Portal de Periódicos da CAPES

Familial Primary Pulmonary Hypertension (Gene PPH1) Is Caused by Mutations in the Bone Morphogenetic Protein Receptor–II Gene

2000; Elsevier BV; Volume: 67; Issue: 3 Linguagem: Inglês

10.1086/303059

1537-6605

Zemin Deng, Jane H. Morse, Susan L. Slager, Nieves Cuervo, Keith J. Moore, George Venetos, Sergey Kalachikov, Eftìhia Cayanis, Stuart G. Fischer, Robyn J. Barst, Susan E. Hodge, James A. Knowles,

Medical Imaging and Pathology Studies

Familial primary pulmonary hypertension is a rare autosomal dominant disorder that has reduced penetrance and that has been mapped to a 3-cM region on chromosome 2q33 (locus PPH1). The phenotype is characterized by monoclonal plexiform lesions of proliferating endothelial cells in pulmonary arterioles. These lesions lead to elevated pulmonary-artery pressures, right-ventricular failure, and death. Although primary pulmonary hypertension is rare, cases secondary to known etiologies are more common and include those associated with the appetite-suppressant drugs, including phentermine-fenfluramine. We genotyped 35 multiplex families with the disorder, using 27 microsatellite markers; we constructed disease haplotypes; and we looked for evidence of haplotype sharing across families, using the program TRANSMIT. Suggestive evidence of sharing was observed with markers GGAA19e07 and D2S307, and three nearby candidate genes were examined by denaturing high-performance liquid chromatography on individuals from 19 families. One of these genes (BMPR2), which encodes bone morphogenetic protein receptor type II, was found to contain five mutations that predict premature termination of the protein product and two missense mutations. These mutations were not observed in 196 control chromosomes. These findings indicate that the bone morphogenetic protein–signaling pathway is defective in patients with primary pulmonary hypertension and may implicate the pathway in the nonfamilial forms of the disease. Familial primary pulmonary hypertension is a rare autosomal dominant disorder that has reduced penetrance and that has been mapped to a 3-cM region on chromosome 2q33 (locus PPH1). The phenotype is characterized by monoclonal plexiform lesions of proliferating endothelial cells in pulmonary arterioles. These lesions lead to elevated pulmonary-artery pressures, right-ventricular failure, and death. Although primary pulmonary hypertension is rare, cases secondary to known etiologies are more common and include those associated with the appetite-suppressant drugs, including phentermine-fenfluramine. We genotyped 35 multiplex families with the disorder, using 27 microsatellite markers; we constructed disease haplotypes; and we looked for evidence of haplotype sharing across families, using the program TRANSMIT. Suggestive evidence of sharing was observed with markers GGAA19e07 and D2S307, and three nearby candidate genes were examined by denaturing high-performance liquid chromatography on individuals from 19 families. One of these genes (BMPR2), which encodes bone morphogenetic protein receptor type II, was found to contain five mutations that predict premature termination of the protein product and two missense mutations. These mutations were not observed in 196 control chromosomes. These findings indicate that the bone morphogenetic protein–signaling pathway is defective in patients with primary pulmonary hypertension and may implicate the pathway in the nonfamilial forms of the disease. Familial primary pulmonary hypertension (PPH [MIM 178600]) is a rare (1/105–1/106) autosomal dominant disorder that has reduced penetrance and that has been mapped to a 3-cM region on chromosome 2q33 (locus PPH1) (Morse et al. Morse et al., 1996Morse JH Jones A DiBenedetto A Hodge SE Nygaard TG Genetic mapping of primary pulmonary hypertension: evidence for linkage to chromosome 2 in a large family.Circulation. 1996; 94: 1-46Crossref PubMed Scopus (15) Google Scholar, Morse et al., 1997Morse JH Jones AC Barst RJ Hodge SE Wilhelmsen KC Nygaard TG Mapping of familial primary pulmonary hypertension locus (PPH1) to chromosome 2q31-q32.Circulation. 1997; 95: 2603-2606Crossref PubMed Scopus (141) Google Scholar; Nichols et al. Nichols et al., 1997Nichols WC Koller DL Slovis B Foroud T Terry VH Arnold ND Siemieniak DR Wheeler L Phillips JA Newman JH Conneally PM Ginsburg D Loyd JE Localization of the gene for familial primary pulmonary hypertension to chromosome 2q31-32.Nat Genet. 1997; 15: 277-280Crossref PubMed Scopus (228) Google Scholar; Deng et al. Deng et al., 2000Deng Z Haghighi F Helleby L Vanterpool K Horn EM Barst RJ Hodge SE Morse JH Knowles JA Fine mapping of PPH1, a gene for familial primary pulmonary hypertension, to a 3-cM region on chromosome 2q33.Am J Respir Crit Care Med. 2000; 161: 1055-1059Crossref PubMed Scopus (75) Google Scholar). It is characterized by monoclonal plexiform lesions of proliferating endothelial cells in pulmonary arterioles (Lee et al. Lee et al., 1998Lee SD Shroyer KR Markham NE Cool CD Voelkel NF Tuder RM Monoclonal endothelial cell proliferation is present in primary but not secondary pulmonary hypertension.J Clin Invest. 1998; 101: 927-934Crossref PubMed Scopus (347) Google Scholar). These lesions lead to elevated pulmonary-artery pressures, right-ventricular failure, and death (Rich et al. Rich et al., 1987Rich S Dantzker DR Ayres SM Bergofsky EH Brundage BH Detre KM Fishman AP Goldring RM Groves BM Koerner SK Primary pulmonary hypertension: a national prospective study.Ann Intern Med. 1987; 107: 216-223Crossref PubMed Scopus (1650) Google Scholar). The disease can occur from infancy throughout life; it has a mean age at onset of 36 years, and the ratio of affected females to affected males is 2:1. Without intervention, the median survival is 460 bp)GCT Ggtgagtagctccggc..1 (>30 kb)..tttcctttattttagCT TCGAla Ala Ser2 (171 bp)CAA Ggcaagtgatactttc..2 (∼2.3 kb)..catattgatttatagGA TATGln Gly Cys3 (171 bp)CTC Agtaagtaaagtaacc..3 (>30 kb)..tttgttttcttttagGT CCALeu Ser Pro4 (111 bp)ACA Ggtaaaaattaccatt..4 (∼3.8 kb)..ttcctgttcttatagGA GACThr Gly Asp5 (92 bp)TTG GAGgtaagtttgccgtta..5 (∼6 kb)..ttaaaacacttgcagCTG ATTLeu GluLeu Ile6 (231 bp)CCC AATgtaagttcttcatag..6 (∼4.1 kb)..ttttcctctatatagGGA TCTPro AsnGly Ser7 (115 bp)GGA Ggtaagatagtcaata..7 (∼7.9 kb)..aaattatccaaacagAT CATGly Asp His8 (161 bp)AGC GAGgtgagtgtatacaaa..8 (∼1.6 kb)..actctaatttatcagGTT GGCSer GluVal Gly9 (148 bp)CCA Ggtaaaaactactgtc..9 (>9.7 kb)..tctacaaatccacagGG GAAPro Gly Glu10 (137 bp)AGC CTGgtaagaaaaaactaa..10 (>5 kb)..tactttgtcttacagGCA GTGSer LeuAla Val11 (173 bp)GAA CGgtaagaccctaaggg..11 (>20 kb)..ctttctttctttaagC AACGlu Arg Asn12 (1,280 bp)CAG Agtaagtggagggatc..12 (∼3.2 kb)..cacttttattttcagTA GGTGln Ile Gly13 (>251 bp) Open table in a new tab Table 2Oligonucleotide Primer Sequences Used to Screen BMPR2PrimeraExonic DNA sequences are underlined.Exon5′3′Size of PCR Product (bp)1AACTAGTTCTGACCCTCGCCCCGGACGCATGGCGAAGGGCAA6022bAmplified by primers within the exon.TAGCTTCGCAGAATCAAGAATGCCTTGTTTTACAAGATTT1773bAmplified by primers within the exon.TAGGATGTTGGTCTCACATTTACTGAGTGGTGTTGTGTCA1774bAmplified by primers within the exon.TAGGTCCACCTCATTCATTTTACCTGTCAACATTCTGTAT1175bAmplified by primers within the exon.TAGGAGACCGTAAACAAGGTTACCTCCAACAGTTTCAGAT986bAmplified by primers within the exon.CAGCTGATTGGCCGAGGTCGTACATTGGGATAGTACTCCA2377bAmplified by primers within the exon.TAGGGATCTTTATGCAAGTATACCTCCTCGTGGTAATTCT1218GCAGAAAAATAATACTACTTCTATAGATGTTTTAATTAAATTATCATTTC3199AGAATATGCTACGTTCTCTCACACTAGATAGCAATGAACTAAAGG33610GTATCAGAAATACCCCTGTTTTAGGCAACTCCAAAAACTAT32811GGTAAACTGAAAAGCTCAATACCATTGAACTATTAGGCTGGT34512-1GATCCCCTTTCTTTCTTTAAGCCTGTTTAAGAGAGTGCTCCATG51012-2GAACCTCAAGGAAAGCTCTGAGCATGGGAGTTAACACTGT43612-3ACCTCATGTGGTGACAGTCAATTGGAATTAGTTCGGCCAC31612-4ATTCCAGTCCTGATGAGCATAGTTATTTAAATGGCCCCAA34313TTACATCCCTTACCCGTTATTTAAAGCAAGTCTTTGTTGC454a Exonic DNA sequences are underlined.b Amplified by primers within the exon. Open table in a new tab In 9 of the 19 families screened, we observed mutations that are likely to disrupt the function of the receptor. Five of these mutations predict premature termination of BMPR-II, in exons 4, 6, 8, and 12, and each was seen in only one family (fig. 1 and table 3). In addition, in exon 11 in three families, an SNP that causes a nonconservative change in amino acid sequence—that is, from arginine, conserved in all known type II TGF-β–superfamily receptors (fig. 2), to tryptophan—was seen (fig. 1 and table 3). These three families do not share a microsatellite marker haplotype. The same arginine was changed to glutamine (1472G→A) in the proband of another family, PPH019 (fig. 1 and table 3), but this proband's parents are genotypically normal. This proband (from whom we have a DNA sample) had both a son who died of PPH in childhood (presumptive; no postmortem was performed) and a deceased uncle with a history of portal hypertension and unspecified cardiac problems. Since the 1472G→A mutation had not been transmitted through either parent, more history on the “affected” uncle was obtained, and he was found to have longstanding alcoholism—and we think that this, rather than right-sided heart failure secondary to PPH, was responsible for his portal hypertension. The observation of this new mutation suggests that mutations in BMPR2 might also cause sporadic cases of PPH.Table 3BMPR2 Mutations Observed in PPHFamily or FamiliesNo. of A/C/UaNo. of DNA samples available for analysis of affected (A), known carrier (C), and unaffected (U) individuals in each family or set of families, determined by segregation pattern and DNA sequencing/dHPLC, except in the case of family PPH019 (in which only DNA sequencing was used; see text).ExonDNA Sequence VariationbSequences are referenced to GenBank BMPR2 cDNA sequence number NM_001204 (see NCBI GenBank Overview); the numbering is based on the use of “+1” to denote the A of the starting methionine codon.Protein Sequence VariationPPH001, PPH008, PPH0214/5/13111471C→TR491WPPH0102/0/181099–1103delGGGGAE368fsX1PPH0156/1/8122579delTN861fsX10PPH0173/0/64507–510delCTTTinsAAAC169XPPH0183/2/4122617C→TR873XPPH0191/0/5111472G→AR491QPPH0222/0/06690–691delAGinsTK230fsX21a No. of DNA samples available for analysis of affected (A), known carrier (C), and unaffected (U) individuals in each family or set of families, determined by segregation pattern and DNA sequencing/dHPLC, except in the case of family PPH019 (in which only DNA sequencing was used; see text).b Sequences are referenced to GenBank BMPR2 cDNA sequence number NM_001204 (see NCBI GenBank Overview); the numbering is based on the use of “+1” to denote the A of the starting methionine codon. Open table in a new tab Except for family PPH019 (see above), the pattern of mutations observed when all additional members of the other eight families were screened by dHPLC and DNA sequencing was identical to the segregation pattern of PPH. None of the putative mutations were observed in 96 additional samples (a total of 196 chromosomes total, including 4 from the screening). In both samples, we also observed a synonymous SNP (2811G→A) with a minor-allele frequency of .21. Since the nine mutations appeared to be functional, and since no such mutations were observed in the controls, we applied Fisher's exact test to the data, and we observed a significant difference (P<.0001), in mutation prevalence, between cases and controls. The mutation in exon 4 is in the transmembrane domain, and those in exons 6, 8, and 11 are in the kinase domain, of this serine/threonine kinase receptor (fig. 1). In functional studies of the homologous TGF-β receptor type II (TβR-II), cell lines lacking endogenous TβR-II were transfected with TβR-II constructs lacking either the complete kinase domain or amino acids 490–508 (homologous to amino acids 452–471 in BPMR-II) (Wieser et al. Wieser et al., 1993Wieser R Attisano L Wrana JL Massague J Signaling activity of transforming growth factor beta type II receptors lacking specific domains in the cytoplasmic region.Mol Cell Biol. 1993; 13: 7239-7247Crossref PubMed Google Scholar). These constructs were unable to restore the ability to inhibit growth, stimulate fibronectin production, and drive transcription from a TGF-β–responsive element, in response to exogenous TGF-β that was observed when the cell lines were transfected with the wild-type TβR-II (Wieser et al. Wieser et al., 1993Wieser R Attisano L Wrana JL Massague J Signaling activity of transforming growth factor beta type II receptors lacking specific domains in the cytoplasmic region.Mol Cell Biol. 1993; 13: 7239-7247Crossref PubMed Google Scholar). Furthermore, the construct lacking amino acids 490–508 was unable to function as a kinase in vitro (Wieser et al. Wieser et al., 1993Wieser R Attisano L Wrana JL Massague J Signaling activity of transforming growth factor beta type II receptors lacking specific domains in the cytoplasmic region.Mol Cell Biol. 1993; 13: 7239-7247Crossref PubMed Google Scholar). Therefore, at least three of these mutations (premature terminations in exons 4, 6, and 8) should encode a nonfunctional receptor that is unable both to phosphorylate a type I receptor and to propagate the signal from a BMP ligand, since they will lack this region of the kinase domain. The lack of kinase activity would be consistent with a disease model of haploinsufficiency. Alternatively, the prematurely terminated products could act as a dominant negatives, as has been observed for TβR-II (Wieser et al. Wieser et al., 1993Wieser R Attisano L Wrana JL Massague J Signaling activity of transforming growth factor beta type II receptors lacking specific domains in the cytoplasmic region.Mol Cell Biol. 1993; 13: 7239-7247Crossref PubMed Google Scholar) and endoglin (Lux et al. Lux et al., 2000Lux A Gallione CJ Marchuk DA Expression analysis of endoglin missense and truncation mutations: insights into protein structure and disease mechanisms.Hum Mol Genet. 2000; 9: 745-755Crossref PubMed Scopus (58) Google Scholar). Given that BMPR-II is likely to be present, on the cell surface, as a dimer (Gilboa et al. Gilboa et al., 2000Gilboa L Nohe A Geissendorfer T Sebald W Henis YI Knaus P Bone morphogenetic protein receptor complexes on the surface of live cells: a new oligomerization mode for serine/threonine kinase receptors.Mol Biol Cell. 2000; 11: 1023-1035Crossref PubMed Scopus (243) Google Scholar), only 25% of such complexes might be functional. The two mutations in exon 11 change Arg491. This arginine is highly conserved in all type II TGF-β–superfamily receptors (fig. 2) and appears to be homologous to the invariant Arg280 in subdomain XI in other protein kinases (Hanks et al. Hanks et al., 1988Hanks SK Quinn AM Hunter T The protein kinase family: conserved features and deduced phylogeny of the catalytic domains.Science. 1988; 241: 42-52Crossref PubMed Scopus (3720) Google Scholar). Mutation of the homologous amino acid in transfected TβR-II (R582A) greatly reduces the ability of exogenous TGF-β to stimulate transcription of a TGF-β–responsive element in TβR-II–deficient cells (Brand and Schneider Brand and Schneider, 1995Brand T Schneider MD Inactive type II and type I receptors for TGF beta are dominant inhibitors of TGF beta-dependent transcription.J Biol Chem. 1995; 270: 8274-8284Crossref PubMed Scopus (54) Google Scholar). Last, arginine is the amino acid that is most frequently changed in disease mutations (see the “Statistics for Missense/Nonsense Mutations” Web page of the Institute of Medical Genetics, University of Wales College of Medicine, Cardiff). Taken together, these results strongly suggest that Arg491 is important to the function of BMPR-II. The mutations in exon 12 occur in the intracellular C-terminal domain, of unknown function, that is unique to BMPR-II. Possible functions for this portion of the molecule include the binding of downstream effector proteins or a role in dimerization and/or trafficking. We screened 93% (2,913/3,117 bp) of the known publicly available coding sequence, the majority of the intron/exon boundaries, and 518 bp in the 5′ and 3′ UTRs of BMPR2, but we failed to find a causative mutation in 10 of the 19 families. There are several possible explanations for why this may have occurred. The causative mutations may occur in known or currently unknown coding sequences, intronic or regulatory regions of BMPR2, or other genes in the BMP-signaling pathway. Several of the linked families are large enough to produce LOD scores suggestive of linkage to 2q33 (individual LOD scores >2), indicating that we may not have screened the entire gene. It is possible that some of the families have disease mutations in the 204 bp of known exonic sequence that we missed in our screen, and we currently are rescreening exons 2–7 in the 10 families. There is also the possibility that some of the coding sequence of BMPR2 in lung tissue is currently unknown and that we therefore have not screened it. mRNA transcripts of 5, 6.5, 8, and 11.5 kb have been observed on northern blots, with the longest transcript predominating in lung tissue (Kawabata et al. Kawabata et al., 1995Kawabata M Chytil A Moses HL Cloning of a novel type II serine/threonine kinase receptor through interaction with the type I transforming growth factor-beta receptor.J Biol Chem. 1995; 270: 5625-5630Crossref PubMed Scopus (134) Google Scholar; Nohno et al. Nohno et al., 1995Nohno T Ishikawa T Saito T Hosokawa K Noji S Wolsing DH Rosenbaum JS Identification of a human type II receptor for bone morphogenetic protein-4 that forms differential heteromeric complexes with bone morphogenetic protein type I receptors.J Biol Chem. 1995; 270: 22522-22526Crossref PubMed Scopus (200) Google Scholar; Rosenzweig et al. Rosenzweig et al., 1995Rosenzweig BL Imamura T Okadome T Cox GN Yamashita H ten Dijke P Heldin CH Miyazono K Cloning and characterization of a human type II receptor for bone morphogenetic proteins.Proc Natl Acad Sci USA. 1995; 92: 7632-7636Crossref PubMed Scopus (462) Google Scholar), so we may have missed some alternatively spliced exons in our screen. We have screened only a small portion of the intronic and regulatory sequences in these families, so mutations in these regions are possible. One regulatory region that we have examined is a (GGC)8–16 trinucleotide repeat at the 5′ end of the gene, at positions −928 to −963, which we amplified by means of the oligonucleotide primers TGAGCGAATCACAACCCCCCG and GAGTTCCGTCAGGAGCCCAG. Using PCR, we have not observed evidence of either an apparent increase in homozygosity or expansion of the repeat, either of which would be consistent with the suggestion of anticipation in PPH (Loyd et al. Loyd et al., 1995Loyd JE Butler MG Foroud TM Conneally PM Phillips JA Newman JH Genetic anticipation and abnormal gender ratio at birth in familial primary pulmonary hypertension.Am J Respir Crit Care Med. 1995; 152: 93-97Crossref PubMed Scopus (195) Google Scholar); but detection of this event might require a Southern blot, and we have a limited quantity of DNA from the affected individuals (many of whom are deceased) in many of our families. Last, it is possible that the mutations in these 10 families occur in other genes in the BMP-signaling pathway. The microsatellite data are consistent—but not conclusive—with linkage to PPH1 in all 19 families, but it is possible that the families with little linkage information could have no linkage to 2q33. An analogous situation has been observed in hereditary hemorrhagic telangectasia (HHT [MIM 187300]), another autosomal dominantly inherited vascular disorder with defects in the TGF-β–signaling pathway, where mutations have been observed in two genes, endoglin (HHT1) (McAllister et al. McAllister et al., 1994McAllister KA Grogg KM Johnson DW Gallione CJ Baldwin MA Jackson CE Helmbold EA Markel DS McKinnon WC Murrell J Endoglin, a TGF-beta binding protein of endothelial cells, is the gene for hereditary haemorrhagic telangiectasia type 1.Nat Genet. 1994; 8: 345-351Crossref PubMed Scopus (1178) Google Scholar) and the type I receptor ALK1 (HHT2) (Johnson et al. Johnson et al., 1996Johnson DW Berg JN Baldwin MA Gallione CJ Marondel I Yoon SJ Stenzel TT Speer M Pericak-Vance MA Diamond A Guttmacher AE Jackson CE Attisano L Kucherlapati R Porteous ME Marchuk DA Mutations in the activin receptor-like kinase 1 gene in hereditary haemorrhagic telangiectasia type 2.Nat Genet. 1996; 13: 189-195Crossref PubMed Scopus (814) Google Scholar). So how do these mutations cause PPH? It is unlikely that they act as in a dominant-negative fashion, by inhibiting the apoptotic effect of the TGF-β pathway, because BMPR-II does not associate with type I receptors of the TGF-β family in transient-expression assays using mammalian cells (Liu et al. Liu et al., 1995Liu F Ventura F Doody J Massague J Human type II receptor for bone morphogenic proteins (BMPs): extension of the two-kinase receptor model to the BMPs.Mol Cell Biol. 1995; 15: 3479-3486Crossref PubMed Scopus (507) Google Scholar), even though this occurs in vitro (Kawabata et al. Kawabata et al., 1995Kawabata M Chytil A Moses HL Cloning of a novel type II serine/threonine kinase receptor through interaction with the type I transforming growth factor-beta receptor.J Biol Chem. 1995; 270: 5625-5630Crossref PubMed Scopus (134) Google Scholar; Liu et al. Liu et al., 1995Liu F Ventura F Doody J Massague J Human type II receptor for bone morphogenic proteins (BMPs): extension of the two-kinase receptor model to the BMPs.Mol Cell Biol. 1995; 15: 3479-3486Crossref PubMed Scopus (507) Google Scholar; Nohno et al. Nohno et al., 1995Nohno T Ishikawa T Saito T Hosokawa K Noji S Wolsing DH Rosenbaum JS Identification of a human type II receptor for bone morphogenetic protein-4 that forms differential heteromeric complexes with bone morphogenetic protein type I receptors.J Biol Chem. 1995; 270: 22522-22526Crossref PubMed Scopus (200) Google Scholar). It is also unlikely that these mutations completely abolish the BMP-signaling pathway, because mice homozygous for a mutation in the kinase domain of BMPR2 die at day 9.5, prior to gastrulation (heterozygotes are grossly normal) (Beppu et al. Beppu et al., 2000Beppu H Kawabata M Hamamoto T Chytil A Minowa O Noda T Miyazono K BMP type II receptor is required for gastrulation and early development of mouse embryos.Dev Biol. 2000; 221: 249-258Crossref PubMed Scopus (317) Google Scholar). This phenotype is very different from what we observe in PPH, and suggests that only 25%–50% of the function of the BMP pathway is required for it to perform a role in early development, given the analogy to TβR-II, which has been discussed above. The BMP pathway induces apoptosis in some cell types (Soda et al. Soda et al., 1998Soda H Raymond E Sharma S Lawrence R Cerna C Gomez L Timony GA Von Hoff DD Izbicka E Antiproliferative effects of recombinant human bone morphogenetic protein-2 on human tumor colony-forming units.Anticancer Drugs. 1998; 9: 327-331Crossref PubMed Scopus (58) Google Scholar; Kimura et al. Kimura et al., 2000Kimura N Matsuo R Shibuya H Nakashima K Taga T BMP2-induced apoptosis is mediated by activation of the TAK1-p38 kinase pathway that is negatively regulated by Smad6.J Biol Chem. 2000; 275: 17647-17652Crossref PubMed Scopus (203) Google Scholar), so a partial block of signal transmission might have a slow proliferative effect and could be caused by either dominant-negative protein interactions or reduced signal transmission due to haploinsufficiency of BMPR-II. As discussed above, both of these mechanisms have been observed with prematurely terminated protein products. Similarly, for both the missense mutations at Arg491 and the C-terminal mutations, either model is possible. In either case, both mechanisms lead to a partial block of BMP-signal transmission, which is likely to cause the development of PPH. This is similar to what has been observed for HHT (Lux et al. Lux et al., 2000Lux A Gallione CJ Marchuk DA Expression analysis of endoglin missense and truncation mutations: insights into protein structure and disease mechanisms.Hum Mol Genet. 2000; 9: 745-755Crossref PubMed Scopus (58) Google Scholar), and determination of the mechanism of the mutations at PPH1 will require study of BMPR-II expression. BMP signaling may occur through both the “Smad” (Massague Massague, 1998Massague J TGF-beta signal transduction.Annu Rev Biochem. 1998; 67: 753-791Crossref PubMed Scopus (3848) Google Scholar) and mitogen-activated protein kinase (Kimura et al. Kimura et al., 2000Kimura N Matsuo R Shibuya H Nakashima K Taga T BMP2-induced apoptosis is mediated by activation of the TAK1-p38 kinase pathway that is negatively regulated by Smad6.J Biol Chem. 2000; 275: 17647-17652Crossref PubMed Scopus (203) Google Scholar) cascades, and both are inhibited by Smad6, which can be induced by vascular shear stress (Topper et al. Topper et al., 1997Topper JN Cai J Qiu Y Anderson KR Xu YY Deeds JD Feeley R Gimeno CJ Woolf EA Tayber O Mays GG Sampson BA Schoen FJ Gimbrone Jr, MA Falb D Vascular MADs: two novel MAD-related genes selectively inducible by flow in human vascular endothelium.Proc Natl Acad Sci USA. 1997; 94: 9314-9319Crossref PubMed Scopus (284) Google Scholar). Either (a) the reduced apoptotic signals from the BMP pathway, caused by mutations in either BMPR2 or other molecules in the signaling cascades, or (b) shear stress via Smad6, possibly after an initial nidus of vascular injury, might underlie many forms of PPH, including those associated with HIV or appetite-suppressant drugs. We wish to thank the patients with PPH and their families for participating in this study and would like to dedicate this work to the memories of the family members who have been lost to PPH. We also wish to thank Drs. S. Rich, I. Aditia, D. Chitayat, B. Groves, M. Hoeper, E. Horn, M. Humbert, I. Lang D. Langleben, R. Schilz, and G. Simonneau for graciously encouraging a number of families with PPH to enter the study. This work was supported by National Heart, Lung and Blood Institute grant HL60056-1 (to J.H.M.), National Institute of Diabetes and Digestive and Kidney Diseases grant DK31813 (to S.E.H.), the Clinical Trials Department of Columbia University (support to J.A.K.), and United Therapeutics Corporation (support to J.H.M.).