The Complexity of KIT Gene Mutations and Chromosome Rearrangements and Their Clinical Correlation in Gastrointestinal Stromal (Pacemaker Cell) Tumors
2002; Elsevier BV; Volume: 160; Issue: 1 Linguagem: Inglês
10.1016/s0002-9440(10)64343-x
ISSN1525-2191
AutoresJohanna C. Andersson‐Assarsson, Helene Sjögren, Jeanne M. Meis‐Kindblom, Göran Stenman, Pierre Åman, Lars‐Gunnar Kindblom,
Tópico(s)Gastric Cancer Management and Outcomes
ResumoGastrointestinal stromal (pacemaker cell) tumors (GIST/GIPACTs) are frequently associated with activating KIT mutations, primarily of exon 11 and rarely of exons 9 and 13, as well as certain chromosome rearrangements. Reports regarding the frequency and prognostic significance of KIT mutations are conflicting and few cases have been completely sequenced. Furthermore, there are few detailed analyses of chromosome alterations in GIST/GIPACTs. In a detailed analysis of 14 GIST/GIPACTs from 12 patients, we found a wider spectrum of KIT mutations than previously reported, including 11 different in-frame mutations involving exons 11, 14, and 15. No mutations were detected in four malignant tumors. The shorter (GNNK−) KIT isoform was preferentially expressed. Cytogenetic and spectral karyotype analyses of 10 tumors revealed clonal abnormalities in eight tumors; the most common were terminal 1p deletions and losses of chromosomes 14 and/or 22. Neither KIT mutation status nor chromosome aberrations correlated with tumor phenotype or clinical behavior in our series. Collectively, these findings indicate that the role of KIT mutations and chromosomal rearrangements in the pathogenesis of GIST/GIPACTs are more complex than previously recognized. Gastrointestinal stromal (pacemaker cell) tumors (GIST/GIPACTs) are frequently associated with activating KIT mutations, primarily of exon 11 and rarely of exons 9 and 13, as well as certain chromosome rearrangements. Reports regarding the frequency and prognostic significance of KIT mutations are conflicting and few cases have been completely sequenced. Furthermore, there are few detailed analyses of chromosome alterations in GIST/GIPACTs. In a detailed analysis of 14 GIST/GIPACTs from 12 patients, we found a wider spectrum of KIT mutations than previously reported, including 11 different in-frame mutations involving exons 11, 14, and 15. No mutations were detected in four malignant tumors. The shorter (GNNK−) KIT isoform was preferentially expressed. Cytogenetic and spectral karyotype analyses of 10 tumors revealed clonal abnormalities in eight tumors; the most common were terminal 1p deletions and losses of chromosomes 14 and/or 22. Neither KIT mutation status nor chromosome aberrations correlated with tumor phenotype or clinical behavior in our series. Collectively, these findings indicate that the role of KIT mutations and chromosomal rearrangements in the pathogenesis of GIST/GIPACTs are more complex than previously recognized. Gastrointestinal stromal tumor (GIST) is the most common nonepithelial neoplasm of the gastrointestinal tract. Problems regarding criteria for diagnosis, appropriate nomenclature, identification of reliable clinical and morphological prognostic factors, and type of differentiation are well recognized. Recent studies have demonstrated a close phenotypic resemblance between GIST and the interstitial cells of Cajal. Hence, the term gastrointestinal pacemaker cell tumor (GIPACT) has been proposed because it more accurately reflects current knowledge regarding differentiation than the noncommittal and purely descriptive term GIST.1Kindblom LG Remotti HE Aldenborg F Meis-Kindblom JM Gastrointestinal pacemaker cell tumor (GIPACT): gastrointestinal stromal tumors show phenotypic characteristics of the interstitial cells of Cajal.Am J Pathol. 1998; 152: 1259-1269PubMed Google Scholar, 2Sircar K Hewlett BR Huizinga JD Chorneyko K Berezin I Riddell RH Interstitial cells of Cajal as precursors of gastrointestinal stromal tumors.Am J Surg Pathol. 1999; 23: 377-389Crossref PubMed Scopus (497) Google Scholar Both interstitial cells of Cajal and GIST/GIPACTs characteristically express the KIT protein,3Hirota S Isozaki K Moriyama Y Hashimoto K Nishida T Ishiguro S Kawano K Hanada M Kurata A Takeda M Muhammad Tunio G Matsuzawa Y Kanakura Y Shinomura Y Kitamura Y Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors.Science. 1998; 279: 577-580Crossref PubMed Scopus (3760) Google Scholar a type III tyrosine-kinase receptor encoded by the proto-oncogene KIT.4Yarden Y Kuang WJ Yang-Feng T Coussens L Munemitsu S Dull TJ Chen E Schlessinger J Francke U Ullrich A Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand.EMBO J. 1987; 6: 3341-3351Crossref PubMed Scopus (1314) Google Scholar, 5Chabot B Stephenson DA Chapman VM Besmer P Bernstein A The proto-oncogene c-kit encoding a transmembrane tyrosine kinase receptor maps to the mouse W locus.Nature. 1988; 335: 88-89Crossref PubMed Scopus (1105) Google Scholar, 6Geissler EN Ryan MA Housman DE The dominant-white spotting (W) locus of the mouse encodes the c-kit proto-oncogene.Cell. 1988; 55: 185-192Abstract Full Text PDF PubMed Scopus (1033) Google Scholar The ligand for KIT is the stem cell factor, also known as Steel factor.7Williams DE Eisenman J Baird A Rauch C Van Ness K March CJ Park LS Martin U Mochizuki DY Boswell HS et al.Identification of a ligand for the c-kit proto-oncogene.Cell. 1990; 63: 167-174Abstract Full Text PDF PubMed Scopus (769) Google Scholar The KIT receptor is essential for the development of the interstitial cells of Cajal, which are responsible for initiating and propagating slow wave activity in gastrointestinal muscles as well as mediating motor input from the enteric nervous system.8Maeda H Yamagata A Nishikawa S Yoshinaga K Kobayashi S Nishi K Requirement of c-kit for development of intestinal pacemaker system.Development. 1992; 116: 369-375PubMed Google Scholar, 9Ward SM Burns AJ Torihashi S Sanders KM Mutation of the proto-oncogene c-kit blocks development of interstitial cells and electrical rhythmicity in murine intestine.J Physiol. 1994; 480: 91-97PubMed Google Scholar, 10Huizinga JD Thuneberg L Kluppel M Malysz J Mikkelsen HB Bernstein A W/kit gene required for interstitial cells of Cajal and for intestinal pacemaker activity.Nature. 1995; 373: 347-349Crossref PubMed Scopus (1240) Google Scholar, 11Torihashi S Ward SM Nishikawa S Nishi K Kobayashi S Sanders KM C-kit-dependent development of interstitial cells and electrical activity in the murine gastrointestinal tract.Cell Tissue Res. 1995; 280: 97-111PubMed Google Scholar, 12Ordog T Ward SM Sanders KM Interstitial cells of Cajal generate electrical slow waves in the murine stomach.J Physiol. 1999; 518: 257-269Crossref PubMed Scopus (199) Google Scholar, 13Horowitz B Ward SM Sanders KM Cellular and molecular basis for electrical rhythmicity in gastrointestinal muscles.Annu Rev Physiol. 1999; 61: 19-43Crossref PubMed Scopus (185) Google Scholar The occurrence of activating mutations involving exon 11 of KIT in sporadic GIST/GIPACTs3Hirota S Isozaki K Moriyama Y Hashimoto K Nishida T Ishiguro S Kawano K Hanada M Kurata A Takeda M Muhammad Tunio G Matsuzawa Y Kanakura Y Shinomura Y Kitamura Y Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors.Science. 1998; 279: 577-580Crossref PubMed Scopus (3760) Google Scholar, 14Nakahara M Isozaki K Hirota S Miyagawa J Hase-Sawada N Taniguchi M Nishida T Kanayama S Kitamura Y Shinomura Y Matsuzawa Y A novel gain-of-function mutation of c-kit gene in gastrointestinal stromal tumors.Gastroenterology. 1998; 115: 1090-1095Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar and the association of exon 11 germline mutations with multicentric GIST/GIPACTs15Nishida T Hirota S Taniguchi M Hashimoto K Isozaki K Nakamura H Kanakura Y Tanaka T Takabayashi A Matsuda H Kitamura Y Familial gastrointestinal stromal tumours with germline mutation of the KIT gene.Nat Genet. 1998; 19: 323-324Crossref PubMed Scopus (492) Google Scholar, 16Kitamura Y Hirota S Nishida T Molecular pathology of c-kit proto-oncogene and development of gastrointestinal stromal tumors.Ann Chir Gynaecol. 1998; 87: 282-286PubMed Google Scholar, 17Maeyama H Hidaka E Ota H Minami S Kajiyama M Kuraishi A Mori H Matsuda Y Wada S Sodeyama H Nakata S Kawamura N Hata S Watanabe M Iijima Y Katsuyama T Familial gastrointestinal stromal tumor with hyperpigmentation: association with a germline mutation of the c-kit gene.Gastroenterology. 2001; 120: 210-215Abstract Full Text Full Text PDF PubMed Scopus (209) Google Scholar indicate they are important in GIST/GIPACT's tumorigenesis. Reports regarding the frequency of mutations in exon 11, however, vary widely, ranging from 30% to nearly 100%.3Hirota S Isozaki K Moriyama Y Hashimoto K Nishida T Ishiguro S Kawano K Hanada M Kurata A Takeda M Muhammad Tunio G Matsuzawa Y Kanakura Y Shinomura Y Kitamura Y Gain-of-function mutations of c-kit in human gastrointestinal stromal tumors.Science. 1998; 279: 577-580Crossref PubMed Scopus (3760) Google Scholar, 18Ernst SI Hubbs AE Przygodzki RM Emory TS Sobin LH O'Leary TJ KIT mutation portends poor prognosis in gastrointestinal stromal/smooth muscle tumors.Lab Invest. 1998; 78: 1633-1636PubMed Google Scholar, 19Lasota J Jasinski M Sarlomo-Rikala M Miettinen M Mutations in exon 11 of c-Kit occur preferentially in malignant versus benign gastrointestinal stromal tumors and do not occur in leiomyomas or leiomyosarcomas.Am J Pathol. 1999; 154: 53-60Abstract Full Text Full Text PDF PubMed Scopus (523) Google Scholar, 20Moskaluk CA Tian Q Marshall CR Rumpel CA Franquemont DW Frierson Jr, HF Mutations of c-kit JM domain are found in a minority of human gastrointestinal stromal tumors.Oncogene. 1999; 18: 1897-1902Crossref PubMed Scopus (167) Google Scholar, 21Taniguchi M Nishida T Hirota S Isozaki K Ito T Nomura T Matsuda H Kitamura Y Effect of c-kit mutation on prognosis of gastrointestinal stromal tumors.Cancer Res. 1999; 59: 4297-4300PubMed Google Scholar, 22Sakurai S Fukasawa T Chong JM Tanaka A Fukayama M C-kit gene abnormalities in gastrointestinal stromal tumors (tumors of interstitial cells of Cajal).Jpn J Cancer Res. 1999; 90: 1321-1328Crossref PubMed Scopus (126) Google Scholar, 23Fukasawa T Chong JM Sakurai S Koshiishi N Ikeno R Tanaka A Matsumoto Y Hayashi Y Koike M Fukayama M Allelic loss of 14q and 22q, NF2 mutation, and genetic instability occur independently of c-kit mutation in gastrointestinal stromal tumor.Jpn J Cancer Res. 2000; 91: 1241-1249Crossref PubMed Scopus (73) Google Scholar There are also conflicting reports with respect to the association between exon 11 mutations and malignant histology and/or aggressive, malignant behavior. Although some investigators have found a positive correlation between the two and have suggested mutation screening as a potential prognosticator,18Ernst SI Hubbs AE Przygodzki RM Emory TS Sobin LH O'Leary TJ KIT mutation portends poor prognosis in gastrointestinal stromal/smooth muscle tumors.Lab Invest. 1998; 78: 1633-1636PubMed Google Scholar, 19Lasota J Jasinski M Sarlomo-Rikala M Miettinen M Mutations in exon 11 of c-Kit occur preferentially in malignant versus benign gastrointestinal stromal tumors and do not occur in leiomyomas or leiomyosarcomas.Am J Pathol. 1999; 154: 53-60Abstract Full Text Full Text PDF PubMed Scopus (523) Google Scholar, 20Moskaluk CA Tian Q Marshall CR Rumpel CA Franquemont DW Frierson Jr, HF Mutations of c-kit JM domain are found in a minority of human gastrointestinal stromal tumors.Oncogene. 1999; 18: 1897-1902Crossref PubMed Scopus (167) Google Scholar, 21Taniguchi M Nishida T Hirota S Isozaki K Ito T Nomura T Matsuda H Kitamura Y Effect of c-kit mutation on prognosis of gastrointestinal stromal tumors.Cancer Res. 1999; 59: 4297-4300PubMed Google Scholar others have not been able to verify these findings.22Sakurai S Fukasawa T Chong JM Tanaka A Fukayama M C-kit gene abnormalities in gastrointestinal stromal tumors (tumors of interstitial cells of Cajal).Jpn J Cancer Res. 1999; 90: 1321-1328Crossref PubMed Scopus (126) Google Scholar In addition, there have been recent reports of GIST/GIPACTs that lack mutations in exon 11 but have activating mutations of exons 924Lux ML Rubin BP Biase TL Chen CJ Maclure T Demetri G Xiao S Singer S Fletcher CD Fletcher JA KIT extracellular and kinase domain mutations in gastrointestinal stromal tumors.Am J Pathol. 2000; 156: 791-795Abstract Full Text Full Text PDF PubMed Scopus (578) Google Scholar, 25Lasota J Wozniak A Sarlomo-Rikala M Rys J Kordek R Nassar A Sobin LH Miettinen M Mutations in exons 9 and 13 of KIT gene are rare events in gastrointestinal stromal tumors: a study of 200 cases.Am J Pathol. 2000; 157: 1091-1095Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar, 26Hirota S Nishida T Isozaki K Taniguchi M Nakamura J Okazaki T Kitamura Y Gain-of-function mutation at the extracellular domain of KIT in gastrointestinal stromal tumours.J Pathol. 2001; 193: 505-510Crossref PubMed Scopus (211) Google Scholar and 1324Lux ML Rubin BP Biase TL Chen CJ Maclure T Demetri G Xiao S Singer S Fletcher CD Fletcher JA KIT extracellular and kinase domain mutations in gastrointestinal stromal tumors.Am J Pathol. 2000; 156: 791-795Abstract Full Text Full Text PDF PubMed Scopus (578) Google Scholar, 25Lasota J Wozniak A Sarlomo-Rikala M Rys J Kordek R Nassar A Sobin LH Miettinen M Mutations in exons 9 and 13 of KIT gene are rare events in gastrointestinal stromal tumors: a study of 200 cases.Am J Pathol. 2000; 157: 1091-1095Abstract Full Text Full Text PDF PubMed Scopus (303) Google Scholar, 27Isozaki K Terris B Belghiti J Schiffmann S Hirota S Vanderwinden JM Germline-activating mutation in the kinase domain of KIT gene in familial gastrointestinal stromal tumors.Am J Pathol. 2000; 157: 1581-1585Abstract Full Text Full Text PDF PubMed Scopus (217) Google Scholar of the KIT gene. Alternative splicing in the 3′end of exon 9 of the KIT transcript gives rise to two different isoforms of the KIT protein that differ in length by four amino acids and are referred to as GNNK+/GNNK− or KitA+/Kit+.28Reith AD Ellis C Lyman SD Anderson DM Williams DE Bernstein A Pawson T Signal transduction by normal isoforms and W mutant variants of the Kit receptor tyrosine kinase.EMBO J. 1991; 10: 2451-2459Crossref PubMed Scopus (205) Google Scholar, 29Zhu WM Dong WF Minden M Alternate splicing creates two forms of the human kit protein.Leuk Lymphoma. 1994; 12: 441-447Crossref PubMed Scopus (29) Google Scholar Preferential expression of the shorter isoform of the protein has been observed in a number of neoplasms, including acute myeloid leukemia30Piao X Curtis JE Minkin S Minden MD Bernstein A Expression of the Kit and KitA receptor isoforms in human acute myelogenous leukemia.Blood. 1994; 83: 476-481Crossref PubMed Google Scholar and human germ cell tumors.31Tian Q Frierson Jr, HF Krystal GW Moskaluk CA Activating c-kit gene mutations in human germ cell tumors.Am J Pathol. 1999; 154: 1643-1647Abstract Full Text Full Text PDF PubMed Scopus (370) Google Scholar Caruana and colleagues32Caruana C Cambareri AC Ashman LK Isoforms of c-KIT differ in activation of signalling pathways and transformation of NIH3T3 fibroblasts.Oncogene. 1999; 18: 5573-5581Crossref PubMed Scopus (80) Google Scholar have shown that the GNNK− isoform is tumorigenic in NIH3T3 cells, whereas the GNNK+ isoform is not. Thus far, there are no reports of the relative distribution of the two KIT isoforms in GIST/GIPACTs. Previous cytogenetic and molecular cytogenetic studies have shown primarily three recurrent abnormalities, including terminal deletions of 1p and complete or partial losses of chromosomes 14 and 22.33Mark J Wedell B Dahlenfors R Havel G Cytogenetic observations in a human gastric leiomyosarcoma.Cancer Genet Cytogenet. 1989; 37: 215-220Abstract Full Text PDF PubMed Scopus (20) Google Scholar, 34Bardi G Johansson B Pandis N Heim S Mandahl N Bak-Jensen E Frederiksen H Andren-Sandberg A Mitelman F Recurrent chromosome aberrations in abdominal smooth muscle tumors.Cancer Genet Cytogenet. 1992; 62: 43-46Abstract Full Text PDF PubMed Scopus (32) Google Scholar, 35Sreekantaiah C Davis JR Sandberg AA Chromosomal abnormalities in leiomyosarcomas.Am J Pathol. 1993; 142: 293-305PubMed Google Scholar, 36Saunders AL Meloni AM Chen Z Sandberg AA Lauwers GY Two cases of low-grade gastric leiomyosarcoma with monosomy 14 as the only change.Cancer Genet Cytogenet. 1996; 90: 184-185Abstract Full Text PDF PubMed Scopus (16) Google Scholar, 37Marci V Casorzo L Sarotto I Dogliani N Milazzo MG Risio M Gastrointestinal stromal tumor, uncommitted type, with monosomies 14 and 22 as the only chromosomal abnormalities.Cancer Genet Cytogenet. 1998; 102: 135-138Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar, 38Breiner JA Meis-Kindblom J Kindblom L McComb E Liu J Nelson M Bridge JA Loss of 14q and 22q in gastrointestinal stromal tumors (pacemaker cell tumors).Cancer Genet Cytogenet. 2000; 120: 111-116Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar Our study aimed to investigate the spectrum of KIT mutations in GIST/GIPACTs as well as the interrelationship between these mutations, KIT isoform expression, cytogenetic and phenotypic characteristics, and clinical behavior. The pertinent clinical and morphological data are summarized in Table 1. Fourteen tumors from 12 patients were analyzed; 6 were primary tumors, 1 a local recurrence, and 7 metastases (in one patient both the primary tumor and a metastasis were analyzed and in another patient two metachronous metastases were studied). The primary tumors arose in the small intestine (n = 7), stomach (n = 4), and rectum (n = 1) and were histologically classified as predominantly spindled, epithelioid, or mixed-spindled epithelioid as well as benign-appearing, borderline, or malignant based on cellularity, pleomorphism, mitotic activity, necrosis, and growth pattern. Immunohistochemically, all tumors were strongly CD117 (KIT)-positive, 10 of 14 tumors were CD34-positive, and 4 of 14 were focally positive for α-smooth muscle actin. All tumors were negative for desmin, S-100 protein, and chromogranin. Ki67 (MIB-1)-labeling index ranged from <1% in benign and borderline tumors to 5 to 30% in malignant tumors. None of the patients in this study received radiation therapy or chemotherapy; all primary and metastatic tumors were treated solely by surgical resection.Table 1Summary of Clinical Data, Histology, Mutation Analysis, and Karyotype in 14 GIST/GIPACTs in 12 PatientsCaseAge/sexSiteSize (cm)HistologyFollow-upMutationKaryotype†Based on G-banding and SKY.157 /FS.I.1*Incidental finding at surgery.S; BAW: 8 yrsPT: V560D, S715delN.D.270 /FS.I.7E+ S; BoAW: 9 yrsPT: V560D, S715delN.D.363 /FG20E+ S; MMet: 9, 14 mosMT (14 mos):41–45, XX,−21[4][cp4]TRD: 1 yrW557_K558del4a72 /MG19E+ S; MMet: 1, 2.5, 3.2 yrsPT: none44–47, X,−Y[7],+7[2], add(18)(q22-23)[3][cp10]4bTRD: 3.5 yrsMT (3.2 yrs): S715del41–47, XY, add(18)(q22-23)[2][cp2]5a47 /MS.I.16E + S; MMet: 8 mos, 1.3, 2, 2.8, 3, 3.2 yrsMT (8 mos): V560D, S715del46, XY5bTRD: 4 yrsMT (3.2 yrs): K558N, K558_V559insP, S715del41, XY, del(1)(p13), del(2)(p13), der(4)t(4;10)(p16;q22),−7,−10, der(11)t(5;11)(q33;p15),−14,−15, der(18)del(18)(p11)del(18)(q12), der(20)t(7;20)(q11;q13),−22654 /FS.I.11S; MMet: 1.5, 2.2 yrsMT (2.2 yrs):46, XXTRD: 3.7 yrsK558_V560del, K704_N705del, S715del778 /MS.I.4S; MMet: APS TRD: 1.5 yrPT: none61–68, XY,−X,+1, del(1)(p22), der(1;14)(q10;q10)x2,+2,+3,+4,+5,+6,+7, der(7)inv(7)(q22q32)del(7)(q33)x2, der(7;8)(p10;q10),−8,−9,−9, −10, der(10)t(10;14)(q11;q?),+11, add(11)(p15)x2, add(12)(p13),−13, −14,−14,−15, der(7;15)(q10;q10)x2,+18, add(18)(p11)x2,+19,+20, +20, der(20)t(13;20)(q?;p13),−21,−22,+mar1[cp11]872 /FG18E; MMet: APS TRD: 8 mosPT: none44–47, XX,+7[7],−22[3][cp8]966 /FG33S; MMet: 6 mos AWM: 4 yrsPT: V560D, S715del41–46, XX,−13[3],−22[5],+mar1[3], +mar2[3][cp7]1045 /FS.I.10E+ S; MMet: 6 times; 1–9 yrs TRD: 9 yrsMT (9 yrs): V560DN.D.1150 /MS.I.18E+ S; MMet: 2 yrs TRD: 4 yrsMT (2 yrs): none42–46, XY, −22[3][cp3]1263 /MR4S; MLR: 4 yrs AW: 4.2 yrsLR (4 yrs): W557_E561delN.D.APS, at primary surgery; AW, alive and well; AWM, alive with metastasis; B, benign; Bo, borderline; E, epithelioid; G, gastric; LR, local recurrence; M, malignant; Met, metastases, surgically removed; mos, months; MT, metastatic tumor; PT, primary tumor; R, rectal; S, spindled; S.I., small intestine; TRD, tumor related death, yr/yrs: year/years; N.D., not determined.* Incidental finding at surgery.† Based on G-banding and SKY. Open table in a new tab APS, at primary surgery; AW, alive and well; AWM, alive with metastasis; B, benign; Bo, borderline; E, epithelioid; G, gastric; LR, local recurrence; M, malignant; Met, metastases, surgically removed; mos, months; MT, metastatic tumor; PT, primary tumor; R, rectal; S, spindled; S.I., small intestine; TRD, tumor related death, yr/yrs: year/years; N.D., not determined. RNA was prepared from 14 fresh frozen GIST/GIPACTs using the Fast Prep System (FastRNA Green; Qbiogene, Illkirch Cedex, France). cDNA was prepared with poly T-primers and RNA as template. All primers (Table 2) were designed using the Unigene Representative Sequence (X06182) for KIT mRNA as template.Table 2Summary of Primer SequencesNameSequencePCR amplification of exons 9–11PCRKIT1 s5′ CTATAGATTCTAGTGCATTCAAG 3′PCRKIT2 as5′ TCAGCCTGTTTCTGGGAAACTCC 3′PCR amplification of exons 12–15PCRKIT9 s5′ CCCAACACAACTTCCTT 3′PCRKIT10 as5′ TTGGGACAACATAAGAAA 3′Sequencing primers exons 9–11SekKIT1 s5′ GTGCATTCAAGCACAATGGC 3′SekKIT2 as5′ GAAACTCCCATTTGTGATCATAAG 3′Sequencing primers exons 12–15M13F s5′ CAGGAAACAGCTATGAC 3′M13R as5′ GTAAAACGACGGCCAG 3′Sp6 s5′ ATTTAGGTGACACTATAG 3′T7 as5′ TAATACGACTCACTATAGGG 3′PCR amplification and sequencing of the complete coding regionPCRKIT13 s5′ TCGCAGCTACCGCGATGAGA 3′PCRKIT14 as5′ TCACTTCTGGGTCTGTGAGA 3′PCRKIT15 s5′ CAGACCCAGAAGTGACCAATTA 3′PCRKIT16 as5′ CTCTCGCTGAACTGATAGTCAAC 3′PCRKIT17 s5′ GTTGACTATCAGTTCAGCGAGAG 3′PCRKIT18 as5′ ATTCACGAGCCTGTCGTAA 3′PCRKIT19 s5′ GCACTTACACATTCCTAGTGTCC 3′PCRKIT20 as5′ ACATCATGCCAGCTACGAT 3′PCRKIT21 s5′ ACTCCTTTGCTGATTGGTTTCGT 3′PCRKIT22 as5′ AATGGTGCAGGCTCCAAGTAGAT 3′PCRKIT23 s5′ CATGAATATTGTGAATCTACTTG 3′PCRKIT24 as5′ TGATCCGACCATGAGTAA 3′PCRKIT25 s5′ GACGAGTTGGCCCTAGAC 3′PCRKIT26 as5′ AGTTGGAGTAAATATGATTGGTG 3′PCRKIT27 s5′ TGCTGAAATGTATGACATAATGA 3′PCRKIT28 as5′ GGTAGAAGCTACGTTGCTATTG 3′PCR amplification of KIT isoformsPCRKIT3 s5′ GGGGGATCCGATGTGGGCAAGACTTCT 3′PCRKIT4 as5′ CAGCAAAGGAGTGAACAG 3′s, Sense; as, antisense. Open table in a new tab s, Sense; as, antisense. cDNA from all tumors was amplified in 100-μl polymerase chain reactions (PCRs) with primers PCRKIT1s and PCRKIT2as designed to amplify exons 9 to 11. In 11 tumors, exons 12 to 15 were also amplified using primers PCRKIT9s and PCRKIT10as. Amplified PCR products were purified with the Jet Sorb gel extraction kit (Genomed, Bad Oeynhausen, Germany). Exons 9 to 11 were directly sequenced, whereas exons 12 to 15 were cloned using pGEM-T-Easy cloning kit (Promega, Madison, WI). Two to eight clones were sequenced from each tumor. Plasmids were prepared using Qiagen Plasmid Mini Kit (Qiagen, Hilden, Germany). All sequence reactions were performed using Big Dye Terminators Cycle Sequencing Ready Reaction Kit (Applied Biosystems, Foster City, CA) with the following primers: exons 9 to 11, SekKIT1s and SekKIT2as; exons 12 to 15, M13F and M13R or Sp6 and T7. Sequence reactions were purified by ethanol precipitation and analyzed on an ABI Prism 310 Genetic Analyzer (Applied Biosystems). In five cases, the complete coding region was amplified and directly sequenced using eight primer pairs (Table 2). Alignments and mutation scanning were performed using Auto Assembler (Applied Biosystems), BLAST (National Center for Biotechnology Information, Bethesda, MD) and ClustalW (Baylor College of Medicine, Houston, TX). The Unigene Representative Sequence for KIT mRNA (X06182) was used for the alignments. The expression pattern of the two KIT transcript isoforms was analyzed by PCR using cDNA as template. cDNA from human bone marrow and human fetal liver were used as controls. The primers PCRKIT3s and PCRKIT4as were used.32Caruana C Cambareri AC Ashman LK Isoforms of c-KIT differ in activation of signalling pathways and transformation of NIH3T3 fibroblasts.Oncogene. 1999; 18: 5573-5581Crossref PubMed Scopus (80) Google Scholar The PCR products were separated by gel electrophoresis on 4% agarose gel stained with ethidium bromide. Quantification of the PCR products was performed using a Molecular Imager FX (BioRad, Hercules, CA). Primary cultures were established from fresh specimens of cases 3, 4a and 4b, 5a and 5b, 6, 7, 8, 9, and 11 as described.39Sjogren H Wedell B Kindblom JM Kindblom LG Stenman G Fusion of the NH2-terminal domain of the basic helix-loop-helix protein TCF12 to TEC in extraskeletal myxoid chondrosarcoma with translocation t(9;15)(q22;q21).Cancer Res. 2000; 60: 6832-6835PubMed Google Scholar Chromosome preparations were made from exponentially growing primary cultures, and these were subsequently G-banded and analyzed using standard procedures.40Mitelman F ISCN: An International System for Human Cytogenetic Nomenclature. S. Karger, Basel1995Google Scholar Slides (3- to 5-days-old) were treated with a pepsin solution (12 μg/ml) for 4 minutes before hybridization. The SkyPaint probe used contained a cocktail of 24 differentially labeled chromosome-specific painting probes (ASI-Applied Spectral Imaging Ltd., Migdal Ha′Emek, Israel). The conditions for hybridization, posthybridization washes, and detection were essentially as recommended by the manufacturer. Chromosomes were counterstained with DAPI (4′,6′-diamidino-2′-phenylindole dihydrochloride) containing an anti-fade solution. Image acquisition was achieved with the SpectraCube system (ASI) mounted on a Zeiss Axioplan 2 Imaging microscope equipped with a custom designed optical filter cube (SKY-1; Chroma Technology, Brattleboro, VT) and a DAPI filter.41Schrock E du Manoir S Veldman T Schoell B Wienberg J Ferguson-Smith MA Ning Y Ledbetter DH Bar-Am I Soenksen D Garini Y Ried T Multicolor spectral karyotyping of human chromosomes.Science. 1996; 273: 494-497Crossref PubMed Scopus (1452) Google Scholar Analysis of spectral images was performed using the SkyView software (ASI). Eleven different KIT mutations were detected in 10 of 14 tumors (Figure 1). No mutations were detected in exons 9, 10, 12, and 13. Nine tumors had mutations in exon 11, all between nucleotides 1690 and 1704 (amino acids 557 and 561). Seven of the 11 tumors investigated for mutations in exons 12 to 15 had one or two mutations involving exons 14 and 15, which have not been previously reported in GIST/GIPACTs. These two new mutations included deletion of three nucleotides, 2162 A, 2163 G, and 2164 C, in exon 15, encoding serine in position 715 (7 of 11 tumors) and deletion of six nucleotides, 2129 A, 2130 T, 2131 A, 2132 A, 2133 G, and 2134 A, in exon 14, encoding asparagine and lysine in positions 704 and 705 (one tumor). The mutations were detected in ∼50% of the clones from each tumor, indicating that only one allele was mutated. Six of nine tumors with mutations in exon 11 had one or more additional mutations involving exons 14 and 15. All detected mutations were in-frame. No mutations were detected in four tumors in which the complete coding region was sequenced. All tumors contained two variants of the KIT transcript that differed in length by 12 nucleotides (Figure 2) as shown by PCR amplification and/or sequence analysis. These 12 nucleotides correspond to the following four amino acids: GNNK (position 510 to 513). Thus, GIST/GIPACTs expressed both isoforms of the KIT transcript. As shown in Figure 2, there was preferential expression of the shorter isoform with a GNNK−/GNNK+ ratio varying between 1.5 and 2.7. Cytogenetic analyses were performed in 10 malignant GIST/GIPACTs from eight patients. Diploid or near-diploid karyotypes predominated in nine tumors; one tumor had karyotypes in the near-triploid mode. The karyotypes, based on G-banding alone or G-banding in combination with SKY (cases 5b and 7), are shown in Table 1 and Figure 3. Clonal abnormalities were detected in eight tumors. Two tumors had normal karyotypes. Three tumors had simple numerical abnormalities, including; −21; +7 and −22; and −22. Two metastatic lesions (cases 5b and 7) had complex karyotypes with both numerical and structural changes. Detailed comparisons of the G-banded karyotypes with the SKY and DAPI band images allowed clarification of nearly all marker chromosomes in these two tumors. In addition to other abnormalities, both tumors had terminal 1p deletions and losses of chromosomes 14 and 22. Another GIST/GIPACT (case 8) contained a variant cell, which in addition to −22, had a del(1)(p32). Two different mutations involving exon 11 (substitution) and exon 15 (deletion) were detected in the only benign GIST/GIPACT in our series (<1 cm in size and an incidental finding in the small intestine). Two different mutations involving exon 11 (substitution) and exon 15 (deletion) were also found in a 7-cm borderline tumor of the small intestine (the patient is alive and well 9 years after surgery). Of 10 patients with histologically malignant tumors, 9 developed metastases, 1 had a local recurrence, and 8 died within an average of 2 years (range, 8 months to 4 years). Mutations were detected in 8 of 12 tumors from these patients, including 1 of 4 primary tumors, 6 of 7 metastases, and 1 local recurrence. The mutations consisted of 19 deletions (exons 11, 14, and 15), six substitutions (exon 11), and one insertion (exon 11). Multiple tumors were analyzed in two cases (Table 1, cases 4 and 5). The primary tumor in case 4 revealed no mutations, whereas the metastasis had one mutation involving exon 15. Both the primary tumor and the metastasis in this case had similar chromosome rearrangements. Two metastases occurring 8 months and 3 years after the primary tumor
Referência(s)