The Yeast Translation Release Factors Mrf1p and Sup45p (eRF1) Are Methylated, Respectively, by the Methyltransferases Mtq1p and Mtq2p
2005; Elsevier BV; Volume: 281; Issue: 5 Linguagem: Inglês
10.1074/jbc.m507651200
ISSN1083-351X
AutoresBogdan Polevoda, Lisa M. Span, Fred Sherman,
Tópico(s)RNA Research and Splicing
ResumoThe translation release factors (RFs) RF1 and RF2 of Escherichia coli are methylated at the N5 -glutamine of the GGQ motif by PrmC methyltransferase. This motif is conserved in organisms from bacteria to higher eukaryotes. The Saccharomyces cerevisiae RFs, mitochondrial Mrf1p and cytoplasmic Sup45p (eRF1), have sequence similarities to the bacterial RFs, including the potential site of glutamine methylation in the GGQ motif. A computational analysis revealed two yeast proteins, Mtq1p and Mtq2p, that have strong sequence similarity to PrmC. Mass spectrometric analysis demonstrated that Mtq1p and Mtq2p methylate Mrf1p and Sup45p, respectively, in vivo. A tryptic peptide of Mrf1p, GGQHVNTTDSAVR, containing the GGQ motif was found to be ∼50% methylated at the glutamine residue in the normal strain but completely unmodified in the peptide from mtq1-Δ. Moreover, Mtq1p methyltransferase activity was observed in an in vitro assay. In similar experiments, it was determined that Mtq2p methylates Sup45p. The Sup45p methylation by Mtq2p was recently confirmed independently (Heurgue-Hamard, V., Champ, S., Mora, L., Merkulova-Rainon, T., Kisselev, L. L., and Buckingham, R. H. (2005) J. Biol. Chem. 280, 2439–2445). Analysis of the deletion mutants showed that although mtq1-Δ had only moderate growth defects on nonfermentable carbon sources, the mtq2-Δ had multiple phenotypes, including cold sensitivity and sensitivity to translation fidelity antibiotics paromomycin and geneticin, to high salt and calcium concentrations, to polymyxin B, and to caffeine. Also, the mitochondrial mit– mutation, cox2-V25, containing a premature stop mutation, was suppressed by mtq1-Δ. Most interestingly, the mtq2-Δ was significantly more resistant to the anti-microtubule drugs thiabendazole and benomyl, suggesting that Mtq2p may also methylate certain microtubule-related proteins. The translation release factors (RFs) RF1 and RF2 of Escherichia coli are methylated at the N5 -glutamine of the GGQ motif by PrmC methyltransferase. This motif is conserved in organisms from bacteria to higher eukaryotes. The Saccharomyces cerevisiae RFs, mitochondrial Mrf1p and cytoplasmic Sup45p (eRF1), have sequence similarities to the bacterial RFs, including the potential site of glutamine methylation in the GGQ motif. A computational analysis revealed two yeast proteins, Mtq1p and Mtq2p, that have strong sequence similarity to PrmC. Mass spectrometric analysis demonstrated that Mtq1p and Mtq2p methylate Mrf1p and Sup45p, respectively, in vivo. A tryptic peptide of Mrf1p, GGQHVNTTDSAVR, containing the GGQ motif was found to be ∼50% methylated at the glutamine residue in the normal strain but completely unmodified in the peptide from mtq1-Δ. Moreover, Mtq1p methyltransferase activity was observed in an in vitro assay. In similar experiments, it was determined that Mtq2p methylates Sup45p. The Sup45p methylation by Mtq2p was recently confirmed independently (Heurgue-Hamard, V., Champ, S., Mora, L., Merkulova-Rainon, T., Kisselev, L. L., and Buckingham, R. H. (2005) J. Biol. Chem. 280, 2439–2445). Analysis of the deletion mutants showed that although mtq1-Δ had only moderate growth defects on nonfermentable carbon sources, the mtq2-Δ had multiple phenotypes, including cold sensitivity and sensitivity to translation fidelity antibiotics paromomycin and geneticin, to high salt and calcium concentrations, to polymyxin B, and to caffeine. Also, the mitochondrial mit– mutation, cox2-V25, containing a premature stop mutation, was suppressed by mtq1-Δ. Most interestingly, the mtq2-Δ was significantly more resistant to the anti-microtubule drugs thiabendazole and benomyl, suggesting that Mtq2p may also methylate certain microtubule-related proteins. Post-translational modification of proteins extends molecular structures beyond the limits imposed by the 20 encoded amino acids and, if reversible, allows a means of control and signaling. A wide range of prokaryotic and eukaryotic proteins are methylated post-translationally, including, for example, cytochrome c, ribosomal proteins, translation factors, and histones (1Paik W.K. Kim S. Protein Methylation. CRC Press, Inc., Boca Baton, FL1990: 1-451Google Scholar). The modifications occur by either N-methylation or carboxymethylation reactions, with the former reactions usually involving N-methylation of lysine, arginine, histidine, alanine, proline, glutamine, phenylalanine, asparagine, and methionine, whereas the latter reactions usually involving O-methylesterification of glutamic and aspartic acid. The enzymes catalyzing these methylation reactions generally use S-adenosylmethionine (AdoMet) 4The abbreviations used are: AdoMet, S-adenosylmethionine; MS, mass spectrometry; MALDI-TOF, matrix-assisted laser desorption/ionization mass spectrometry time-of-flight analysis; RF, translation release factor; LC-MS/MS, liquid chromatography/tandem mass spectrometry; DTT, dithiothreitol; Oligo, oligonucleotide; TAP, tandem affinity purification; RT, reverse transcription. as the methyl donor to transfer the methyl group to the free amino group on the side chain of an amino acid residue (2Lhoest J. Colson C. Paik W.K. Kim S. Protein Methylation. CRC Press, Inc., Boca Baton, FL1990: 61-92Google Scholar). The extent of methylation can be complete or almost complete, as in the case of cytochrome c, or can be partial, as in case of ribosomal proteins. Once incorporated, the methyl groups do not appear to be removed from most proteins. However, reversible methylation of glutamic acid residues is involved in the chemotactic response of bacteria (3Kim C. Jackson M. Lux R. Khan S. J. Mol. Biol. 2001; 307: 119-135Crossref PubMed Scopus (46) Google Scholar); also reversible methylation of the C subunit of the phosphoprotein phosphatase 2A (PP2A) at a conserved C-terminal leucine residue regulates PP2A activity (4Tolstykh T. Lee J. Vafai S. Stock J.B. EMBO J. 2000; 19: 5682-5691Crossref PubMed Scopus (194) Google Scholar). Furthermore, histones were recently shown to be demethylated at the N-terminal tails by the LSD1 enzyme, a process that impacts on chromatin structure and gene transcription (5Shi Y. Lan F. Matson C. Mulligan P. Whetstine J.R. Cole P.A. Casero R.A. Shi Y. Cell. 2004; 119: 941-953Abstract Full Text Full Text PDF PubMed Scopus (3206) Google Scholar). Protein methylation affects various important cell processes, including protein-protein and protein-nucleic acid interactions, chromatin remodeling, transcriptional regulation, RNA processing, protein nuclear trafficking, protein metabolism, cellular signaling, and other basic cellular phenomena (1Paik W.K. Kim S. Protein Methylation. CRC Press, Inc., Boca Baton, FL1990: 1-451Google Scholar, 6McBride A.E. Silver P.A. Cell. 2001; 106: 5-8Abstract Full Text Full Text PDF PubMed Scopus (398) Google Scholar, 7Grant P.A. Genome Biology. 2001; http://genomebiology.com/2001/2/4/reviews/0003PubMed Google Scholar). Although methylation does not change the overall charge of amino acid residues, addition of the methyl groups increases steric hindrance and removes amino hydrogens that might be involved in the formation of bonds. Therefore, methylation could serve to modulate intra- or intermolecular interactions of the target proteins. Particularly, modification of the heterogeneous nuclear RNA proteins, ribosomal proteins, and translation factors may affect their affinity to RNA or play auxiliary role in RNA binding. Methylation of the proteins involved in translation, including translation factors and ribosomal proteins, has been observed in diverse organisms, from Escherichia coli to higher eukaryotes. Furthermore, methylation of certain ribosomal protein orthologs, for example, E. coli L11, yeast Saccharomyces cerevisiae L12, and rat L12 and L3, as well as possibly methylation of translation release factors (RFs), is conserved throughout evolution (2Lhoest J. Colson C. Paik W.K. Kim S. Protein Methylation. CRC Press, Inc., Boca Baton, FL1990: 61-92Google Scholar, 8Dincbas-Renqvist V. Engstrom A. Mora L. Heurgue-Harnard V. Buckingham R. Ehrenberg M. EMBO J. 2000; 19: 6900-6907Crossref PubMed Scopus (123) Google Scholar, 9Lhoest J. Colson C. Eur. J. Biochem. 1981; 121: 33-37Crossref PubMed Scopus (30) Google Scholar). RFs recognize the stop codon in the A site of the ribosome and transfer this stop signal to the peptidyltransferase center (10Kisselev L.L. Buckingham R.H. Trends Biochem. Sci. 2000; 25: 561-566Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar). This induces the hydrolysis of peptidyl-tRNA, thus releasing the nascent polypeptides, but the mechanisms of this reaction are not clearly understood (11Inge-Vechtomov S. Zhouravleva G. Philippe M. Biol. Cell. 2003; 95: 195-209Crossref PubMed Scopus (101) Google Scholar). There are two RFs classes, I, which actually recognizes a stop codon, and II, a recycle factor for RFI, which is a GTPase (10Kisselev L.L. Buckingham R.H. Trends Biochem. Sci. 2000; 25: 561-566Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar). In E. coli, two of the class I translation release factors, RF1 and RF2, are required for recognition of the translation termination stop codons; RF1 recognizes UAG and UAA and RF2 recognizes UAA and UGA (12Scolnick E.M. Tompkins R. Caskey C.T. Nirenberg M. Proc. Natl. Acad. Sci. U. S. A. 1968; 61: 768-774Crossref PubMed Scopus (267) Google Scholar, 13Beaudet A.L. Caskey C.T. Proc. Natl. Acad. Sci. U. S. A. 1971; 68: 619-624Crossref PubMed Scopus (60) Google Scholar). In eukaryotes a single protein, eRF1, recognizes all three translation stop codons (14Frolova L.Y. Le Goff X. Rasmussen H.H. Cheperegin S. Drugeon G. Kress M. Arman I. Haenni A.L. Celis J.E. Philippe M. Kisselev L. Nature. 1994; 372: 701-703Crossref PubMed Scopus (375) Google Scholar); thus eukaryotic RFs are structurally and functionally distinct as compared with the prokaryotic counterparts. The corresponding genes of the class I release factors, RF1, RF2, and eRF1, are essential for viability in bacteria and yeast (11Inge-Vechtomov S. Zhouravleva G. Philippe M. Biol. Cell. 2003; 95: 195-209Crossref PubMed Scopus (101) Google Scholar). RF3 (class II RF) enhances the activity of RF1 and RF2 in a GTP-dependent manner and catalyzes the dissociation of RFI from the ribosome following peptide release (15Freistroffer D.V. Pavlov M.Y. MacDougall J. Buckingham R.H. Ehrenberg M. EMBO J. 1997; 16: 4126-4133Crossref PubMed Scopus (245) Google Scholar, 16Zavialov A.V. Buckingham R.H. Ehrenberg M. Cell. 2001; 107: 115-124Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar, 17Zavialov A.V. Mora L. Buckingham R.H. Ehrenberg M. Mol. Cell. 2002; 10: 789-798Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar), although this has not been established in eukaryotes. RF3 has been shown not to be essential in E. coli (18Milman G. Goldstein J. Scolnick E. Caskey T. Proc. Natl. Acad. Sci. U. S. A. 1969; 63: 183-190Crossref PubMed Scopus (79) Google Scholar); however the eukaryotic release factor, eRF3 (Sup35p in yeast), is an essential gene and is required for the activity of the release factor complex at all three stop codons (19Zhouravleva G. Frolova L.Y. Le Goff X. Le Guellec R. Inge-Vechtomov S. Kisselev L. Philippe M. EMBO J. 1995; 14: 4065-4072Crossref PubMed Scopus (522) Google Scholar, 20Stansfield I. Jones K.M. Kushnirov V.V. Dagkesamanskaya A.R. Poznyakovski A.I. Paushkin S.V. Nierras C.R. Cox B.S. Ter Avanesyan M.D. Tuite M.F. EMBO J. 1995; 14: 4365-4373Crossref PubMed Scopus (429) Google Scholar, 21Stansfield I. Jones K.M. Tuite M.F. Trends Biochem. Sci. 1995; 20: 489-491Abstract Full Text PDF PubMed Scopus (35) Google Scholar). Also, eRF3 forms a ribosome-bound complex with eRF1 that in bacteria could be detected only in presence of ribosomes (16Zavialov A.V. Buckingham R.H. Ehrenberg M. Cell. 2001; 107: 115-124Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar, 22Frolova L.Y. Merkulova T.I. Kisselev L.L. RNA (N. Y.). 2000; 6: 381-390Crossref PubMed Scopus (111) Google Scholar). Organellar release factors have been identified in the mitochondria of rat, yeast, and humans (23Pel H.J. Maat C. Rep M. Grivell L.A. Nucleic Acids Res. 1992; 20: 6339-6346Crossref PubMed Scopus (42) Google Scholar, 24Zhang Y.L. Spremulli L.L. Biochim. Biophys. Acta. 1998; 1443: 245-250Crossref PubMed Scopus (64) Google Scholar, 25Askarian-Amiri M.E. Pel H.J. Geuvremont D. McCaughan K.K. Poole E.S. Sumpter V.G. Tate W.P. J. Biol. Chem. 2000; 275: 17241-17248Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar). The only release factor that acts at the translation termination stop codons in mitochondria is mRF1 (24Zhang Y.L. Spremulli L.L. Biochim. Biophys. Acta. 1998; 1443: 245-250Crossref PubMed Scopus (64) Google Scholar, 26Tate W.P. Poole E.S. Mannering S.A. Prog. Nucleic Acids Res. Mol. Biol. 1996; 52: 293-335Crossref PubMed Google Scholar). In the yeast S. cerevisiae, the MRF1 gene encodes a protein more similar to the prokaryotic RF1 than to RF2, and the MRF1 gene is required for proper translation in mitochondria (27Towpik J. Chacinska A. Ciesla M. Ginalski K. Boguta M. J. Biol. Chem. 2004; 279: 14096-14103Abstract Full Text Full Text PDF PubMed Scopus (13) Google Scholar). Mrf1p recognizes only the termination codons UAA and UAG on mitochondrial and bacterial ribosomes (25Askarian-Amiri M.E. Pel H.J. Geuvremont D. McCaughan K.K. Poole E.S. Sumpter V.G. Tate W.P. J. Biol. Chem. 2000; 275: 17241-17248Abstract Full Text Full Text PDF PubMed Scopus (21) Google Scholar), the same codons recognized by RF1. The UGA codon is not a stop signal in yeast mitochondria (28Jukes U.P. Osawa S. Comp. Biochem. Physiol. B. 1993; 106: 489-494Crossref PubMed Scopus (15) Google Scholar). Bacterial RF1, mitochondrial RF1, and eRF1 are homologous proteins (supplemental Fig. 1), and although they are functionally similar, they belong to the different families and display differences in the protein domain structure (10Kisselev L.L. Buckingham R.H. Trends Biochem. Sci. 2000; 25: 561-566Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar). However, one tripeptide motif, the GGQ motif, is the most conserved feature of the release factors in prokaryotes, eukaryotes, and Archaea (14Frolova L.Y. Le Goff X. Rasmussen H.H. Cheperegin S. Drugeon G. Kress M. Arman I. Haenni A.L. Celis J.E. Philippe M. Kisselev L. Nature. 1994; 372: 701-703Crossref PubMed Scopus (375) Google Scholar, 29Song H. Mugnier P. Das A.K. Webb H.M. Evans D.R. Tuite M.F. Hemmings B.A. Barford D. Cell. 2000; 100: 311-321Abstract Full Text Full Text PDF PubMed Scopus (384) Google Scholar). This motif was shown to be important for the hydrolysis of peptidyl-tRNA (22Frolova L.Y. Merkulova T.I. Kisselev L.L. RNA (N. Y.). 2000; 6: 381-390Crossref PubMed Scopus (111) Google Scholar), and it has been proposed that the glutamine residue in the release factor GGQ motif is involved in the coordination of the water molecule necessary for the hydrolysis of the peptidyl-tRNA ester bond (29Song H. Mugnier P. Das A.K. Webb H.M. Evans D.R. Tuite M.F. Hemmings B.A. Barford D. Cell. 2000; 100: 311-321Abstract Full Text Full Text PDF PubMed Scopus (384) Google Scholar) and for normal functioning of the class I release factors. S. cerevisiae Mrf1p and Sup45p (eRF1) have extensive sequence similarities to the bacterial RF1, including the predicted site of methylation, GGQ. The GGQ motif is essential for the function of both prokaryotic and eukaryotic RFs, and mutations of the glutamine residue in E. coli and S. cerevisiae result in lethality (29Song H. Mugnier P. Das A.K. Webb H.M. Evans D.R. Tuite M.F. Hemmings B.A. Barford D. Cell. 2000; 100: 311-321Abstract Full Text Full Text PDF PubMed Scopus (384) Google Scholar, 30Mora L. Heurgué-Hamard V. Champ S. Ehrenberg M. Kisselev L. Buckingham R.H. Mol. Microbiol. 2003; 47: 267-275Crossref PubMed Scopus (84) Google Scholar). RF1 and RF2 proteins of E. coli are post-translationally methylated at the glutamine residue by PrmC (HemK) methyltransferase (31Heurgue-Hamard V. Champ S. Engstrom A. Ehrenberg M. Buckingham R.H. EMBO J. 2002; 21: 769-778Crossref PubMed Scopus (115) Google Scholar, 32Nakahigashi K. Kubo N. Narita S.-I. Shimaoka T. Goto S. Oshima T. Mori H. Maeda M. Wada C. Inokuchi H. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 1473-1478Crossref PubMed Scopus (98) Google Scholar). It has been confirmed in another study that the glutamine residues of the GGQ motif at position 235 in RF1 and at position 252 in RF2 are indeed N5-methylated (8Dincbas-Renqvist V. Engstrom A. Mora L. Heurgue-Harnard V. Buckingham R. Ehrenberg M. EMBO J. 2000; 19: 6900-6907Crossref PubMed Scopus (123) Google Scholar). Moreover, methylation of glutamine at position 252 in the GGQ motif of E. coli RF2 correlates with increased efficiency of translation termination (8Dincbas-Renqvist V. Engstrom A. Mora L. Heurgue-Harnard V. Buckingham R. Ehrenberg M. EMBO J. 2000; 19: 6900-6907Crossref PubMed Scopus (123) Google Scholar). The E. coli ribosomal protein L3 is the only other protein known to have an N5 -methylglutamine modification (33Lhoest J. Colson C. Mol. Gen. Genet. 1977; 154: 175-180Crossref PubMed Scopus (28) Google Scholar). In addition to high similarities of the protein sequences for translation release factors in bacteria and yeast, including the conserved GGQ motif, the proteins similar to E. coli PrmC methyltransferase could be identified in yeast as well. The protein methyltransferases responsible for these modifications generally have conserved functional domains, responsible for binding of the cofactor AdoMet. The orthologs of these protein methyltransferases share common functional domains, and consequently potential protein methyltransferases can be identified by sequence comparisons. To identify those methyltransferases that may modify the yeast translation release factors, we have searched the yeast S. cerevisiae proteome for potential candidates; this search revealed the two yeast proteins, Ynl063wp and Ydr140wp, that had strong sequence similarity to the E. coli PrmC (Fig. 1). The corresponding genes will be referred to as MTQ1 and MTQ2, respectively. In this study we demonstrated that the yeast S. cerevisiae protein methyltransferases, Mtq1p and Mtq2p, methylate Mrf1p and Sup45p (eRF1), respectively, in vivo. We also tested the methyltransferase activity of Mtq1p and Mtq2p in vitro and the phenotypes of the corresponding deletion mutants. Although mtq1-Δ strains had only slightly diminished growth on YPG medium, the mtq2-Δ strains showed multiple phenotypes, including cold sensitivity and sensitivity to translation fidelity antibiotics paromomycin and geneticin, to high salt and calcium concentrations, to polymyxin B, and to caffeine. Most interestingly, the mtq2-Δ mutant was significantly more resistant to the anti-mitotic drugs thiabendazole and benomyl as compared with the normal strain. While this work was in progress, Heurgue-Hamard et al. (35Heurgue-Hamard V. Champ S. Mora L. Merkulova-Rainon T. Kisselev L.L. Bucking ham R.H. J. Biol. Chem. 2005; 280: 2439-2445Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar) independently found that YDR140w was capable of methylating eRF1. Yeast Strains—The strains of S. cerevisiae used in this study are listed in Table 1. The analysis of N5 -glutamine methylation was carried out with two isogenic series, which were derived from the following parental strains: B-8114 (MATa CYC1 cyc7-67 lys5-10 ura3-52) and B-14276 (MATα his3Δ0 leu2Δ0 lysΔ0 ura3Δ0). Several deletion mutant strains, which were used as a source to generate the PCR disruption products, and the MRF1::TAP strain were purchased from Invitrogen or Open Biosystems (Huntsville, AL).TABLE 1Yeast strainsStrain no.GenotypeRef./SourceB-8114MATa CYC1 cyc7-67 lys5-10 ura3-52This studyB-8389MATa ade2-101 kar1-1 ura3-52 [cox2-25]34Bonnefoy N. Fox T.D. Mol. Gen. Genet. 2000; 262: 1036-1046Crossref PubMed Scopus (61) Google ScholarB-15278MATa CYC1 cyc7-67 lys5-10 ura3-52 mtq1-Δ::kanMX4This studyB-15313MATa CYC1 cyc7-67 lys5-10 ura3-52 mtq2-Δ::kanMX4This studyB-15545MATa CYC1-853 cyc7-67 lys5-10 ura3-52 mtq1-Δ::URA3This studyB-15567MATa CYC1-853 cyc7-67 lys5-10 ura3-52 mtq2-Δ::URA3This studyB-15286MATa CYC1 cyc7-67 lys5-10 ura3-52 mrf1-Δ::kanMX4This studyB-14276MATα his3Δ0 leu2Δ0 lys2Δ0 ura3Δ0BY4742B-14483MATα his3Δ0 leu2Δ0 lys2Δ0 ura3Δ0 mrf1-Δ::kanMX4Research GeneticsB-14471MATα his3Δ0 leu2Δ0 lys2Δ0 ura3Δ0 mtq1-Δ::kanMX4Research GeneticsB-14481MATα his3Δ0 leu2Δ0 lys2Δ0 ura3Δ0 mtq2-Δ::kanMX4Research GeneticsB-15403MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 MRF1::TAP::HIS3Open BiosystemsB-15450MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 MRF1::TAP::HIS3 mtq2-Δ::kanMX4This studyB-15452MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ0 MRF1::TAP::HIS3 mtq1-Δ::kanMX4This studyB-15609MATa CYC1 cyc7-67 lys5-10 ura3-52 p[2μ URA3 MRF1::TAP::HIS3]This studyB-15610MATa his3Δ1 leu2Δ0 met15Δ0 ura3Δ mrf1-Δ::kanMX4 p[2μ URA3 MRF1::TAP::HIS3]This studyB-15611MATa CYC1 cyc7-67 lys5-10 ura3-52 mrf1-Δ::kanMX4 p[2μ URA3 MRF1::TAP::HIS3]This studyB-15543MATa CYC1 cyc7-67 lys5-10 ura3-52 SUP45::TAP::URA3This studyB-15612MATa CYC1 cyc7-67 lys5-10 ura3-52 p[2μ URA3 SUP45::TAP::URA3]This studyB-15613MATa CYC1 cyc7-67 lys5-10 ura3-52 mtq2-Δ::kanMX4 p[2μ URA3 SUP45::TAP::URA3]This studyB-15593MATa kar1-1 leu1 [cox2-V25]M. BogutaB-15594MATa kar1-1 leu1 [mit+]M. BogutaB-15598MATa kar1-1 leu1 mtq1-Δ::kanMX4 [cox2-V25]This studyB-15599MATa kar1-1 leu1 mtq1-Δ::kanMX4 [mit+]This studyB-15891MATa kar1-1 leu1 mtq2-Δ::kanMX4 [cox2-V25]This studyB-15890MATa kar1-1 leu1 mtq2-Δ::kanMX4 [mit+]This study Open table in a new tab Media—Standard media YPD, YPG, YPDG, and SD, containing appropriate supplements, and sporulation medium SP3 have been described (36Sherman F. Methods Enzymol. 2002; 350: 3-41Crossref PubMed Scopus (992) Google Scholar). Other media contain 1% Bacto-yeast extract, 2% Bactopeptone, and either 2% ethanol (YPE), 2% glycerol and 1% ethanol (YPEG), or 2% raffinose. Unless stated otherwise, yeast strains were grown at 30 °C. Certain phenotypes of the mtq1-Δ and mtq2-Δ strains were determined with YPD medium containing the following amounts of different agents: 1 m NaCl; 1 m KCl; 0.3 m CaCl2; 0.15% caffeine; 200 –1200 μg/ml paromomycin; 50 –75 μg/ml geneticin (G418); 100–200 μg/ml polymyxin B; 25–50 μg/ml thiabendazole; and 10 –30 μg/ml benomyl. Construction of the Deletion Mutants—Standard molecular biological procedures were used to generate deletions. The MTQ1, MTQ2, and MRF1 genes were disrupted by replacing portions of the genes with the URA3 gene of Kluveromyces lactis or the kanMX4 gene produced by PCR and then using the appropriate fragment for yeast transformation. For example, primers Oligo1 and Oligo2 (Table 2) and plasmid pAB2630 (pBS1539) were used to prepare the PCR fragment, which were used in the construction of the mtq1-Δ::URA3 disruption. After yeast transformation, the correct disruptions among the transformants were identified by PCR, using the set of primers Oligo3 and Oligo4. Similarly, the DNA fragment required for producing the mtq2-Δ::URA3 disruption was prepared with Oligo5 and Oligo6 and plasmid pAB2630. The transformants were screened by PCR with Oligo7 and Oligo8. To obtain mtq1, mtq2, and mrf1 deletion strains with the marker kanMX4 in the B-8114 background, yeast genomic DNAs, which were prepared from the corresponding ORF::kanMX4 deletion strain (Invitrogen), were used as template for PCR with primers Oligo3 and 4, Oligo7 and 8, and Oligo14 and 15, respectively.TABLE 2Oligonucleotides used in the construction and testing of the disrupted genesOpen reading frameOligonucleotideSequence (5′ → 3′)MTQ1Oligo1(-26) CTCTTCCCCTTAACTCGTAGACAAGGAGCGATAGTTGAATGGTAGGCATTGGATGGTGGTAACGMTQ1Oligo2(+1016) TCCACAGAGTGTTCCGTTTGATAACTTCCAACAAAAAAACCTGAGCCATTAAGTTGATCCATTGMTQ1Oligo3(-51) GGAGCGATAGTTGAATGGTAGGMTQ1Oligo4(+993) AACTTCCAACAAAAAAACCTGAGMTQ2Oligo5(-50) CTCTGAAATATAATATTGATAAACTTAACACAGGGTGAGAAAGGTGATTGGATGGTGGTAACGCMTQ2Oligo6(+707) GACACAGGTTATCAATTATAACGTGAAAGGTTTTGCAACTGTCACCTTAAGTTGATCCATTGTGMTQ2Oligo7(-100) CCGAAGACGCCATCGGAATTTGMTQ2Oligo8(+719) CGCTTTGAGTAAAGACACAGGTSUP45Oligo9(+1264) GAGGATGAATATTATGACGAAGATGAAGGATCCGACTATGATTTCTCCATGGAAAAGAGAAGSUP45Oligo10(+1390) AGCGAATTTAATTTAAATCTGGCATCTAGTGATTAAATTCTTTTTGTACGACTCACTATAGGGSUP45Oligo11(-151) CCAGTGCTAAGCGTCAAATCASUP45Oligo12(+1485) TCCTCTAAACCCACTATGTACSUP45Oligo13(+1111) GAATGGCTAGCAGCTAACTACMRF1Oligo14(-44) TGAAAAGTTCGTAGAGCAGAACMRF1Oligo15(+1294) CAGAAGTGATAGATACGATATGMTQ1Oligo16(-7) AGAACATATGGTCGACATATCTACATCATTGMTQ1Oligo17(+956) CATTTATATACTGGATCCCAATTAGCTTTGTGMTQ2Oligo18(-6) TGAAGTATGCTCGAGACCCCTTATGTAMTQ2Oligo19(+667) GTCACCTTGGATCCCTGTACACACTGACOX2Oligo20(+798) GCATATTTGCATGACCTGTCCCCOX2Oligo21(+171) ATTTTCAGGATTCAGCAACACCCOX2Oligo22(+720) ACTTGATTTAATCTACCAGGAGACT1Oligo23(+702) AGAAGATTGAGCAGCGGTTTGCACT1Oligo24(+73) GACGCTCCTCGTGCTGTCTTCCACT1Oligo25(+646) GTTTTTCCTTGATGTCACGGAC Open table in a new tab Construction of the SUP45::TAP Yeast Strain—The SUP45::TAP strain was made by a PCR-based technique with Oligo9 and Oligo10 and with plasmid pAB2630 (pBS1539) as a template (Table 2). B-8114 was transformed with the resulting PCR product containing the SUP45::TAP::URA3 DNA fragment, and the transformants were screened by amplifying the SUP45 locus with Oligo11 and Oligo12. The SUP45::TAP from the positive clones was amplified by PCR, and the insert was sequenced to confirm the correct in-frame fusion. In addition, the cell extract of the positive strain, B-15543, was probed with peroxidase-anti-peroxidase complex antibody that recognizes the TAP tag within proteins. Because B-15543 grew similar to the normal strain, without a detectable phenotype, the SUP45::TAP fusion was inferred to be completely functional. It is important to note that SUP45, unlike MRF1, is an essential gene, and the sup45 deletion mutant is not viable. Also, MRF1::TAP was completely functional, although the mrf1-Δ strain does not grow on nonfermentable carbon sources. Test for Suppression of the Readthrough Accuracy Using the cox2-V25 Mutant—Testing gene deletions for readthrough accuracy in mitochondrial translation was performed by using strains B-15594, normal, and B-15593 that contain the cox2-V25 allele, which has an early premature stop codon that interrupts the COX2 gene (37Boguta M. Zoladek T. Putrament A. J. Gen. Microbiol. 1986; 132: 2087-2097PubMed Google Scholar). These tester strains were obtained from Dr. M. Boguta (Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Warsaw, Poland). mtq1-Δ deletions were made in both strains B-15594 and B-15593 by replacing the MTQ1 gene with the kanMX4 gene, as described above, to produce B-15598 and B-15599, respectively (Table 1). Similarly, mtq2-Δ strains B-15891 and B-15890 were made from B-15594 and B-15593, respectively. Subsequently, all strains were tested on YP0.1%DG medium. The level of mitochondrial Cox2p expression was determined by Western blot analysis, using cell extracts of the yeast strains grown on YPDG and using mouse monoclonal anti-Cox2p antibody (a gift from Dr. T. Fox, Cornell University). We also used actin antibody as loading control (rabbit polyclonal antibody was a gift from Dr. A. Bretscher, Cornell University). The following isogenic series of strains were used: normal B-15594 (mit+); B-15593 (cox2-V25); and each of the strains containing mtq1-Δ or mtq2-Δ (Table 1). Yeast cell extract preparation, protein separation by SDS-PAGE, Western blotting, and probing with antibody were performed by standard techniques (38Rigaut G. Shevchenko A. Rutz B. Wilm M. Mann M. Séraphin B. Nat. Biotechnol. 1999; 17: 1030-1032Crossref PubMed Scopus (2286) Google Scholar, 39Polevoda B. Cardillo T.S. Doyles T.C. Bedi G.S. Sherman F. J. Biol. Chem. 2003; 33: 30686-30697Abstract Full Text Full Text PDF Scopus (94) Google Scholar). Total yeast RNA was extracted by standard procedures with phenol: chloroform treatment of the glass-bead disrupted cells. The RNA samples were normalized after measuring their absorbance at 280/260 nm and were tested by electrophoresis on 1% agarose gel. COX2 and ACT1 cDNAs were obtained with ThermoScript RT-PCR System kit (Invitrogen) using gene-specific oligonucleotides 20 and 23, respectively (Table 2). Subsequently, specific DNA fragments were amplified by PCR with nested oligonucleotides 21 and 22 for COX2 and oligonucleotide 24 and 25 for ACT1. The expected PCR products of 550 bp for COX2 and 574 bp for ACT1 were observed in 1% agarose gel. MTQ1 and MTQ2 Overexpression in Bacterial System—Cloning of the MTQ1 and MTQ2 genes for overexpression in the E. coli pET system was performed by using PCR with oligonucleotides Oligo16 and Oligo17 for MTQ1 and Oligo18 and Oligo19 for MTQ2 (Table 2). Genomic DNA prepared from the normal yeast strain served as template for PCR, and the primers were designed to introduce XhoI and BamHI restriction sites to both ends of the resulting PCR products (Table 2). This allowed for the direct cloning of DNA fragments containing the modified MTQ1 and MTQ2 genes into the pET15b vector (Novagen, Madison, WI) that is used for making polyhistidine-tagged proteins. The positive transformants containing inserts were sequenced to confirm the correct in-frame fusion for MTQ1 and MTQ2 genes; subsequently the corresponding cell extracts were tested with anti-polyhistidine antibody (Sigma). The plasmids containing N-His6-MTQ1 and -MTQ2 were transformed into the E. coli strain BL21 that is designed for production of proteins. Purification of N-His6-Mtq1p and N-His6-Mtq2p Proteins—The bacterially overexpressed Mtq1p and Mtq2p His6 fusion proteins were purified by immob
Referência(s)