, DNA polymerase δFen-1, p53, proliferating cell nuclear antigen, and Rad 52 (11Kamath-Loeb A.S. Johansson E. Burgers P.M. Loeb L.A. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4603-4608Google Scholar, 16Bohr V.A. Brosh Jr., R.M. von Kobbe C. Opresko P. Karmakar P. Biogerontology. 2002; 3: 89-94Google Scholar, 17Brosh Jr., R.M. Karmakar P. Sommers J.A. Yang Q. Wang X.W. Spillare E.A. Harris C.C. Bohr V.A. J. Biol. Chem. 2001; 276: 35093-35102Google Scholar, 18Brosh Jr., R.M. Orren D.K. Nehlin J.O. Ravn P.H. Kenny M.K. Machwe A. Bohr V.A. J. Biol. Chem. 1999; 274: 18341-18350Google Scholar, 19Blander G. Kipnis J. Leal J.F. Yu C.E. Schellenberg G.D. Oren M. J. Biol. Chem. 1999; 274: 29463-29469Google Scholar, 20Lebel M. Spillare E.A. Harris C.C. Leder P. J. Biol. Chem. 1999; 274: 37795-37799Google Scholar, 21Spillare E.A. Robles A.I. Wang X.W. Shen J.C. Yu C.E. Schellenberg G.D. Harris C.C. Genes Dev. 1999; 13: 1355-1360Google Scholar, 22Baynton K. Otterlei M. Bjoras M. von Kobbe C. Bohr V.A. Seeberg E. J. Biol. Chem. 2003; 278: 36476-36486Google Scholar). Although some of these proteins have been shown to influence WRN catalytic activities in vitro, the physiological significance of these interactions remains largely unknown. In previous studies, we reported that WRN binds to Ku70/80 heterodimer (Ku) (23Li B. Comai L. J. Biol. Chem. 2000; 275: 28349-28352Google Scholar), a factor involved in the repair of doublestrand DNA breaks by non-homologous end joining (reviewed in Ref. 24Karran P. Curr. Opin. Genet. Dev. 2000; 10: 144-150Google Scholar). Remarkably, our studies showed that Ku recruits WRN to DNA ends and alters the properties of the WRN exonuclease (23Li B. Comai L. J. Biol. Chem. 2000; 275: 28349-28352Google Scholar, 25Li B. Comai L. J. Biol. Chem. 2001; 276: 9896-9902Google Scholar). Other studies have also indicated that Ku70/80 is required for the WRN-mediated hydrolysis of DNA molecules containing lesions mimicking oxidative DNA damage (26Orren D.K. Machwe A. Karmakar P. Piotrowski J. Cooper M.P. Bohr V.A. Nucleic Acids Res. 2001; 29: 1926-1934Google Scholar). A functional interaction between WRN and Ku70/80 is also supported by genetic studies showing that Ku80-null mice display genomic instability and shortened life span (27DiFilippantonio M.J. Zhu J. Chen H.T. Meffre E. Nussenzweig M.C. Max E.E. Ried T. Nussenzweig A. Nature. 2000; 404: 510-514Google Scholar, 28Gu Y. Seidl K.J. Rathbun G.A. Zhu C. Manis J.P. van der Stoep N. Davidson L. Cheng H.L. Sekiguchi J.M. Frank K. Stanhope-Baker P. Schlissel M.S. Roth D.B. Alt F.W. Immunity. 1997; 7: 653-665Google Scholar, 29Ferguson D.O. Sekiguchi J.M. Chang S. Frank K.M. Gao Y. DePinho R.A. Alt F.W. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 6630-6633Google Scholar, 30Gebhart E. Bauer R. Raub U. Schinzel M. Ruprecht K.W. Jonas J.B. Human Genet. 1988; 80: 135-139Google Scholar, 31Vogel H. Lim D.S. Karsenty G. Finegold M. Hasty P. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 10770-10775Google Scholar). Thus, biochemical and genetic evidence suggest that Ku80 and WRN may function together in a DNA repair pathway required for the maintenance of genome integrity. In this study, we report the identification of a cellular WRN complex composed of WRN, Ku70/80, and poly(ADP-ribose) polymerase-1 (PARP-1). PARP-1 is nuclear factor implicated in the control of genomic stability and mammalian life span (32Burkle A. Chembiochem. 2001; 2: 725-728Google Scholar, 33de Murcia G. Menissier de Murcia J. Trends Biochem. Sci. 1994; 19: 172-176Google Scholar). Our results indicate that a subpopulation of PARP-1 coelutes over ion-exchange and gel-filtration chromatography and coimmunoprecipitates with WRN and Ku70/80. Further biochemical analyses show that PARP-1 poly(ADP-ribosyl)ates Ku70/80 but not WRN in vitro, and ADP-ribosylation of Ku70/80 reduces its DNA-binding activity and weakens its ability to stimulate the exonuclease activity of WRN. Lentiviral Vectors and Stable Cell Lines—We subcloned Flag-tagged wild type and helicase mutant (WRNH, K577M; A → G transition at position 1730 of WRN open reading frame; Ref. 34Gray M. Shen J.C. Kamath-Loeb A. Blank A. Sopher B. Martin G. Oshima J. Loeb L. Nat. Genet. 1997; 17: 100-103Google Scholar) WRN cDNAs (excluding the polyadenylation signal and 3′ untranslated sequences) into the polylinker sequence of a lentiviral transfer vector pRRLsin.hCMV-Puro. To generate pRRLsin.hCMV-Puro, the internal ribosome entry site-green fluorescent protein (IRES-GFP) region of the vector pRRLsin.hCMV-IRES-GFP (35Sakoda T. Kasahara N. Hamamori Y. Kedes L. J. Mol. Cell Cardiol. 1999; 31: 2037-2047Google Scholar) was replaced by a minimal SV40 promoter driving the expression of the puromycin N-acetyl transferase gene. We produced recombinant lentivirus preparations by three-plasmid transient co-transfection of human 293T cells as described by Naldini et al. (36Naldini L. Blomer U. Gallay P. Ory D. Mulligan R. Gage F.H. Verma I.M. Trono D. Science. 1996; 272: 263-267Google Scholar). For lentiviral infection, 293T cell cultures were trypsinized, seeded onto 60-mm plates, and incubated at 37 °C for 24 h. The supernatant containing viral particles was collected and added to cultures that were 30–40% confluent. After a 6-h incubation at 37 °C, the supernatant was removed, the cells were washed twice and incubated in Dulbecco's modified Essential medium containing 10% serum at 37 °C. Transduced cells expressing Flag-WRN and Flag-WRNH were selected in media supplemented with puromycin (10 μg/ml). The expression of Flag epitope-tagged proteins was analyzed by immunoblotting with anti-Flag antibodies (Sigma). Construction of Plasmids and Production of Recombinant Proteins— Recombinant WRN and Ku70/80 heterodimer were purified from baculovirus-infected Sf9 cells as described previously (23Li B. Comai L. J. Biol. Chem. 2000; 275: 28349-28352Google Scholar). The pVL1392 Flag-PARP-1 vector for expression of the recombinant Flag-PARP-1 protein in Sf9 cells was constructed by PCR cloning. First, the region of the open reading frame from amino acids 1–232 was amplified from a PARP-1 cDNA clone (Open Biosystems) by PCR using the following primers: 5′-CTAGGGGCATAGGCGGAGTCTTC-3′/5′-GGGCTTTTTCAAGCTTACTATCC-3′. The amplified fragment was digested with NdeI and HindIII and subcloned into the pcDNA3.1/HisA vector. A HindIII fragment containing the carboxyl-terminal portion of PARP-1 was cloned into pcDNA3.1/HisA-Flag-PARP-1-N. The full-length PARP-1 cDNA was then subcloned into the NdeI-XhoI sites of a pVL1392-Flag vector. pVL1392-Flag-PARP-1 was cotransfected with linearized baculogold DNA (BaculoGold, Pharmingen) into Sf9 cells to generate the recombinant baculovirus. For the purification of recombinant Flag-PARP-1, baculovirus-infected cells were lysed in lysis buffer (10 mm Hepes, pH 7.5, 100 mm NaCl, 1.5 mm MgCl2, 0.5% Nonidet P-40), and Flag-PARP-1 was purified by chromatography on DEAE-Sepharose and anti-Flag resin columns. Purification of the WRN Complex—100 mg of nuclear extracts prepared from cells expressing Flag-WRNH were incubated with anti-Flag beads at 4 °C for one hour. After extensive washes, bound proteins were eluted with BCO buffer (1 m KCl, 10 mm Tris HCl, pH 7.5, 1 mm EDTA, 5% glycerol, 1 mm dithiothreitol, 0.5 mm phenylmethylsulfonyl fluoride, 5 μg/ml leupeptin, 5 μg/ml aprotinin) (23Li B. Comai L. J. Biol. Chem. 2000; 275: 28349-28352Google Scholar), resolved by SDS-polyacrylamide gel electrophoresis, and visualized by silver staining. For the identification of the 120-kDa associated factor by mass spectrometry, we isolated the WRN complex from ∼1.0 g of nuclear extracts prepared from 293T-WRNH cells. After the immunopurification of the WRN complex, the proteins were separated by SDS-PAGE and stained with Coomassie blue. The gel was extensively destained, and the protein bands were excised from the gel and shipped to the Howard Hughes Medical Institute Biopolymer Facility and W. M. Keck Foundation Biotechnology Resource Laboratory at Yale University for tryptic peptide digestion and sequencing by mass spectrometry. Twenty-four peptides matched PARP-1 amino acid sequences (see Table I).Table IPARP-1 peptides identified by mass spectrometryIEREGECQRSKLPKPVQDLIKVVDRDSEEAEIIRMIFDVESMKKLQLLEDDKENRIAPPEAPVTGYMFGKAMVEYEIDLQKQQVPSGESAILDRVVSEDFLQDVSASTKGDEVDGVDEVAKKPPLLNNADSVQAKMVDPEKPQLGMIDRSWGRVGTVIGSNKHPDVEVDGFSELREELGFRPEYSASQLKGGSDDSSKDPIDVNYEKFYPLEIDYGQDEEAVKGGAAVDPDSGLEHSAHVLEKNREELGFRPEYSASQLKTGNAWHSKAEPVEVVAPREDAIEHFMKGIYFADMVSKTLGDFAAEYAK Open table in a new tab Immunoprecipitation—Nuclear extracts from 293T cells were prepared as described previously (23Li B. Comai L. J. Biol. Chem. 2000; 275: 28349-28352Google Scholar). The immunoprecipitation of cellular WRN was carried out using antibody generated by immunization of rabbits with a recombinant WRN amino-terminal fragment (amino acids 1–423). Rabbit immunization and sera production were contracted to an outside company (Bethyl Inc.). Immunoprecipitation products were resolved by SDS-PAGE and transferred to nitrocellulose. Western blot analyses were performed by using antibodies raised against WRN, Ku70, and Ku80 (Santa Cruz Biotechnology), PARP-1 (Santa Cruz Biotechnology) and poly(ADP-ribose) (Trevigen). Chromatographic Analysis of WRN, Ku70/80, and PARP-1—Nuclear extracts (5 ml, 4 mg/ml) prepared according to the standard protocol of Dignam et al. (37Dignam J.D. Lebovitz R.M. Roeder R.G. Nucleic Acids Res. 1983; 11: 1475-1489Google Scholar) were loaded onto a 1-ml DEAE-Sepharose fast flow (Amersham Biosciences) column equilibrated in buffer A (20 mm Tris, pH 7.5, 1.0 mm EDTA, 10% glycerol, 1.0 mm dithiothreitol, and a protease inhibitor mixture) containing 150 mm KCl. The flow-through (containing WRN, PARP-1, and Ku70/80) was then applied to a 1.0-ml SP-Sepharose fast flow (Amersham Biosciences) column, which was step-eluted in buffer A containing 0.4 KCl. An equal volume (15 μl) of the nuclear extract, DEAE-Sepharose flow-through, SP-Sepharose flow-through (SP-0.15), and 0.4 m KCl eluate (SP-0.4) were loaded onto an SDS-8% polyacrylamide gel and analyzed by immunoblotting with WRN, Ku70, and PARP-1 antibodies. The flow-through from the SP-Sepharose column (SP-0.15) was centrifuged at 100,000 × g for 60 min, and 1 ml of the supernatant was loaded onto a Superose 6 column (SP-0.15 Superose, 90 ml). The column was run at 0.4 ml/min with buffer A containing 150 mm KCl, and eluates were collected in 0.6-ml fractions. Aliquots (15 μl for the Ku70/80 immunoblot; 100 μl for the WRN immunoblot) from alternate fractions were analyzed by SDS-PAGE and immunoblotted with antibodies raised against WRN and Ku70. For the analysis of WRN, 100 μl of the indicated fractions were subjected to trichloroacetic acid precipitation prior to loading on the SDS-polyacrylamide gel. Likewise, the 0.4 m KCl eluate from the SP-Sepharose column (SP-0.4) was dialyzed in buffer A containing 0.15 m KCl, centrifuged at 100,000 × g for 60 min, and 1 ml of the supernatant was loaded onto a Superose 6 column (SP-0.4 Superose, 90 ml). The column was run as described above. Aliquots (15 μl for PARP-1 and Ku70/80 immunoblots; 100 μl for WRN immunoblot) from alternate fractions were analyzed by SDS-PAGE and immunoblotted with anti-WRN, PARP-1, and Ku70 antibodies. Quantitation of signal intensities was performed by densitometry scanning of x-ray films. For the immunoprecipitation reactions, 0.8 ml of combined fractions 45–46 and 0.8 ml of combined fractions 47–48 from the appropriate gel-filtration column (SP-0.15 Superose 6 or SP-0.4 Superose 6) were incubated with 5 μg of anti-WRN antibody and 15 μl of protein A-Sepharose beads for 2 h. The immunoprecipitated products were washed extensively, released by boiling in SDS-sample buffer, resolved on an SDS-8% PAGE, and analyzed by immunoblots with antibodies raised against WRN, PARP-1, and Ku70. Exonuclease Assay—WRN exonuclease activity was analyzed as described previously (23Li B. Comai L. J. Biol. Chem. 2000; 275: 28349-28352Google Scholar, 25Li B. Comai L. J. Biol. Chem. 2001; 276: 9896-9902Google Scholar) using a 20-oligomer A1 (CGCTAGCAATATTCTGCAGC) and a 46-oligomer A2 (GCGCGGAAGCTTGGCTGCAGAATATTGCTAGCGGGAAATCGGCGCG) partially complementary to A1. Oligonucleotide A1 was labeled at the 5′ end with [γ32P]ATP and T4 DNA kinase. The oligonucleotides were annealed by boiling and cooled gradually to room temperature. Reaction mixtures contained 40 mm Tris-HCl (pH 7.5), 4 mm MgCl2, 5 mm dithiothreitol, 1 mm ATP, 0.1 mg/ml bovine serum albumin, 40 fmol of DNA substrates (100,000 cpm), and increasing amounts (50, 100, and 200 fmol) of Ku70/80 or poly-(ADP-ribose)ated Ku70/80 and WRN in a final volume of 10 μl. The reaction mixtures were incubated at room temperature for 20 min, and each reaction was terminated by the addition of 2 μl of a formamide solution. After incubation at 95 °C for 3 min, the reaction products were resolved by 16% polyacrylamide-urea gel electrophoresis, visualized by autoradiography and phosphoimager analyzer, and quantified with ImageQuant software (Molecular Dynamics). Electrophoretic Mobility Shift Assay—A 20-mer A1 was labeled using [γ32P]ATP and T4 polynucleotide kinase and then annealed to a partially complementary 46-mer A2. Radiolabeled double-strand oligonucleotides (80 fmol, 200,000 cpm) were incubated with increasing amounts (100–300 fmol) of unmodified Ku70/80 or poly(ADP-ribosyl)ated Ku70/80 in 15 μl of buffer (10 mm Tris-HCl, pH 7.5, 100 mm NaCl, 0.5 mm EDTA, and 10% glycerol) at 25 °C for 10 min. The samples were resolved by electrophoresis at 10 V/cm through a 4% polyacrylamide gel at 4 °C. The gel was dried, and reaction products were visualized by autoradiography and PhosphorImager analyzer and quantified by ImageQuant software (Molecular Dynamics). (ADP-ribosyl)ation of Proteins—20 μg of purified Flag-PARP-1 was incubated with 2 μg His-Ku70/80 or His-WRN in a reaction mixture (500 μl) containing 100 mm Tris pH 8.0, 10 mm MgCl2, 1 mm dithiothreitol, 20 ng/μl sonicated salmon sperm DNA, and 20 μm NAD+. After incubation at 30 °C for 2 h, the salts concentration in the reaction was adjusted to 400 mm KCl, and the reaction mixture was incubated with anti-Flag beads at 4 °C for one hour. The supernatant was collected and incubated with metal affinity resin (Talon, Clontech) at 4 °C for one hour. After extensive washes with 20 mm Tris, pH 8.0, 150 mm KCl, 1 mm MgCl2, 10% glycerol, and a mixture of protease inhibitors, Ku70/80 or WRN were eluted with buffer containing 100 mm imidazole, dialyzed, and analyzed by SDS-polyacrylamide gel electrophoresis, silver staining, and immunoblotting, or snap frozen at -80 °C. Isolation of WRN-associated Proteins from Cells Stably Expressing Flag-WRNH—To assist in the purification of a native WRN protein complex, we generated stable 293T cells using recombinant, replication-defective, lentivirus vectors expressing either wild-type Flag-WRN or Flag-WRNH, a WRN protein carrying a point mutation (K577M) that inactivates the helicase activity (25Li B. Comai L. J. Biol. Chem. 2001; 276: 9896-9902Google Scholar, 34Gray M. Shen J.C. Kamath-Loeb A. Blank A. Sopher B. Martin G. Oshima J. Loeb L. Nat. Genet. 1997; 17: 100-103Google Scholar). Because Flag-WRN is expressed at extremely low levels (Fig. 1A, lane 1), this cell line is not particularly useful for biochemical studies. One possible explanation for this effect is that the increased level of functional WRN may be toxic to the cell. On the other hand, the level of expression of Flag-WRNH (lane 2), which is comparable with that of the endogenous WRN (data not shown), is sufficient for the isolation and biochemical characterization of WRNH from cell extracts. Thus, we prepared nuclear extracts from the 293T-WRNH cells and purified the tagged protein by affinity chromatography on anti-Flag resin. In parallel, extracts from 293T cells that were infected with a control lentivirus were subjected to the same purification procedure. Proteins bound to the affinity column were eluted with high salts and examined by SDS-polyacrylamide gel electrophoresis and silver staining. This analysis revealed the presence of three polypeptides of ∼70, 90, and 120 kDa, respectively. These proteins were eluted specifically from the resin incubated with the 293T-WRNH nuclear extract and were absent from the eluate of the control resin (Fig. 1). The 70- and 90-kDa polypeptides were identified as Ku70 and Ku80, respectively, by immunoblot analysis (Fig. 1C). To identify the 120-kDa polypeptide, the protein band was excised from the SDS-polyacrylamide gel, subjected to proteolytic digestion, and analyzed by matrix assisted laser desorption ionization mass spectrometry. Data base searches indicated that the 120-kDa polypeptide is identical to PARP-1 (see Table I), an enzyme that is activated by DNA damage and utilizes NAD+ to catalyze the addition of poly(ADP-ribose) on target proteins. The initial identification was confirmed by immunoblot analysis with monoclonal anti-PARP-1 antibody (Fig. 1C). Physical Interaction between WRN and PARP-1 in Human Cells—To provide further evidence that PARP-1 interacts with endogenous WRN in vivo, we immunoprecipitated WRN from nuclear extracts prepared from 293T cells using anti-WRN antibodies. As a control, the same nuclear extract was subjected to immunoprecipitation with antibody against β-actin. The products of the immunoprecipitation reactions were resolved by SDS-polyacrylamide gel electrophoresis and analyzed by immunoblotting. The results indicate that PARP-1 coimmunoprecipitates with WRN but not with β-actin (Fig. 2A). The Ku70/80 complex is also detected in the immunoprecipitation reaction with anti-WRN antibodies, confirming the results of the immunopurification of Flag-WRNH. Treatment of the nuclear extract with DNase I prior to the immunoprecipitation yielded identical results (data not shown). Previous studies have shown that PARP-1 binds to Ku70/80 (38Galande S. Kohwi-Shigematsu T. J. Biol. Chem. 1999; 274: 20521-20528Google Scholar, 39Ruscetti T. Lehnert B.E. Halbrook J. Le Trong H. Hoekstra M.F. Chen D.J. Peterson S.R. J. Biol. Chem. 1998; 273: 14461-14467Google Scholar); therefore, it is possible that Ku70/80 mediates the interaction between WRN and PARP-1. To determine whether WRN binds directly to PARP-1, recombinant Flag-PARP-1 was immobilized on anti-Flag beads and incubated with recombinant WRN (His-WRN). In parallel reactions, immobilized Flag-PARP1 was incubated with Ku70/80 or with a mixture containing Ku70/80 and WRN. After washing the beads, the bound proteins were resolved by SDS-PAGE and analyzed by Western blotting with antibodies against WRN, Ku70/80, and PARP-1. As shown in Fig. 2B, WRN binds to PARP-1 in the absence of Ku70/80 (lane 6), suggesting that the interaction between WRN and PARP-1 in the WRN complex is mediated, at least in part, by direct interaction between these two proteins. Similarly, WRN binds to PARP-1 in the presence of Ku70/80 (lane 8). These results suggest that these factors can individually associate with each other and can form a trimeric complex in vitro. Analysis of the WRN Complex by Ion Exchange and Gel Filtration Chromatography—To further examine the relationship among WRN, Ku70/80, and PARP-1 and determine whether there is evidence for the existence of a stably associated complex in vivo, we performed a three-step fractionation of the nuclear extracts using a DEAE ion-exchange column, SP-Sepharose ion-exchange column, and Superose 6 gel-filtration columns (Fig. 3). The flow-through of the DEAE column, which contains PARP-1, WRN, and Ku70/80 as detected by immunoblotting (Fig. 3B, lane 2), was applied to an SP-Sepharose column. Immunoblot analysis of the fractions from the step-eluted SP-Sepharose column indicates that WRN and Ku70 elute in both the flow-through (SP-0.15) (lane 3) and the 0.4 m KCl fraction (SP-0.4) (lane 4), whereas PARP-1 elutes in the 0.4 m KCl fraction (SP-0.4) (lane 4). The SP-Sepharose flow-through (SP-0.15) and 0.4 m KCl fraction (SP-0.4) were then individually fractionated further on Superose 6 gel-filtration columns. The analysis of the fraction eluted from the Superose 6 column loaded with the SP-Sepharose flow-through fraction (SP-0.15 Superose 6) indicates that WRN and a portion of Ku coelute in fractions 44–50 (Fig. 3C, top panel). The immunoblot analysis also indicates that a minor fraction of Ku70 elutes in the void volume, possibly suggesting the presence of high molecular weight Ku complexes or aggregates. A similar analysis of the fractions eluted from the Superose 6 column loaded with the SP-Sepharose 0.4 m KCl fraction (SP-0.4 Superose 6) shows that WRN coelutes with a portion of PARP-1 and Ku in fractions 44–52 (Fig. 3C, bottom panel). Note that these data are only suggestive of complex formation. Complex formation per se was then tested by direct immunoprecipitation of these fractions by using anti-WRN antibodies and by probing the precipitated proteins for immunoreactivity against WRN, PARP-1, and Ku70. As shown in Fig. 3D, Ku70 coimmunoprecipitated with WRN from pooled fractions 45/46 and fractions 47/48 of the SP-0.15 Superose 6 column (Fig. 3D, lanes 1 and 2), and Ku70 and PARP-1 coimmunoprecipitated with WRN from pooled fractions 45/46 and fractions 47/48 of the SP-0.4 Superose 6 column (lanes 3 and 4). These results suggest that two WRN complexes may exist in vivo, one with Ku and another with both Ku and PARP-1. Poly(ADP-ribosyl)ation Reduces Ku70/80 DNA-binding Activity—PARP-1 is a nuclear protein that binds to DNA strand breaks and catalyzes ADP-ribosylation of itself and other nuclear proteins by using NAD+ as a cofactor. This catalytic activity requires DNA. To establish that our preparation of purified recombinant PARP-1 was able to poly(ADP-ribosyl)ate itself in a DNA-dependent manner, we incubated recombinant PARP-1 in the absence or presence of increasing amounts of DNA and NAD+. As shown in Fig. 4A, recombinant PARP-1 becomes poly(ADP-ribosyl)ated
Referência(s)