Glutathione Export during Apoptosis Requires Functional Multidrug Resistance-associated Proteins
2007; Elsevier BV; Volume: 282; Issue: 19 Linguagem: Inglês
10.1074/jbc.m611019200
ISSN1083-351X
AutoresChristine L. Hammond, Rosemarie Marchan, Suzanne M. Krance, Nazzareno Ballatori,
Tópico(s)Pediatric Hepatobiliary Diseases and Treatments
ResumoGSH is released in cells undergoing apoptosis, and the present study indicates that the multidrug resistance-associated proteins (MRPs/ABCC) are responsible for this GSH release. Jurkat cells released ∼75-80% of their total intracellular GSH during both Fas antibody- and staurosporine-induced apoptosis. In contrast, Raji cells, a lymphocyte cell line that is deficient in phosphatidylserine externalization, did not release GSH during apoptosis, and other apoptotic features appeared more slowly in these cells. Jurkat and Raji cell lines expressed comparable MRP and OATP/SLCO (organic anion-transporting polypeptide) mRNA levels, and MRP1 protein levels; however, differences existed in MRP1 localization and function. In Jurkat cells, MRP1 was largely localized to the plasma membrane, and these cells exported the MRP substrate calcein. Calcein release was enhanced during apoptosis. In contrast, Raji cells had little MRP1 at the plasma membrane and did not export calcein under basal or apoptotic conditions, indicating that these cells lack functional MRPs at the plasma membrane. GSH release in Jurkat cells undergoing apoptosis was inhibited by the organic anion transport inhibitors MK571, sulfinpyrazone, and probenecid, supporting a role for the MRP transporters in this process. Furthermore, when MRP1 expression was decreased with RNA interference, GSH release was lower under both basal and apoptotic conditions, providing direct evidence that MRP1 is involved in GSH export. GSH is released in cells undergoing apoptosis, and the present study indicates that the multidrug resistance-associated proteins (MRPs/ABCC) are responsible for this GSH release. Jurkat cells released ∼75-80% of their total intracellular GSH during both Fas antibody- and staurosporine-induced apoptosis. In contrast, Raji cells, a lymphocyte cell line that is deficient in phosphatidylserine externalization, did not release GSH during apoptosis, and other apoptotic features appeared more slowly in these cells. Jurkat and Raji cell lines expressed comparable MRP and OATP/SLCO (organic anion-transporting polypeptide) mRNA levels, and MRP1 protein levels; however, differences existed in MRP1 localization and function. In Jurkat cells, MRP1 was largely localized to the plasma membrane, and these cells exported the MRP substrate calcein. Calcein release was enhanced during apoptosis. In contrast, Raji cells had little MRP1 at the plasma membrane and did not export calcein under basal or apoptotic conditions, indicating that these cells lack functional MRPs at the plasma membrane. GSH release in Jurkat cells undergoing apoptosis was inhibited by the organic anion transport inhibitors MK571, sulfinpyrazone, and probenecid, supporting a role for the MRP transporters in this process. Furthermore, when MRP1 expression was decreased with RNA interference, GSH release was lower under both basal and apoptotic conditions, providing direct evidence that MRP1 is involved in GSH export. Cells stimulated to undergo apoptosis release GSH into the extracellular space, but the precise mechanisms behind the GSH export and its significance to the apoptotic process are not understood (1Hammond C.L. Lee T.K. Ballatori N. J. Hepatol. 2001; 34: 946-954Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar). Because GSH regulates many cellular functions, depletion of intracellular GSH can disrupt these processes. Although apoptotic GSH release may be a simple consequence of cell death, there is increasing evidence that it is required for either activation of specific apoptotic signaling pathways or for proper dismantling of cellular components (1Hammond C.L. Lee T.K. Ballatori N. J. Hepatol. 2001; 34: 946-954Abstract Full Text Full Text PDF PubMed Scopus (177) Google Scholar, 2Coppola S. Ghibelli L. Biochem. Soc. Trans. 2000; 28: 56-61Crossref PubMed Scopus (144) Google Scholar). For example, the decrease in GSH may lead to an increase in reactive oxygen species, which could function as second messengers, or may accelerate mitochondrial damage and apoptosis. Intracellular GSH levels are controlled in two major ways: by regulating its rate of synthesis inside the cell and its rate of transport out of the cell (3Ballatori N. Hammond C.L. Cunningham J.B. Krance S.M. Marchan R. Toxicol. Appl. Pharmacol. 2005; 204: 238-255Crossref PubMed Scopus (211) Google Scholar). GSH depletion during apoptosis has been reported to occur concomitantly with an increase in extracellular GSH, indicating that GSH is exported (4Ghibelli L. Coppola S. Rotilio G. Lafavia E. Maresca V. Ciriolo M.R. Biochem. Biophys. Res. Commun. 1995; 216: 313-320Crossref PubMed Scopus (178) Google Scholar, 5Ghibelli L. Fanelli C. Rotilio G. Lafavia E. Coppola S. Colussi C. Civitareale P. Ciriolo M.R. FASEB J. 1998; 12: 479-486Crossref PubMed Scopus (297) Google Scholar, 6Hammond C.L. Madejczyk M.S. Ballatori N. Toxicol. Appl. Pharmacol. 2004; 195: 12-22Crossref PubMed Scopus (46) Google Scholar, 7He Y.Y. Huang J.L. Ramirez D.C. Chignell C.F. J. Biol. Chem. 2003; 278: 8058-8064Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 8van den Dobbelsteen D.J. Nobel C.S. Schlegel J. Cotgreave I.A. Orrenius S. Slater A.F. J. Biol. Chem. 1996; 271: 15420-15427Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar). GSH release is probably mediated by transport proteins, because it is detected before plasma membrane integrity is lost (5Ghibelli L. Fanelli C. Rotilio G. Lafavia E. Coppola S. Colussi C. Civitareale P. Ciriolo M.R. FASEB J. 1998; 12: 479-486Crossref PubMed Scopus (297) Google Scholar, 6Hammond C.L. Madejczyk M.S. Ballatori N. Toxicol. Appl. Pharmacol. 2004; 195: 12-22Crossref PubMed Scopus (46) Google Scholar, 7He Y.Y. Huang J.L. Ramirez D.C. Chignell C.F. J. Biol. Chem. 2003; 278: 8058-8064Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 8van den Dobbelsteen D.J. Nobel C.S. Schlegel J. Cotgreave I.A. Orrenius S. Slater A.F. J. Biol. Chem. 1996; 271: 15420-15427Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar), and it can be inhibited by specific drugs (5Ghibelli L. Fanelli C. Rotilio G. Lafavia E. Coppola S. Colussi C. Civitareale P. Ciriolo M.R. FASEB J. 1998; 12: 479-486Crossref PubMed Scopus (297) Google Scholar, 6Hammond C.L. Madejczyk M.S. Ballatori N. Toxicol. Appl. Pharmacol. 2004; 195: 12-22Crossref PubMed Scopus (46) Google Scholar, 7He Y.Y. Huang J.L. Ramirez D.C. Chignell C.F. J. Biol. Chem. 2003; 278: 8058-8064Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 8van den Dobbelsteen D.J. Nobel C.S. Schlegel J. Cotgreave I.A. Orrenius S. Slater A.F. J. Biol. Chem. 1996; 271: 15420-15427Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar). Reducing GSH export during apoptosis slows down the apoptotic process (6Hammond C.L. Madejczyk M.S. Ballatori N. Toxicol. Appl. Pharmacol. 2004; 195: 12-22Crossref PubMed Scopus (46) Google Scholar, 7He Y.Y. Huang J.L. Ramirez D.C. Chignell C.F. J. Biol. Chem. 2003; 278: 8058-8064Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 8van den Dobbelsteen D.J. Nobel C.S. Schlegel J. Cotgreave I.A. Orrenius S. Slater A.F. J. Biol. Chem. 1996; 271: 15420-15427Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar), and in some cases it has been reported to increase cell survival (5Ghibelli L. Fanelli C. Rotilio G. Lafavia E. Coppola S. Colussi C. Civitareale P. Ciriolo M.R. FASEB J. 1998; 12: 479-486Crossref PubMed Scopus (297) Google Scholar). Although GSH release is important for maintaining both basal and apoptotic intracellular GSH levels, the mechanisms responsible for GSH transport out of the cell are not well characterized (3Ballatori N. Hammond C.L. Cunningham J.B. Krance S.M. Marchan R. Toxicol. Appl. Pharmacol. 2005; 204: 238-255Crossref PubMed Scopus (211) Google Scholar). A recent study suggests that the OATP (organic anion-transporting polypeptide)/SLCO) family of proteins is responsible for apoptotic GSH release (9Franco R. Cidlowski J.A. J. Biol. Chem. 2006; 281: 29542-29557Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar); however, only indirect evidence was provided for this conclusion. Under basal conditions, GSH is thought to be released from cells largely via the multidrug resistance-associated protein (MRP/ABCC) family of proteins (3Ballatori N. Hammond C.L. Cunningham J.B. Krance S.M. Marchan R. Toxicol. Appl. Pharmacol. 2005; 204: 238-255Crossref PubMed Scopus (211) Google Scholar), although the OATPs may also contribute (3Ballatori N. Hammond C.L. Cunningham J.B. Krance S.M. Marchan R. Toxicol. Appl. Pharmacol. 2005; 204: 238-255Crossref PubMed Scopus (211) Google Scholar, 10Li L. Lee T.K. Meier P.J. Ballatori N. J. Biol. Chem. 1998; 273: 16184-16191Abstract Full Text Full Text PDF PubMed Scopus (252) Google Scholar, 11Briz O. Romero M.R. Martinez-Becerra P. Macias R.I. Perez M.J. Jimenez F. Martin F. G. San Marin J.J. J. Biol. Chem. 2006; 281: 30326-30335Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Several members of the MRP family have been shown to mediate GSH transport, including MRP1, MRP2, MRP4, MRP5, and CFTR (3Ballatori N. Hammond C.L. Cunningham J.B. Krance S.M. Marchan R. Toxicol. Appl. Pharmacol. 2005; 204: 238-255Crossref PubMed Scopus (211) Google Scholar). For the OATPs, rat Oatp1 is thought to release GSH through an exchange mechanism with an organic anion (10Li L. Lee T.K. Meier P.J. Ballatori N. J. Biol. Chem. 1998; 273: 16184-16191Abstract Full Text Full Text PDF PubMed Scopus (252) Google Scholar), and human OATP8 (OATP1B3) has been implicated in the cotransport of GSH and bile acids (11Briz O. Romero M.R. Martinez-Becerra P. Macias R.I. Perez M.J. Jimenez F. Martin F. G. San Marin J.J. J. Biol. Chem. 2006; 281: 30326-30335Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). OATP8 is the only human OATP implicated in GSH transport thus far. The present findings indicate that the MRPs, and not the OATPs, are responsible for the GSH export that is observed in cells undergoing apoptosis. Materials—Fas antibody clone CH-11 was purchased from MBL International Corp. (Woburn, MA), and MK571 was purchased from Biomol Research Laboratories (Plymouth Meeting, PA). Fluorescent caspase 3 substrate Ac-DEVD-AMC (7-amido-4-methylcoumarin) was from Calbiochem, Annexin V-APC was from BD Pharmingen (San Jose, CA), and calcein-AM and FM®1-43FX were from Molecular Probes, Inc. (Eugene, OR). All other chemicals and reagents were purchased from Sigma. Cell Culture—Jurkat and Raji cells were purchased from the American Type Culture Collection (ATCC) (Manassas, VA). Both cell lines were cultured in RPMI 1640 with l-glutamine (Mediatech, Herndon, VA) with 10% fetal bovine serum and 10 μg/ml gentamycin (Invitrogen) and incubated at 37 °C and 5% CO2 atmosphere. Experiments were run with 4 × 106 cells/ml in Krebs-Henseleit (KH) 3The abbreviations used are: KH, Krebs-Henseleit; TBST, Tris-buffered saline with 0.05% Tween 20; siRNA, small interfering RNA; Ab, antibody. buffer (118 mm NaCl, 4.7 mm KCl, 1.2 mm KH2PO4, 25 mm NaHCO3, 0.6 mm MgSO4, 1.25 mm CaCl2, and 10 mm Hepes/Tris, pH 7.5) containing 0.5 mm acivicin, an inhibitor of γ-glutamyl transpeptidase activity. GSH Release—Jurkat and Raji cells were treated with an apoptotic inducer after a 20-min preincubation period at 37 °C in KH buffer plus 0.5 mm acivicin. KH buffer was collected to analyze extracellular GSH, and cell lysate was analyzed for intracellular GSH using an enzymatic assay containing 5,5′-dithio-bis(2-nitrobenzoic acid) and glutathione reductase (12Griffith O.W. Anal. Biochem. 1980; 106: 207-212Crossref PubMed Scopus (4060) Google Scholar). Protein analysis was performed using the Lowry protein assay (13Lowry O.H. Rosebrough N.J. Farr A.L. Randall R.J. J. Biol. Chem. 1951; 193: 265-275Abstract Full Text PDF PubMed Google Scholar). GSH release is expressed as the percentage of total GSH (extracellular and intracellular) present in the media. Phosphatidylserine Externalization—After treatment, Jurkat and Raji cells were stained with Annexin V-APC and propidium iodide in KH buffer containing 2.5 mm CaCl2. Cells were analyzed for propidium iodide exclusion and increases in Annexin V-APC staining using a BD Biosciences FACSCalibur flow cytometer at the University of Rochester Flow Cytometry Core. Data were analyzed using Cell Quest software, gating out propidium iodide-positive cells and including Annexin V-positive cells for phosphatidylserine externalization. Plasma Membrane Integrity—Plasma membrane integrity was measured by propidium iodide exclusion and by lactate dehydrogenase release. Propidium iodide exclusion was measured by flow cytometry. Lactate dehydrogenase release was measured as described by Vassault (14Vassault A. Methods of Enzymatic Analysis. 1983; (Bergmeyer, H. V., ed), Verlag Chemie, Deerfield Beach, FL: 118-126Google Scholar), and the results are expressed as a percentage of total lactate dehydrogenase activity (lysed untreated cells). Caspase 3-like Activity—The caspase 3-like activity assay was based on one provided by BD PharMingen. Briefly, cells were placed in cell lysis buffer (10 mm Tris-HCl, 10 mm NaH2PO4/NaHPO4, pH 7.5, 130 mm NaCl, 1% Triton X-100, and 10 mm sodium pyrophosphate) and frozen at -80 °C until activity assay. Cell lysates were combined with 1× HEPES buffer (20 mm HEPES, pH 7.5, 10% glycerol, and 2 mm dithiothreitol) and 30 μm Ac-DEVD-AMC. Caspase 3-like activity was measured using a SPECRTAmax Gemini XS spectrofluorometer (Molecular Devices Corp., Sunnyvale, CA) at 37 °C. DNA Fragmentation—Jurkat and Raji cells were analyzed for a sub-G1 population, which corresponds to cells with fragmented DNA using a protocol described by Nicoletti et al. (15Nicoletti I. Migliorati G. Pagliacci M.C. Grignani F. Riccardi C. J. Immunol. Methods. 1991; 139: 271-279Crossref PubMed Scopus (4431) Google Scholar). The protocol was altered slightly, substituting KH buffer for phosphate-buffered saline in the propidium iodide solution. Flow cytometry was performed on an Epics Elite ESP (Beckman Coulter, Miami, FL) cytometer and analyzed with EPICS Cyto-Logic software (Beckman Coulter) at the University of Rochester Flow Cytometry Core. Truncated Bid Protein Expression Analysis—Whole cell lysates were prepared as previously described (16Grant C.E. Valdimarsson G. Hipfner D.R. Almquist K.C. Cole S.P. Deeley R.G. Cancer Res. 1994; 54: 357-361PubMed Google Scholar, 17Almquist K.C. Loe D.W. Hipfner D.R. Mackie J.E. Cole S.P. Deeley R.G. Cancer Res. 1995; 55: 102-110PubMed Google Scholar). Briefly, cells were resuspended in Western blot lysis buffer containing 10 mm Tris-HCl (pH 7.4), 10 mm KCl, 1.5 mm MgCl2, 2 mm phenylmethylsulfonyl fluoride, 200 μg/ml EDTA, and protease inhibitor mixture at 5 × 107 cells/ml at 4 °C for 10 min and then homogenized. Sucrose was added to a final concentration of 250 mm, and lysate was centrifuged at 800 × g at 4 °C for 20 min. Proteins were detected using 1:1000 primary antibody for Bid (Cell Signaling, Beverly, MA) overnight at 4 °C and secondary antibody (1:3000) for 1 h at room temperature. Images were detected using a Kodak Digital Science Image Station 440 (Eastman Kodak Co.). MRP1 Protein Expression Analysis—Membrane-enriched fractions were prepared as previously described (16Grant C.E. Valdimarsson G. Hipfner D.R. Almquist K.C. Cole S.P. Deeley R.G. Cancer Res. 1994; 54: 357-361PubMed Google Scholar, 17Almquist K.C. Loe D.W. Hipfner D.R. Mackie J.E. Cole S.P. Deeley R.G. Cancer Res. 1995; 55: 102-110PubMed Google Scholar). Briefly, whole cell lysate was prepared as above and was further centrifuged at 100,000 × g at 4 °C for 20 min. Cell pellets were resuspended in 10 mm Tris-HCl (pH 7.4), 125 mm sucrose, 200 μg/ml EDTA, 2 mm phenylmethylsulfonyl fluoride, and protease inhibitor mixture. MRPr1 (Alexis Biochemicals, San Diego, CA) primary antibody was diluted to 1:300, and the secondary antibody was diluted to 1:15,000. mRNA Expression—Total RNA was isolated using the RNeasy Mini Kit and the RNase-Free DNase set (Qiagen, Valencia, CA). Oligonucleotide primers were designed for portions of the MRP and OATP families of genes as well as for β-actin using Primer Express 1.5 (Applied Biosystems, Foster City, CA) and published sequences from GenBank™ (Table 1). One primer set was designed that identifies both OATP-C and OATP8, because they are very similar in sequence. Reactions were conducted and analyzed on a Roto-Gene 3000 real time light cycler (Corbett Research, Phenix Corp., Hayward, CA). PCR analysis was performed on 10-100 ng of RNA using the Quantitect Sybr Green quantitative reverse transcription-PCR kit (Qiagen, Valencia, CA).TABLE 1Primer sequences and annealing temperatures (Ta) for real time reverse transcription-PCRProteinGeneGenBank™ accession numberForward primer (5′–3′)Reverse primer (5′–3′)TaAmplicon sizebpMRP1ABCC1NM 004996AGGTCAAGCTTTCCGTGTACTGGGACTTTCGTGTGCTCCTGA57174MRP2ABCC2NM 000392CTGCGGTGGATCTAGAGACAGATGCCGCACTCTATAATCTTCCC58156MRP3ABCC3AF085690GGCTGCAGGGCGTACAGTCTGCCAAGATGAGGGCAGAGAGTA61184MRP4ABCC4AY081219TTTGTGACCTTCACCACCTACGTGGTTGCGCTGTGATATCTCATCAAGT62201MRP5ABCC5NM 005688AGTTCTGTTTGTTACCCACCAGTTACCCTTGTCTTGTGACTTCTTCTGT57226MRP6ABCC6NM 001171GCTCTATCCTCAGGAACTCGAAGACGCTTTCTCTGCATTCATAGCATTCT60226MRP7ABCC10NM 033450GATTCTGCCACTGGTACAAGCTGTCAGTAAGCTTGGTACACGTGCAAG61201MRP8ABCC11NM 032583GCCAAAGGTAGAAAGTCAGGCTCTGAAGATCGTTAAGAAGACGATCA58216MRP9ABCC12NM 145187AGCAGGAAAAGTACCCCAAAGAGCTGTGCAGAACCGATTTGA57.8153CFTRABCC7NM 000492CTACTCTCCTTCGCCACATTTTCTGGCTCAGAGAGGCCTTCTC58188OATP-ASLCO1A2NM 021094.2CTGTGCGACAAAGGACCTGACTGTTATCCAGGTATGGCAGCCAAAGAA59101OATP-BSLCO2B1NM 007256.2CCTTTGCTTGCTAGTCTGAACAGGTATACTTCTTTCCACCCAG59144OATP-CSLCO1B1NM 006446.2GAAAAGGTTGTTTAAAGGAATCTGGCGAAATCATCAATGTAAGAAAGCC55123OATP-DSLCO3A1NM 013272.2GCGGTCTTCATTGACACAAGGAAGAGAAGAAGAGTAAGGCACC54110OATP-ESLCO4A1NM 016354.3GCCATAGCCTGCTTCTTATACAAGCTGGCTATCTGTGGCACTGTCAG59104OATP-FSLCO1C1NM 017435.2GAACAATGGTGTCTACAAGATTCCAGTTTCTAAAGTTGAGTTTCCTTGCC57102OATP-HSLCO4C1NM 180991.4GATGAAACTGCTCCACCTCAGACCTCCACCTCTTGTTAGATCAGTAGTG59147OATP-ISLCO6A1NM 173488.2GGAGCCAGGATGAAGTCTCAAGAACCTTATCAAGGCCTCTGGAAG55155OATP-JSLCO5A1NM 03958.1TCATGCTCCCCTACGGTACAGGCTCACCTTTGTTTGGAGTGTTAG59102OATP8SLCO1B3NM 019844.1GAAAAGGTTGTTTAAAGGAATCTGGCGAAATCATCAATGTAAGAAAGCC55123PGTSLCO2A1NM 05630.1CCGTATTCCGAGGAGTAGAGAGGGTATGAGCATGTCTGAAACCAG57152ActinNM 031144CCGTGAAAAGATGACCCAGATCGGTACGACCAGAGGCATACAGG55100 Open table in a new tab Immunofluorescence Detection of MRP1—Cells were fixed and stained using the Fix and Perm® cell permeabilization kit (Caltag Laboratories, Burlingame, CA). After washing with phosphate-buffered saline plus 5% goat serum, cells were incubated with 1.25 μg/ml MRPr1 (Alexis Biochemicals, San Diego, CA), 1.25 μg/ml rat IgG2a (Zymed Laboratories, San Francisco, CA) in Reagent B of the Fix and Perm Kit or phosphate-buffered saline plus 5% goat serum for 30 min at room temperature in a humidified chamber. Rat IgG2a and phosphate-buffered saline plus 5% goat serum were used as negative controls. Cells were then labeled with a 1:1000 dilution of anti rat IgG Alexa Fluor 647 (Molecular Probes) in Reagent B for 30 min at room temperature in a humidified chamber. After washing, 10 nm SYTOX green nucleic acid stain (Molecular Probes) was added for 10 min. Cells were fixed in 3.7% paraformaldehyde and mounted with Fluoromount G (Southern Biotech, Birmingham, AL). Confocal Laser-scanning Microscopy—Images were taken with a Leica TCS SP Spectral Confocal microscope (Leica Microsystems, Exton, PA) incorporating an upright DMRE Leica microscope at the University of Rochester Pathology/Morphology Imaging Core. Images were scanned simultaneously with a 488-nm argon laser and a 633-nm helium-neon laser. MRP Transport Activity—Cells were incubated with 1 μm calcein-AM at 37 °C for 30 min, collected by centrifugation, and resuspended in KH buffer plus 0.5 mm acivicin. Apoptotic inducers were added, and cells were incubated at 37 °C for the indicated times. Samples were analyzed on a SPECRTAmax Gemini XS spectrofluorometer (Molecular Devices) at 37 °C, excitation 485 nm; emission 530 nm. Cells without calcein were measured to detect background fluorescence. Protein was analyzed using the DC protein assay (Bio-Rad). The calcein release data were expressed as average fluorescence/mg of protein and then converted to percentage of calcein released (supernatant) from total calcein made by cells (supernatant + cell lysate calcein). RNA Interference Knockdown of MRP1 in Jurkat Cells—Double-stranded siRNAs specific to MRP1 were designed by Dharmacon Inc. (Lafayette, CO). The targeting sequences were as follows: sense, 5′-GAUGACACCUCUCAACAAAUU; antisense, 5′-PUUUGUUGAGAGGUGUCAUCUU (catalog number MU-007308-00-0020). siCONTROL nontargeting siRNA (Dharmacon) was used as a negative control. Jurkat cells were transfected as described by Ku et al. (18Ku G.M. Yablonski D. Manser E. Lim L. Weiss A. EMBO J. 2001; 20: 457-465Crossref PubMed Scopus (92) Google Scholar). Briefly, 2 × 107 cells were resuspended in 400 μl of culture medium and electroporated with 100 nm siRNA and 10 μg of pmaxGFP (Amaxa Inc., Gaithersburg, MD) at 250 V and 950 microfarads using the GenePulsar Xcell Electroporation System (Bio-Rad). After electroporation, cells were incubated for 24 h in 200 ml of culture medium. As controls, cells were electroporated without RNA or were not electroporated. After 24 h, the cells were resuspended in cold KH buffer and sorted for green fluorescent protein-positive cells at the University of Rochester Flow Cytometry Core using a FACSVantage SE (BD Biosciences). GSH release experiments and total intracellular and extracellular GSH levels were assayed as described above. Statistical Analysis—Statistical analysis was performed using Statview 5. Data were analyzed using one-factor analysis of variances and Fisher's PLSD (protected least significant difference) post hoc or unpaired t tests where appropriate. In all cases, p values of less than 0.05 were considered statistically significant. GSH Release Is a Feature Observed in Both Intrinsic and Extrinsic Apoptosis—Jurkat cells treated with Fas antibody released a large amount of intracellular GSH into the media (Fig. 1A), confirming the findings of van den Dobblesteen et al. (8van den Dobbelsteen D.J. Nobel C.S. Schlegel J. Cotgreave I.A. Orrenius S. Slater A.F. J. Biol. Chem. 1996; 271: 15420-15427Abstract Full Text Full Text PDF PubMed Scopus (333) Google Scholar). There was a concurrent decline of intracellular GSH (data not shown). Apoptosis was indicated by an increase in phosphatidylserine externalization (Fig. 1C), caspase 3 activity (Fig. 1E), DNA fragmentation (Fig. 1G), and Bid truncation (Fig. 1I). Lactate dehydrogenase was not released after Fas antibody treatment (data not shown), indicating that the release of GSH was not due to cell lysis. Another lymphocyte cell line, the Raji cells, was tested for GSH release during apoptosis in order to examine if this transport process is associated with phosphatidylserine externalization, since Raji cells are deficient in this process (19Fadeel B. Gleiss B. Hogstrand K. Chandra J. Wiedmer T. Sims P.J. Henter J.I. Orrenius S. Samali A. Biochem. Biophys. Res. Commun. 1999; 266: 504-511Crossref PubMed Scopus (127) Google Scholar, 20Tepper A.D. Ruurs P. Wiedmer T. Sims P.J. Borst J. van Blitterswijk W.J. J. Cell Biol. 2000; 150: 155-164Crossref PubMed Scopus (172) Google Scholar, 21Kagan V.E. Gleiss B. Tyurina Y.Y. Tyurin V.A. Elenstrom-Magnusson C. Liu S.X. Serinkan F.B. Arroyo A. Chandra J. Orrenius S. Fadeel B. J. Immunol. 2002; 169: 487-499Crossref PubMed Scopus (209) Google Scholar, 22Forsberg A.J. Kagan V.E. Schroit A.J. Antioxid. Redox. Signal. 2004; 6: 203-208Crossref PubMed Scopus (10) Google Scholar). Raji cells did not externalize phosphatidylserine after Fas antibody exposure (Fig. 1D), confirming previous findings (19Fadeel B. Gleiss B. Hogstrand K. Chandra J. Wiedmer T. Sims P.J. Henter J.I. Orrenius S. Samali A. Biochem. Biophys. Res. Commun. 1999; 266: 504-511Crossref PubMed Scopus (127) Google Scholar); however, they exhibited features of apoptosis as indicated by increases in caspase 3 activity (Fig. 1F) and DNA fragmentation (Fig. 1H) and the presence of tBid (Fig. 1J). The increase in apoptotic markers was higher in Jurkat cells, and caspase activity appeared more quickly in the Jurkat cells than in the Raji cells (Fig. 1). Both the Raji and Jurkat cells had ∼40 ng of intracellular GSH/mg of protein; however, GSH was not released in Raji cells treated with Fas antibody (Fig. 1B). In addition, GSH was not released even after 6 h of treatment or when 500 ng/ml Fas antibody was used (data not shown). Inducing apoptosis chemically with staurosporine also resulted in GSH release in Jurkat cells but not in the Raji cells (Fig. 2). Raji cells also failed to externalize phosphatidylserine after treatment with staurosporine (Fig. 2D). Staurosporine elicited other features of apoptosis in the Raji cells, including enhanced caspase activity (Fig. 2F) and DNA fragmentation (Fig. 2H), and truncation of Bid (Fig. 2J). Similarly to Fas antibody treatment, staurosporine led to a higher apoptotic marker expression level in the Jurkat cells when compared with the Raji cells (Fig. 2). Jurkat and Raji Cells Express Comparable Levels of MRPs and OATPs—MRP1, MRP2, MRP4, and MRP5, putative GSH transporters, were expressed at comparable levels in Raji and Jurkat cells (Figs. 3, A and B). MRP2 expression was low in both cell lines, and this was expected, because MRP2 is not often present in nonpolarized cells. MRP1 was the most abundant member of this gene family in both cell lines. Western blotting revealed that MRP1 protein was expressed at similar levels in Jurkat and Raji cells (Fig. 3E), consistent with the mRNA data. Jurkat and Raji cells also expressed similar levels of OATP mRNA, except for OATP-D, which was higher in the Raji cells. Neither the Jurkat nor the Raji cells expressed OATP8 (Fig. 3, C and D), the only human OATP suggested to transport GSH thus far (11Briz O. Romero M.R. Martinez-Becerra P. Macias R.I. Perez M.J. Jimenez F. Martin F. G. San Marin J.J. J. Biol. Chem. 2006; 281: 30326-30335Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). MRP1 Is Not Localized to the Plasma Membrane, and MRP-associated Transport Activity Is Not Observed in Raji Cells— MRP transporters are generally located either at the plasma membrane or in intracellular vesicles (23Gennuso F. Fernetti C. Tirolo C. Testa N. L'Episcopo F. Caniglia S. Morale M.C. Ostrow J.D. Pascolo L. Tiribelli C. Marchetti B. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2470-2475Crossref PubMed Scopus (144) Google Scholar, 24Rajagopal A. Simon S.M. Mol. Biol. Cell. 2003; 14: 3389-3399Crossref PubMed Scopus (166) Google Scholar, 25Nies A.T. Konig J. Pfannschmidt M. Klar E. Hofmann W.J. Keppler D. Int. J. Cancer. 2001; 94: 492-499Crossref PubMed Scopus (144) Google Scholar). These vesicles may regulate transport activity through trafficking to and from the plasma membrane (23Gennuso F. Fernetti C. Tirolo C. Testa N. L'Episcopo F. Caniglia S. Morale M.C. Ostrow J.D. Pascolo L. Tiribelli C. Marchetti B. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 2470-2475Crossref PubMed Scopus (144) Google Scholar). To examine MRP1 subcellular localization in Jurkat and Raji cells, these cells were stained with MRP1 antibody and visualized using confocal laser-scanning microscopy. In the Jurkat cells, plasma membrane MRP1 staining was observed (Fig. 4, B-D), whereas MRP1 staining was largely intracellular in the Raji cells (Fig. 4, F-H). Note that both Jurkat and Raji cells have large nuclei and very little cytoplasm (Fig. 4, A and E). FM®1-43FX, a marker for the plasma membrane, confirmed that the MRP1 staining was on the plasma membrane in Jurkat cells and that MRP1 was not on the plasma membrane in Raji cells (data not shown). To examine whether differences in MRP transport activity between the Jurkat and Raji cells may explain the lack of GSH export in the Raji cells, the export of the MRP substrate calcein was measured in both cell lines. Calcein-AM freely diffuses into cells and is cleaved by nonspecific esterases to form the fluorescent product calcein. Calcein is a substrate for MRP transporters, and the overexpression of MRP proteins has been shown to deplete cells of calcein (26Feller N. Broxterman H.J. Wahrer D.C. Pinedo H.M. FEBS Lett. 1995; 368: 385-388Crossref PubMed Scopus (189) Google Scholar, 27Versantvoort C.H. Bagrij T. Wright K.A. Twentyman P.R. Int. J. Cancer. 1995; 63: 855-862Crossref PubMed Scopus (83) Google Scholar). Untreated Jurkat cells released ∼25% of the calcein over 3 h (Fig. 5, A and C), suggesting that these cells have functional MRP proteins. Adding Fas antibody (Fig. 5A) or staurosporine (Fig. 5C) increased the amount of calcein released by Jurkat cells. This increase in calcein release follows a similar time course as the increase in GSH release due to either apoptotic inducer (Figs. 1A and 2A). Probenecid inhibited both the basal calcein release and that induced by Fas antibody (Fig. 5A) or staurosporine (Fig. 5C). MK571 also inhibited both basal and Fas antibody-stimulated calcein export (data not shown). In contrast to the Jurkat cells, Raji cells loaded with calcein failed to release this compound over 3 h, and treatment with Fas antibody or staurosporine did not stimulate calcein release (Fig. 5, B and D). Note that both Jurkat and Raji cells had similar levels of total calcein fluorescence (Fig. 5, E and F), indicating that the lack of calcein export in Raji cells was not due to insufficient loading. MRP Inhibitors Decrease GSH Export during
Referência(s)