The Role of Constant Region Carbohydrate in the Assembly and Secretion of Human IgD and IgA1
2002; Elsevier BV; Volume: 277; Issue: 32 Linguagem: Inglês
10.1074/jbc.m203258200
ISSN1083-351X
AutoresFrançoise A. Gala, Sherie L. Morrison,
Tópico(s)Monoclonal and Polyclonal Antibodies Research
ResumoImmunoglobulins are glycoproteins, containing N- linked carbohydrates in the heavy chain constant regions of all isotypes and O-linked carbohydrates in the hinge regions of human IgA1 and IgD. A previous study showed that IgD synthesized in the presence of tunicamycin and lacking the three N-linked glycans on the heavy chain was not secreted (Shin, S. U., Wei, D. F., Amin, A. R., Thorbecke, G. J., and Morrison, S. L. (1992) Hum. Antibodies 3, 65–74). The contribution of each of the carbohydrates in the Fc of IgD to assembly and secretion was now analyzed by eliminating the carbohydrate addition sequence, Asn-X-Ser/Thr, through site-directed mutagenesis. Only the carbohydrate nearest the sole disulfide bond between heavy chains, which remained high mannose and appeared to be buried within the folded molecule, was found to be essential for secretion. When IgD lacked that glycan, assembly reached only the heavy/light chain half-molecule stage, and heavy chains were held inside the endoplasmic reticulum. Using benzyl 2-acetamido-2-deoxy-α-d-galactopyranoside (BADG) to inhibit complete O-linked glycosylation, we found that IgA1 and IgD with incomplete hinge carbohydrates were assembled and secreted from cells. Thus, one N-linked glycan plays a structural role in IgD and is required for proper assembly and secretion, but the O-linked carbohydrates in the hinge of IgD and IgA1 are not required for folding and export. Immunoglobulins are glycoproteins, containing N- linked carbohydrates in the heavy chain constant regions of all isotypes and O-linked carbohydrates in the hinge regions of human IgA1 and IgD. A previous study showed that IgD synthesized in the presence of tunicamycin and lacking the three N-linked glycans on the heavy chain was not secreted (Shin, S. U., Wei, D. F., Amin, A. R., Thorbecke, G. J., and Morrison, S. L. (1992) Hum. Antibodies 3, 65–74). The contribution of each of the carbohydrates in the Fc of IgD to assembly and secretion was now analyzed by eliminating the carbohydrate addition sequence, Asn-X-Ser/Thr, through site-directed mutagenesis. Only the carbohydrate nearest the sole disulfide bond between heavy chains, which remained high mannose and appeared to be buried within the folded molecule, was found to be essential for secretion. When IgD lacked that glycan, assembly reached only the heavy/light chain half-molecule stage, and heavy chains were held inside the endoplasmic reticulum. Using benzyl 2-acetamido-2-deoxy-α-d-galactopyranoside (BADG) to inhibit complete O-linked glycosylation, we found that IgA1 and IgD with incomplete hinge carbohydrates were assembled and secreted from cells. Thus, one N-linked glycan plays a structural role in IgD and is required for proper assembly and secretion, but the O-linked carbohydrates in the hinge of IgD and IgA1 are not required for folding and export. heavy light endoplasmic reticulum N-acetylgalactosamine galactose N-acetylglucosamine benzyl 2-acetamido-2-deoxy-α-d-galactopyranoside tunicamycin endoglycosidase H concanavalin A major endoplasmic reticulum glycoprotein Chinese Hamster Ovary bovine serum albumin 5-dimethylaminonaphthalene-1-sulfonyl β-mercaptoethanol horseradish peroxidase fluorescein isothiocyanate transferrin receptor Like all immunoglobulin isotypes, human IgD and IgA1 are glycoproteins, containing N-linked carbohydrates on their heavy (H)1 chains. They are unique also in that they bear O-linked carbohydrates in the hinge region. The two types of glycans differ in several ways. Asparagine- or N-linked carbohydrates are added as large GlcNAc2Man9Glc3 precursors to proteins co-translationally in the endoplasmic reticulum (ER) prior to folding. O-linked glycans are assembled sequentially onto folded proteins in the Golgi apparatus, where N-glycans may continue to be enzymatically processed to their mature form (1Kornfeld R. Kornfeld S. Annu. Rev. Biochem. 1985; 54: 631-664Crossref PubMed Scopus (4010) Google Scholar). The consensus sequence for addition of the precursor carbohydrate to asparagine residues of nascent proteins is Asn-X-Ser/Thr, where X may be any amino acid except proline, and if Ser is in the third position, X may only rarely be Asp, Glu, Trp, or Leu (2Gavel Y. von Heijne G. Protein Eng. 1990; 3: 433-442Crossref PubMed Scopus (650) Google Scholar, 3Kasturi L. Eshleman J.R. Wunner W.H. Shakin-Eshleman S.H. J. Biol. Chem. 1995; 270: 14756-14761Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 4Kasturi L. Chen H. Shakin-Eshleman S.H. Biochem. J. 1997; 323: 415-419Crossref PubMed Scopus (115) Google Scholar, 5Shakin-Eshleman S.H. Spitalnik S.L. Kasturi L. J. Biol. Chem. 1996; 271: 6363-6366Abstract Full Text Full Text PDF PubMed Scopus (260) Google Scholar). Less is known about the regulation ofO-glycan addition to serine or threonine residues. There exists no defined addition sequon for the attachment of the firstN-acetylgalactosamine (GalNAc) residue, although through statistical methods some trends in the surrounding sequences have been identified (6Elhammer A.P. Poorman R.A. Brown E. Maggiora L.L. Hoogerheide J.G. Kezdy F.J. J. Biol. Chem. 1993; 268: 10029-10038Abstract Full Text PDF PubMed Google Scholar, 7Hansen J.E. Lund O. Engelbrecht J. Bohr H. Nielsen J.O. Biochem. J. 1995; 308: 801-813Crossref PubMed Scopus (236) Google Scholar). N-linked glycans are large and contain a pentasaccharide core derived from the precursor, consisting of twoN-acetylglucosamine (GlcNAc) and three mannose residues. To this may be attached mannose, glucose, galactose (Gal), and/or GlcNAc residues as well as sialic acid and fucose. Mature carbohydrates may be high mannose, hybrid, or complex. High mannose glycans are the least processed and resemble a trimmed version of the precursor. Hybrid glycans are trimmed to a greater degree, with some residues added to terminal mannoses. Complex carbohydrates are the most highly processed and appear in a variety of structures with a greater number of residues added to the pentasaccharide core. O-linked carbohydrates are comprised of a smaller, more diverse core consisting of a GalNAc-Gal pair or a GalNAc with GlcNAc and Gal attached via different possible linkages. More residues also may be present on the mature carbohydrate (8Hounsell E.F. Davies M.J. Renouf D.V. Glycoconj. J. 1996; 13: 19-26Crossref PubMed Scopus (189) Google Scholar, 9Schachter H. Brockhausen I. Symp. Soc. Exp. Biol. 1989; 43: 1-26PubMed Google Scholar, 10Yamashita Y. Chung Y.S. Horie R. Kannagi R. Sowa M. J. Natl. Cancer Inst. 1995; 87: 441-446Crossref PubMed Scopus (53) Google Scholar). Glycosylation may play a role in protein stability, prevention or induction of aggregation, secretion, ligand/receptor recognition and binding affinity, activity, protease and heat resistance, and cell-cell interactions, among others (11Dwek R.A. Biochem. Soc. Trans. 1996; 23: 1-25Crossref Scopus (161) Google Scholar, 12Elbein A.D. Annu. Rev. Biochem. 1987; 56: 497-534Crossref PubMed Google Scholar, 13Olden K. Parent J.B. White S.L. Biochim. Biophys. Acta. 1982; 650: 209-232Crossref PubMed Scopus (352) Google Scholar, 14Van den Steen P. Rudd P.M. Dwek R.A. Opdenakker G. Crit. Rev. Biochem. Mol. Biol. 1998; 33: 151-208Crossref PubMed Scopus (635) Google Scholar). In particular, the carbohydrate present in the Fc of IgG has been shown to be important for effective activation of the complement cascade and recognition by Fc receptors (15Jefferis R. Lund J. Goodall M. Immunol. Lett. 1995; 44: 111-117Crossref PubMed Scopus (37) Google Scholar, 16Radaev S. Sun P.D. J. Biol. Chem. 2001; 276: 16478-16483Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar, 17Wright A. Morrison S.L. J. Exp. Med. 1994; 180: 1087-1096Crossref PubMed Scopus (167) Google Scholar). Earlier reports have shown that N-linked carbohydrates may be necessary for assembly and secretion of IgA and IgD antibodies. Although murine IgA1 was not secreted when the glycosylation sites were removed by site-directed mutagenesis (18Taylor A.K. Wall R. Mol. Cell. Biol. 1988; 8: 4197-4203Crossref PubMed Scopus (60) Google Scholar), the assembly and secretion of murine-human chimeric IgA1 was unaffected by removal of glycosylation sites (19Chuang P.D. Morrison S.L. J. Immunol. 1997; 158: 724-732PubMed Google Scholar). Human IgD bears three addition sites, Asn-354, Asn-445, and Asn-496 (20Takahashi N. Tetaert D. Debuire B. Lin L.C. Putnam F.W. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 2850-2854Crossref PubMed Scopus (41) Google Scholar). Murine-human chimeric IgD was not secreted from a transfectant myeloma cell line when produced in the presence of tunicamycin (Tm), an inhibitor of N-linked glycosylation. IgD lacking N-linked glycans was assembled into HL half-molecules rather than fully formed H2L2 antibodies (21Shin S.U. Wei C.F. Amin A.R. Thorbecke G.J. Morrison S.L. Hum. Antibodies. 1992; 3: 65-74Crossref Scopus (10) Google Scholar), and these remained within the cell. Although this study did not identify the role of individual carbohydrate molecules, it was hypothesized that the glycan at Asn-354 may be critical for the proper conformation of the hinge region in which a single disulfide bond links the two heavy chains at Cys-290. In the absence of this glycan the conformation may have been altered, blocking assembly and resulting in retention in the secretory pathway. We have now investigated the role of each N-linked glycan in IgD assembly and secretion using Chinese Hamster Ovary (CHO) cell lines producing IgD proteins mutated to lack a single addition site, two sites, or all three. We found that the presence of carbohydrate at Asn-354, but not at Asn-445 or Asn-496, was required for IgD assembly and secretion. Using immunofluorescent staining and confocal microscopy, the heavy chains from an N354Q IgD mutant were found to remain in the ER and not to traffic to the Golgi apparatus. The carbohydrate at Asn-354 remained high mannose and could not be bound effectively by lectin-coated Sepharose resin, suggesting that it was buried between protein domains. Truncation of O-linked glycans in the hinge region of IgD and IgA1 using benzyl 2-acetamido-2-deoxy-α-d-galactopyranoside (BADG) (22Kuan S.F. Byrd J.C. Basbaum C. Kim Y.S. J. Biol. Chem. 1989; 264: 19271-19277Abstract Full Text PDF PubMed Google Scholar) did not inhibit secretion. The initial human IgD heavy chain gene expression vector constructed in this laboratory (21Shin S.U. Wei C.F. Amin A.R. Thorbecke G.J. Morrison S.L. Hum. Antibodies. 1992; 3: 65-74Crossref Scopus (10) Google Scholar) contained the IgD heavy chain gene in its genomic form with six exons. For the current study, a new IgD heavy chain vector was constructed in which the introns within the coding sequence of the constant region were removed using a combination of PCR and cloning. Additionally, the 5′-intron separating VH from CH1 was shortened to 223 bases. The heavy chain gene contained the murine 27.44 VH specific for the hapten dansyl (23Dangl J.L. Parks D.R. Oi V.T. Herzenberg L.A. Cytometry. 1982; 2: 395-401Crossref PubMed Scopus (98) Google Scholar) and the 3′-untranslated region from IgG3 (24Shin S.U. Friden P. Moran M. Morrison S.L. J. Biol. Chem. 1994; 269: 4979-4985Abstract Full Text PDF PubMed Google Scholar), and the gene was inserted as an EcoRV-BamHI fragment into the multiple cloning site of the expression vector pcDNA3.1(−) (Invitrogen). IgD mutants lacking N-linked glycosylation sites were made using nested PCR to produce point mutations in the Asn codons. Primers encoded an Asn → Gln substitution in all three cases plus aXhoI site near the substitutions at Asn-354 and Asn-445. Primer sets were designed as listed below. Asn-354AccI-HindIII cassette: primer 1, 5′-CTTGGC(GTCTAC)CTGCTAACCC-3′ and primer 2, 5′-GCC CTG GCTGTGCCG(CTCGAG)C-3′; primer 3, 5′-G(CTCGAG)CGGCACAGC CAG GGC-3′ and primer 4, 5′-CAGGTTCAGGGA(AAGCTT)GACG-3′. Asn-445HindIII-PmlI cassette: primer 5, 5′-GCACCCGTC(AAGCTT)TCCCTG-3′ and primer 6, 5′-GAAGT CTG CACCTCACGCTGGTC(CTCGAG)C-3′; primer 7, 5′-G(CTCGAG)GACCAGCGTGAGGTG CAG ACTTC-3′and primer 8, 5′-GGCA(CACGTG)TAGGTGGCTGG-3′. Asn-496PmlI-EcoRI cassette: primer 9, 5′-CCTA(CACGTG)TGTGGTCAGCACGAGGACTCCCGGACTCTGCTC CAG GCCAG-3′ and primer 10, 5′-GCAGTCGC(GAATTC)TCATTTCATGGGGCCATGGTCTGTTACATAGCTGACTTCTAGGCTCCGG-3′. Restriction enzyme sites are in parentheses, substituted bases are in boldface type, and Asn → Gln is underlined. PCR products were cloned into the TA Cloning Vector (Invitrogen) and analyzed by restriction enzyme digests. Selected products were then sequenced using reagents and directions by PerkinElmer Life Sciences and the ABI Prism method. Data were collected at the UCLA Core Facility or at Laragen, Inc. (Los Angeles, CA). Mutant cassettes were reconstituted into the complete IgD heavy chain gene, generating sequences lacking one, two, or three carbohydrate addition sites. Transfection of CHO cells was performed using Lipofectin reagent (Invitrogen). Cells first were transfected with a murine-human chimeric anti-dansyl κ chain expression vector described previously (17Wright A. Morrison S.L. J. Exp. Med. 1994; 180: 1087-1096Crossref PubMed Scopus (167) Google Scholar), generating a light chain producer. The anti-dansyl heavy chain constructs then were transfected into the light chain producer as described previously (17Wright A. Morrison S.L. J. Exp. Med. 1994; 180: 1087-1096Crossref PubMed Scopus (167) Google Scholar), with 10 μg of uncut H chain vector per Petri dish containing ∼5 × 106 adherent cells. After transfection, the cells were plated into six 96-well plates in 125 μl/well of Iscove's modified Dulbecco's medium with 10% fetal bovine serum and either 0.5 mm histidinol for selection on the light chain vector or 0.5 mg/ml zeocin (Invitrogen) for selection on the heavy chain vector. Culture supernatants from surviving clones were screened subsequently by enzyme-linked immunosorbent assay using either goat anti-human κ-coated or dansyl-BSA-coated plates followed by goat anti-human κ antibody conjugated with alkaline phosphatase (Sigma). Selected cell populations were subcloned by limiting dilution, and the clone producing the highest amount of IgD was selected by enzyme-linked immunosorbent assay. For biosynthetic labeling, cells were washed with phosphate-buffered saline and incubated either 3–4 h or overnight in Dulbecco's modified Eagle's medium deficient in methionine, cysteine, and glutamine (Invitrogen) supplemented with 1 μl/ml [35S]methionine/[35S]cysteine Easytag mix (Amersham Biosciences) and 1× GlutaMax glutamine analog (Invitrogen). For overnight labels 1–2 × 106 cells were used, and for shorter incubations 5 × 106 cells were used. Coincident labeling and Tm treatment were performed by preincubating cells with 8 μg/ml Tm for 3 h and then washing and incubating overnight in labeling medium supplemented with 8 μg/ml Tm. Following labeling, supernatants were collected, cytoplasmic lysates were prepared, and these were immunoprecipitated as described previously (25Shin S.U. Morrison S.L. Methods Enzymol. 1989; 178: 459-476Crossref PubMed Scopus (82) Google Scholar) using goat anti-human IgD (Sigma) and rabbit anti-human Fab followed by rabbit anti-goat IgG (Sigma). Samples were analyzed by SDS-PAGE under non-reducing conditions using 5% phosphate gels or under reducing conditions, as described (25Shin S.U. Morrison S.L. Methods Enzymol. 1989; 178: 459-476Crossref PubMed Scopus (82) Google Scholar), using 8 or 12.5% Tris-glycine gels. To inhibit complete O-linked glycosylation in transfectant cells, 5 mm BADG (Sigma) was added to culture medium. Proteins containing complete O-linked carbohydrates were precipitated from unlabeled cell supernatants and cytoplasmic lysates using jacalin-coated agarose beads (Vector Laboratories, Burlingame, CA). Following this, the remaining immunoglobulins with truncated O-glycans containing only GalNAc were immunoprecipitated with 40–60 μl of Sepharose 4B coated with dansyl-BSA (Amersham Biosciences). Agarose beads were washed and eluted using the immunoprecipitation protocol above. Sepharose beads were washed three times with phosphate-buffered saline, pH 7.8, and eluted by incubating with 40–60 μl of 3 mm dansyl-lysine on ice followed by centrifugation. Samples were analyzed by SDS-PAGE, as described above, with the position of the proteins determined by Western blot (see below). Endoglycosidase H (Endo H) treatment of antibody samples was performed as described previously (26Coloma M.J. Trinh R.K. Martinez A.R. Morrison S.L. J. Immunol. 1999; 162: 2162-2170PubMed Google Scholar). Briefly, immunoprecipitates from the supernatants of ∼2 × 106 cells were resuspended in 100 μl of Endo H Reaction Buffer (50 mm sodium citrate, pH 5.5, 2 mmphenylmethanesulfonyl fluoride, and 100 mmβ-mercaptoethanol (β-Me)). 25 μl of each sample was incubated overnight at 37 °C with or without 6–9 units of Endo H (Roche Molecular Biochemicals). 5× sample buffer (125 mm Tris, pH 6.7, 1.5% SDS, 50% glycerol, and 20 μg/50 ml bromphenol blue) was added to each tube, and samples were heated in a boiling waterbath for 3 min to elute labeled molecules prior to analysis on a 12.5% Tris-glycine gel. 5–10 × 106 transfectant cells were biosynthetically labeled overnight, supernatants were collected, and concanavalin A (ConA)-Sepharose (Sigma) binding was performed as described previously (27Wright A. Tao M.H. Kabat E.A. Morrison S.L. EMBO J. 1991; 10: 2717-2723Crossref PubMed Scopus (135) Google Scholar). After the resin was removed by centrifugation, the supernatants were immunoprecipitated with anti-IgG or anti-IgD as described above. Antibodies eluted from the resin with 0.5 m methyl α-d-mannopyranoside also were immunoprecipitated with anti-IgG or anti-IgD. Immunoprecipitated antibodies from the original supernatants and from the ConA-Sepharose eluates were analyzed by SDS-PAGE under reducing conditions as described above. Antibodies in sample buffer containing β-Me were run on 8% Tris-glycine gels and transferred to polyvinylidene difluoride membranes (Immobilon-P®, Millipore Corp., Bedford, MA). Membranes were blocked with 5% nonfat dry milk in buffer containing 100 mm Tris, pH 8.0, 150 mm NaCl, and 0.1% Tween 20 and then probed with goat anti-human IgD or rabbit anti-human IgA (Sigma) followed by horseradish peroxidase (HRP)-conjugated rabbit anti-goat IgG (Sigma) or HRP-conjugated donkey anti-rabbit IgG (Promega, Madison, WI), respectively. All bands were visualized using Super Signal chemiluminescent substrate (Pierce) and Hyperfilm MP (Amersham Biosciences). Wells of 8-chamber Permanox slides (Nalge Nunc, Naperville, IL) were seeded with CHO transfectant cells in Iscove's modified Dulbecco's medium + 5% fetal bovine serum and incubated overnight. Cells were gently washed twice with phosphate-buffered saline and fixed in a freshly prepared solution of 0.01 m sodium metaperiodate, 0.075m lysine, 0.0375 mNaH2PO4, pH 7.4, and 2% paraformaldehyde for 2–3 h at room temperature. Wells were rinsed three times with a solution of 0.5% ovalbumin (Sigma) in phosphate-buffered saline, pH 7.4 (Buffer A), for 10 min. Cells were permeabilized by a 5-min incubation with Buffer B (Buffer A containing 0.05% saponin (Sigma)) at room temperature. Primary antibodies were diluted in Buffer B and added to relevant wells, and slides were incubated with shaking overnight at 4 °C. Primary antibodies used were goat anti-human IgD, diluted to 1/75; rabbit anti-MERG (major ER glycoprotein, a generous gift from Dr. D. Meyer), diluted to 1/30; and rabbit anti-Golgi β-coatomer protein (Affinity Bioreagents, Golden, CO), diluted to 1/75. Cells were then washed in Buffer B three times, and secondary antibody was added. Secondary antibodies (Texas Red-conjugated swine anti-goat IgG (EY Laboratories, San Mateo, CA) and FITC-conjugated swine anti-rabbit IgG (Nordic Immunology, Tilburg, The Netherlands)) were diluted 1/25 and 1/100, respectively, in Buffer B. Prior to adding diluted secondary antibodies to wells, the solutions were centrifuged to remove any antibody aggregates, which bind to cells directly and increase background fluorescence. Secondary antibody staining was performed at room temperature for 1 h, and the cells were washed. Chambers were then removed from each slide, and a drop of Prolong (Molecular Probes, Eugene, OR) was laid over each group of cells to reduce quenching of dyes followed by a coverslip, which was sealed to the slide. The heavy chain gene used for the expression of murine-human chimeric anti-dansyl IgD is shown in Fig. 1. The gene has a shortened intron separating VH and CH1 and no introns within the constant region. The 3′-untranslated region was derived from IgG3, an antibody produced at high levels in transfectants. Mutant IgD molecules were generated using nested PCR with the heavy chain gene template. Glutamine was substituted for asparagine in each N-glycan addition sequence. Three cassettes, each encompassing a portion of IgD with a mutated addition site, were used to replace wild type sequences, yielding IgD genes with one, two, or all three glycosylation sites mutated. To determine the contribution of each of the individualN-linked glycans on IgD to its assembly and secretion, we analyzed wild type IgD and mutants missing glycosylation sites at residues 354, 445, or 496 and combinations thereof. Transfectants expressing wild type or mutant IgD were biosynthetically labeled for 3–4 h, cytoplasmic lysates were prepared, and IgD was immunoprecipitated. Analysis of non-reduced samples by SDS-PAGE (Fig.2 A) showed that all antibodies assembled into HL half-molecules but that only those with heavy chains bearing carbohydrate at site 354 assembled into H2L2 antibodies (lanes 2,4, 5, and 7). Analysis of IgD immunoprecipitated from cell supernatants following overnight labeling showed that only antibodies with asparagine at site 354 of the H chain were secreted as H2L2 species (Fig.2 B). Small amounts of HL half-molecules also were present in secretions along with free light chain and light chain dimers. Unexpectedly, we also observed that all heavy chains with carbohydrate at Asn-445 exist as two glycoforms (Fig. 2 C), suggesting that the site at 445 is variably glycosylated. The observed band pattern consistent with variable glycosylation of Asn-445 is diagrammed in Fig. 2 D. Immunofluorescent staining was used to determine the intracellular localization of non-secreted IgD HL half-molecules (Fig. 3). Cells fixed to slides were permeabilized with saponin and probed with goat anti-IgD and rabbit antiserum specific for an ER major glycoprotein or the Golgi β-coatomer protein and then stained with either Texas Red-conjugated swine anti-goat or FITC-conjugated swine anti-rabbit secondary antibodies. Comparison of the transfectant stably expressing wild type IgD with that expressing the N354Q heavy chain mutant showed that wild type IgD heavy chain is found in both the ER (panel C) and the Golgi apparatus (panel F), whereas the mutant is found in the ER (panel I), but not in the Golgi apparatus (panel L). Thus, it appears that the heavy chain lacking the hinge-proximal glycan can assemble into HL half-molecules, but these are retained in the ER and do not proceed any further along the secretory pathway. It has been reported that the carbohydrate at Asn-354 is high mannose in wild type IgD (28Mellis S.J. Baenziger J.U. J. Biol. Chem. 1983; 258: 11546-11556Abstract Full Text PDF PubMed Google Scholar). To determine whether the Asn-354 oligosaccharide processing was also minimal when other heavy chain glycans were absent, cells synthesizing wild type IgD or mutant IgD containing carbohydrate at Asn-354 were biosynthetically labeled. The secreted IgD was immunoprecipitated and digested with Endo H. We observed that all were Endo H-sensitive (Fig.4). Therefore, the glycan at Asn-354 remains high mannose in antibodies with glycans missing at sites 445, 496, or both as well as in the wild type. The glycan at site 445 appears to remain complex when its neighbor at site 496 is missing, as there are two glycoforms following digestion with Endo H (lane 6), one representing H chains with no carbohydrate and one with complex carbohydrate at Asn-445. Similarly, the carbohydrate attached to Asn-496 remains complex when the glycan at 445 is missing because the single heavy chain band (lane 4) is larger than the lower bands (lanes 6 and 8), which represent heavy chains missing all N-glycans. After demonstrating that the carbohydrate attached to Asn-354 was necessary for proper assembly of IgD, we used ConA to investigate whether that carbohydrate is sequestered within the folded protein. ConA is a lectin that preferentially binds high mannose sugars but also recognizes complex, bi-antennary oligosaccharides (29Brewer C.F. Bhattacharyya L. J. Biol. Chem. 1986; 261: 7306-7310Abstract Full Text PDF PubMed Google Scholar). ConA-Sepharose effectively precipitated antibody bearing high mannose carbohydrate in the V region (Fig. 5,lanes 3 and 4) but not IgA1 lackingN-linked carbohydrates (lanes 1 and2), although the presence of a small amount of protein inlane 1 indicated that ConA-Sepharose beads bound some IgA1 non-specifically. Wild type IgD, which bears Asn-354 high mannose glycan and two complex glycans as well, was bound by the ConA-Sepharose (lanes 5 and 6). However, the IgD mutant with only the Asn-354 high mannose carbohydrate failed to be effectively and specifically bound by ConA-Sepharose (lanes 7 and8). This suggested that the carbohydrate at site 354 is buried within the folded antibody and is not available on the surface for binding by the lectin. To determine whether the O-linked glycans that are attached to the hinge region of IgD and IgA1 are necessary for antibody secretion, transfectants producing each isotype were grown in the presence of BADG, an inhibitor of full-length O-glycosylation. Supernatants were collected and cytoplasmic lysates prepared after overnight incubation with or without the drug. Sequential precipitations were performed with each sample, first with jacalin-coated agarose to bind antibodies containing complete O-glycans, followed by Sepharose 4B coated with dansyl-BSA, for which the antibody variable region is specific. Precipitated proteins were reduced, separated by SDS-PAGE, and transferred to membranes that were probed with anti-IgA (Fig.6 A) or anti-IgD (Fig.6 B). Wild type IgA1 binds to jacalin (Fig. 6 A,lane 1), whereas IgA1 with truncated O-glycans does not (lane 2). Although IgA1 lacking completeO-glycans was not bound by jacalin-agarose, it was indeed present in the supernatant and bound to dansyl-BSA Sepharose (lane 4). Under the conditions of the experiment, jacalin-agarose did not remove all antibodies from the supernatant of untreated IgA1 transfectants (lane 3). However, in a subsequent experiment involving three sequential precipitations of supernatant containing wild type IgA1 with jacalin-agarose resin, no IgA1 remained after the second precipitation (data not shown). Therefore, it appeared that all of the IgA1 synthesized by cells not treated with BADG was O-glycosylated. Similar results were obtained for IgD (Fig. 6 B). However, jacalin-agarose bound less than half of the total IgD-bearingO-glycans (lanes 1 and 3). Sequential precipitations with jacalin-agarose, in an experiment like that described above, showed that no IgD remained after the second precipitation, indicating that all wild type IgD was indeedO-glycosylated (data not shown). Interestingly, a comparison of the ratio of the signal seen in lanes 3 and 7with those in lanes 4 and 8 suggests that less IgD was secreted in the presence of BADG. Therefore, although theO-linked carbohydrates in the hinge of IgD may not be absolutely required, they may facilitate its assembly and secretion. Analysis of cell lysates shows little or noO-glycosylated IgA1 or IgD present prior to secretion (Fig. 6, A and B, lanes 5), consistent with O-glycosylation taking place in the Golgi apparatus. Also, two N-linked glycoforms are visible for IgA1. We occasionally observed variable processing of the N-linked carbohydrates on the heavy chain from this transfectant. Analysis of the intracellular assembly of IgA1 and IgD showed that it was not affected by the presence or absence of complete O-glycans (data not shown). To further analyze the role of glycosylation in IgA1 secretion, cells were biosynthetically labeled overnight with BADG and/or Tm added to the medium. IgA1 lacking complete O-linked sugars,N-linked sugars, or both is secreted (Fig. 6 C). The thin non-specific band migrating below IgA1 (lanes 1 and 2) and above IgA1 (lanes 3 and4) serves as a marker to discern the small differences in size between each IgA1 glycoform. The apparent molecular weight of the IgA1 heavy chain is largest in lane 1 with a reduction in size observed in successive lanes, representing truncation ofO-linked glycans (lane 2), loss ofN-linked glycans (lane 3), or both (lane 4). In cell lysates, no change in apparent molecular weight is observed when O-glycosylation is altered, consistent with its being a late event occurring just prior to secretion. Similar analysis of a wild type IgD transfectant showed that antibodies produced in cells treated with BADG and lacking completeO-glycans were secreted, whereas no IgD was secreted in the presence of tunicamycin, as expected (data not shown). Previously we observed that in transfectants expressing murine-human chimeric IgD, treatment with Tm halted assembly of antibodies at the HL half-molecule stage, and IgD was not secreted. Tm inhibits all N-linked glycosylation in the cell and prevents carbohydrate addition to all three sites in IgD (30Kuo S.C. Lampen J.O. Biochem. Biophys. Res. Commun. 1974; 58: 287-295Crossref PubMed Scopus (191) Google Scholar). Therefore, the earlier study cou
Referência(s)