Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

Stem Cell-derived Neural Stem/Progenitor Cell Supporting Factor Is an Autocrine/Paracrine Survival Factor for Adult Neural Stem/Progenitor Cells

2003; Elsevier BV; Volume: 278; Issue: 37 Linguagem: Inglês

10.1074/jbc.m305342200

ISSN

1083-351X

Autores

Hiroki Toda, Masayuki Tsuji, Ichiro Nakano, Kazuhiro Kobuke, Takeshi Hayashi, Hironori Kasahara, Jun Takahashi, Akira Mizoguchi, Takeshi Houtani, Tetsuo Sugimoto, Nobuo Hashimoto, Theo D. Palmer, Tasuku Honjo, Kei Tashiro,

Tópico(s)

Epigenetics and DNA Methylation

Resumo

Recent evidence suggests that adult neural stem/progenitor cells (ANSCs) secrete autocrine/paracrine factors and that these intrinsic factors are involved in the maintenance of adult neurogenesis. We identified a novel secretory molecule, stem cell-derived neural stem/progenitor cell supporting factor (SDNSF), from adult hippocampal neural stem/progenitor cells by using the signal sequence trap method. The expression of SDNSF in adult central nervous system was localized to hippocampus including dentate gyrus, where the neurogenesis persists throughout life. In induced neurogenesis status seen in ischemically treated hippocampus, the expression of SDNSF was up-regulated. As functional aspects, SDNSF protein provided a dose-dependent survival effect for ANSC following basic fibroblast growth factor 2 (FGF-2) withdrawal. ANSCs treated by SDNSF also retain self-renewal potential and multipotency in the absence of FGF-2. However, SDNSF did not have mitogenic activity, nor was it a cofactor that promoted the mitogenic effects of FGF-2. These data suggested an important role of SDNSF as an autocrine/paracrine factor in maintaining stem cell potential and lifelong neurogenesis in adult central nervous system. Recent evidence suggests that adult neural stem/progenitor cells (ANSCs) secrete autocrine/paracrine factors and that these intrinsic factors are involved in the maintenance of adult neurogenesis. We identified a novel secretory molecule, stem cell-derived neural stem/progenitor cell supporting factor (SDNSF), from adult hippocampal neural stem/progenitor cells by using the signal sequence trap method. The expression of SDNSF in adult central nervous system was localized to hippocampus including dentate gyrus, where the neurogenesis persists throughout life. In induced neurogenesis status seen in ischemically treated hippocampus, the expression of SDNSF was up-regulated. As functional aspects, SDNSF protein provided a dose-dependent survival effect for ANSC following basic fibroblast growth factor 2 (FGF-2) withdrawal. ANSCs treated by SDNSF also retain self-renewal potential and multipotency in the absence of FGF-2. However, SDNSF did not have mitogenic activity, nor was it a cofactor that promoted the mitogenic effects of FGF-2. These data suggested an important role of SDNSF as an autocrine/paracrine factor in maintaining stem cell potential and lifelong neurogenesis in adult central nervous system. Studies carried out in the last few decades have revealed the potential for lifelong neurogenesis in the adult mammalian central nervous system (CNS). 1The abbreviations used are: CNS, central nervous system; NSC, neural stem/progenitor cell; ANSC, adult neural stem/progenitor cell; EGF, epidermal growth factor; FGF-2, basic fibroblast growth factor 2; IGF-1, insulin-like growth factor-1; SDNSF, stem cell-derived neural stem/progenitor cell supporting factor; DMEM, Dulbecco's modified Eagle's medium; FCS, fetal calf serum; ES, embryonic stem; dpc, days postcoitus; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; BrdU, 5-bromo-2-deoxyuridine; ELISA, enzyme-linked immunosorbent assay; GFP, green fluorescent protein; RT, reverse transcription; Ni-NTA, nickel-nitrilotriacetic acid; DIVn, nth day in vitro; ANOVA, analysis of variance; LSD, least squares difference; En, embryonic day n;Pn, postnatal day n; GFAP, glial fibrillary acidic protein. At present, discrete regions of the adult brain, the subventricular zone of the forebrain and the subgranular layer of hippocampal dentate gyrus, are known to mediate adult neurogenesis (1Altman J. Das G.D. J. Comp. Neurol. 1965; 124: 319-335Crossref PubMed Scopus (2780) Google Scholar, 2Bayer S.A. Exp. Brain Res. 1982; 46: 315-323Crossref PubMed Scopus (231) Google Scholar, 3Kaplan M.S. Bell D.H. J. Neurosci. 1984; 4: 1429-1441Crossref PubMed Google Scholar, 4Luskin M.B. Neuron. 1993; 11: 173-189Abstract Full Text PDF PubMed Scopus (1605) Google Scholar), but little is known about signaling that maintains the pool of self-renewing stem cells within these regions. Primary culture of adult neural stem/progenitor cells (ANSCs) is a potent tool to investigate signals controlling adult neurogenesis. ANSCs can be isolated and expanded by means of epidermal growth factor (EGF) and/or basic fibroblast growth factor (FGF-2). Cycling cells can maintain the properties of self-renewal and multipotency (5Reynolds B.A. Weiss S. Science. 1992; 255: 1707-1710Crossref PubMed Scopus (4570) Google Scholar, 6Palmer T.D. Ray J. Gage F.H. Mol. Cell Neurosci. 1995; 6: 474-486Crossref PubMed Scopus (567) Google Scholar, 7Gage F.H. Coates P.W. Palmer T.D. Kuhn H.G. Fisher L.J. Suhonen J.O. Peterson D.A. Suhr S.T. Ray J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11879-11883Crossref PubMed Scopus (889) Google Scholar, 8Gritti A. Parati E.A. Cova L. Frolichsthal P. Galli R. Wanke E. Faravelli L. Morassutti D.J. Roisen F. Nickel D.D. Vescovi A.L. J. Neurosci. 1996; 16: 1091-1100Crossref PubMed Google Scholar). The fate of ANSCs is under tight environmental control, and various extrinsic factors to promote lineage commitment have been described (9Palmer T.D. Takahashi J. Gage F.H. Mol. Cell Neurosci. 1997; 8: 389-404Crossref PubMed Scopus (956) Google Scholar, 10Takahashi J. Palmer T.D. Gage F.H. J. Neurobiol. 1999; 38: 65-81Crossref PubMed Scopus (374) Google Scholar, 11Tanigaki K. Nogaki F. Takahashi J. Tashiro K. Kurooka H. Honjo T. Neuron. 2001; 29: 45-55Abstract Full Text Full Text PDF PubMed Scopus (331) Google Scholar). ANSCs grafted into the neurogenic or non-neurogenic regions give rise to neurons in a site-specific manner, i.e. only within the neurogenic regions (7Gage F.H. Coates P.W. Palmer T.D. Kuhn H.G. Fisher L.J. Suhonen J.O. Peterson D.A. Suhr S.T. Ray J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11879-11883Crossref PubMed Scopus (889) Google Scholar, 12Lois C. Alvarez-Buylla A. Science. 1994; 264: 1145-1148Crossref PubMed Scopus (1968) Google Scholar, 13Herrera D.G. Garcia-Verdugo J.M. Alvarez-Buylla A. Ann. Neurol. 1999; 46: 867-877Crossref PubMed Scopus (176) Google Scholar, 14Suhonen J.O. Peterson D.A. Ray J. Gage F.H. Nature. 1996; 383: 624-627Crossref PubMed Scopus (541) Google Scholar). Therefore, we anticipate that cell fate is tightly regulated by specific signaling molecules within neurogenic region or "stem cell niche." However, the maintenance of the stem cell phenotype must also be an important attribute of the stem cell niche, and in vitro culture has provided evidence that stem cells themselves may produce autocrine/paracrine factors that facilitate proliferative self-renewal (7Gage F.H. Coates P.W. Palmer T.D. Kuhn H.G. Fisher L.J. Suhonen J.O. Peterson D.A. Suhr S.T. Ray J. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 11879-11883Crossref PubMed Scopus (889) Google Scholar). Glycosylated cystatin C (15Taupin P. Ray J. Fischer W.H. Suhr S.T. Hakansson K. Grubb A. Gage F.H. Neuron. 2000; 28: 385-397Abstract Full Text Full Text PDF PubMed Scopus (283) Google Scholar) and insulin-like growth factor-I (IGF-I) (16Arsenijevic Y. Weiss S. Schneider B. Aebischer P. J. Neurosci. 2001; 21: 7194-7202Crossref PubMed Google Scholar) are two such essential autocrine/paracrine molecules that have been identified as cofactors of FGF-2 and EGF, respectively. To further explore autocrine/paracrine signaling within the stem cell niche, therefore, we used the signal sequence trap method (17Tashiro K. Nakamura T. Honjo T. Methods Enzymol. 1999; 303: 479-495Crossref PubMed Scopus (18) Google Scholar, 18Jacobs K.A. Collins-Racie L.A. Colbert M. Duckett M. Golden-Fleet M. Kelleher K. Kriz R. LaVallie E.R. Merberg D. Spaulding V. Stover J. Williamson M.J. McCoy J.M. Gene (Amst.). 1997; 198: 289-296Crossref PubMed Scopus (0) Google Scholar) to isolate additional novel secretory molecules from ANSCs. Using this cDNA screening method, we have efficiently isolated many secreted molecules with a wide variety of functions (19Tashiro K. Tada H. Heilker R. Shirozu M. Nakano T. Honjo T. Science. 1993; 261: 600-603Crossref PubMed Scopus (638) Google Scholar, 20Yabe D. Nakamura T. Kanazawa N. Tashiro K. Honjo T. J. Biol. Chem. 1997; 272: 18232-18239Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 21Nakamura T. Yabe D. Kanazawa N. Tashiro K. Sasayama S. Honjo T. Genomics. 1998; 54: 89-98Crossref PubMed Scopus (32) Google Scholar, 22Nakamura T. Ruiz-Lozano P. Lindner V. Yabe D. Taniwaki M. Furukawa Y. Kobuke K. Tashiro K. Lu Z. Andon N.L. Schaub R. Matsumori A. Sasayama S. Chien K.R. Honjo T. J. Biol. Chem. 1999; 274: 22476-22483Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar, 23Kato K. Morrison A.M. Nakano T. Tashiro K. Honjo T. Blood. 2000; 96: 362-364Crossref PubMed Google Scholar, 24Nakashiba T. Ikeda T. Nishimura S. Tashiro K. Honjo T. Culotti J.G. Itohara S. J. Neurosci. 2000; 20: 6540-6550Crossref PubMed Google Scholar, 25Kobuke K. Furukawa Y. Sugai M. Tanigaki K. Ohashi N. Matsumori A. Sasayama S. Honjo T. Tashiro K. J. Biol. Chem. 2001; 276: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). In this report, we describe the cloning and characterization of a novel molecule, stem cell-derived neural stem/progenitor cell survival factor (SDNSF), from a cDNA library from rat adult hippocampal NSCs (9Palmer T.D. Takahashi J. Gage F.H. Mol. Cell Neurosci. 1997; 8: 389-404Crossref PubMed Scopus (956) Google Scholar). SDNSF is secreted via the classical vesicular export pathway and provides trophic support for ANSC in the absence of mitogenic growth factors. In addition, SDNSF maintains the self-renewal potential and multipotency of ANSCs in the absence of FGF-2. SDNSF-treated ANSCs can proliferate in response to FGF-2 and produce neuronal and glial cell population after differentiation treatment. Animals and Transient Forebrain Global Ischemia Model—Fisher 344 rats, Sprague-Dawley rats, and C57BL/6 mice were maintained and used for experimentation according to the guidelines of the Kyoto University Animal Research Committee and Stanford University Animal Facility. The animals were deeply anesthetized, sacrificed with sodium pentobarbital, and then dissected immediately or fixed by intracardiac perfusion with 4% paraformaldehyde. For cell cultures, the brains were dissected according to the cell culture protocols as below. For RNA extraction, the tissues are immediately frozen in liquid nitrogen. For in situ hybridization, 50-μm-thick coronal sections were prepared from adult female Fisher 344 rat brains after paraformaldehyde perfusion. Transient global ischemia was induced on male Sprague-Dawley rats (300–350 g; Charles River Laboratories, Wilmington, MA) by bilateral common carotid artery occlusion and induced hypotension using the modified two-vessel occlusion method (26Smith M.L. Bendek G. Dahlgren N. Rosen I. Wieloch T. Siesjo B.K. Acta Neurol. Scand. 1984; 69: 385-401Crossref PubMed Scopus (622) Google Scholar). In brief, the animals were anesthetized with 1.5% isoflurane, 68.5% nitrous oxide, and 30% oxygen and monitored from the femoral artery with PE-50 catheter (427410; Becton Dickinson, San Diego, CA). After exposure of the right jugular vein and both common carotid arteries, 150 IU/kg heparin was intravenously injected, and blood was quickly withdrawn via the jugular vein. When the mean arterial blood pressure became 30 mm Hg, both common carotid arteries were clamped with surgical clips. Mean arterial blood pressure was maintained at 30–35 mm Hg for 5 min. After ischemic treatment, the clips were removed, and the blood was reinfused. Body temperature was monitored with a rectal probe and controlled at 37 °C. Sham-operated animals underwent exposure of vessels without blood withdrawal or clamping of carotid arteries. All animals were treated in accordance with Kyoto University Animal Research Committee guidelines, Stanford University guidelines, and the animal protocol approved by Stanford University's Administrative Panel on Laboratory Animal Care. Cell Culture—ANSCs were isolated from adult rat hippocampi and cultured as described previously (6Palmer T.D. Ray J. Gage F.H. Mol. Cell Neurosci. 1995; 6: 474-486Crossref PubMed Scopus (567) Google Scholar, 27Palmer T.D. Markakis E.A. Willhoite A.R. Safar F. Gage F.H. J. Neurosci. 1999; 19: 8487-8497Crossref PubMed Google Scholar). Briefly, hippocampi from adult female Fisher 344 rats were enzymatically dissociated with a papain (2.5 units/ml; Worthington, Freehold, NJ), dispase II (1 unit/ml; Roche Applied Science), and DNase I (250 units/ml; Worthington) solution. A whole digested tissue was then suspended in 50% Percoll solution and fractionated by centrifugation for 10 min at 20,000 × g. Fractionated cells were washed free of Percoll and plated onto poly-l-ornithine/laminin-coated dishes in DMEM/Ham's F-12 medium (1:1) containing 10% FCS medium for 24 h, and then the medium was replaced with serum-free growth medium consisting of DMEM/Ham's F-12 medium (1:1) supplemented with N2 supplement (Invitrogen) and 20 ng/ml recombinant human FGF-2 (Genzyme, Cambridge, MA). To follow the proliferating single NSC, NSCs were infected by replication-deficient GFP-expressing recombinant retrovirus, LZRS-CAMut4GFP (28Okada A. Lansford R. Weimann J.M. Fraser S.E. McConnell S.K. Exp. Neurol. 1999; 156: 394-406Crossref PubMed Scopus (115) Google Scholar). To promote differentiation, the growth medium was replaced with DMEM/F-12 containing 0.5% FCS, 0.5 μm all-trans-retinoic acid (differentiation medium), and ANSCs were cultured for 6 days. For primary culture of neurons and astrocytes, Fischer 344 rat E18 hippocampi for neurons and P2–4 hippocampi for astrocytes were dissected and dissociated by treatment with 0.25% trypsin and trituration with a fire-polished Pasteur pipette. The cells were plated onto poly-l-lysine-coated dishes and cultured in DMEM/Ham's F-12 medium (1:1) supplemented with N2 supplement for neurons and in DMEM with 10% FCS for astrocytes (29Booher J. Sensenbrenner M. Neurobiology. 1972; 2: 97-105PubMed Google Scholar). The astrocytes were cultured for 3–6 weeks with two to three passages and 5 mm glutamate treatment to eliminate neurons. Rat embryonic NSCs were isolated from E14 striata described previously with slight modification (30Ciccolini F. Svendsen C.N. J. Neurosci. 1998; 18: 7869-7880Crossref PubMed Google Scholar). Dissected striata were enzymatically digested similarly to rat adult NSC isolation and triturated with fire-polished Pasteur pipette, and the cells were plated onto noncoated Nunc four-well dishes in the same growth medium as adult NSCs in the presence of FGF-2 at a concentration of 20 ng/ml. COS-7 cells, HEK293T cells, rat glioma C6 cells (31Benda P. Lightbody J. Sato G. Levine L. Sweet W. Science. 1968; 161: 370-371Crossref PubMed Scopus (1226) Google Scholar), mouse neuroblastoma N18 cells (32Amano T. Richelson E. Nirenberg M. Proc. Natl. Acad. Sci. U. S. A. 1972; 69: 258-263Crossref PubMed Scopus (609) Google Scholar), and human glioblastoma U251 cells (33de Ridder L.I. Laerum O.D. Mork S.J. Bigner D.D. Acta Neuropathol. 1987; 72: 207-213Crossref PubMed Scopus (40) Google Scholar) were cultured in DMEM containing 10% FCS. Mouse embryonic stem (ES) cell line, R1, were cultured on a feeder layer of irradiated mouse embryonic fibroblasts with daily changed medium containing knockout DMEM, penicillin-streptomycin, 100 μm β-mercaptoethanol, 2 mm l-glutamine, 100 mm nonessential amino acids (Invitrogen), 15% FCS (HyClone, Logan, UT), and 1,000 units/ml leukemia inhibitory factor (Chemicon, Temecula, CA) (34Nagy A. Rossant J. Nagy R. Abramow-Newerly W. Roder J.C. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 8424-8428Crossref PubMed Scopus (1987) Google Scholar). RNA Analysis and SDNSF cDNA Cloning—To isolate novel secretory or membrane proteins from neural stem cells, cDNA library was constructed from cultured ANSCs. Poly(A)+ RNA was extracted from ANSCs with TRIzol reagent (Invitrogen) and Oligotex-dT30 Super (Roche Applied Science). The construction of the cDNA library of NSCs and screening by signal sequence trap using yeast was carried out as described previously (18Jacobs K.A. Collins-Racie L.A. Colbert M. Duckett M. Golden-Fleet M. Kelleher K. Kriz R. LaVallie E.R. Merberg D. Spaulding V. Stover J. Williamson M.J. McCoy J.M. Gene (Amst.). 1997; 198: 289-296Crossref PubMed Scopus (0) Google Scholar). To obtain full-length SDNSF cDNAs from poly(A)+ RNA of ANSC cells and rat brain, 5′- and 3′-rapid amplification of cDNA ends methods with the Marathon kit (Clontech) were performed. From this sequence data of 5′ and 3′-rapid amplification of cDNA ends methods, the coding sequence of rat SDNSF was confirmed of RT-PCR using a set of primer pairs: 5′-GCGTCAGGGGGACGCAGCTGG-3′ and 5′-GTCAGCTCCGATTGCACAAATACTTGA-3′. Coding sequences of mouse and human were obtained from adult mouse brain total RNA and human heart total RNA (Clontech, Palo Alto, CA) with RT-PCR using two sets of primer pairs based on rat sequence data and on expressed sequence tag data from a data base search: 5′-GTGCGGAGAAAAGCGTCCCAG-3′ and 5′-TCCATTTTATTGTCAGATAGCCAGAGTTCA-3′, 5′-TGGTGAGGCCCGAGGCGTT-3′ and 5′-TCTTGGGTACGTCTTTATCAGCAGCAT-3′. The Northern analysis was performed essentially as described (35Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989: 7.39-7.52Google Scholar). Rat SDNSF and rat GAPDH (459–1001 of GenBank™ accession number M17701) cDNAs were labeled with [α-32P]dCTP by random priming. The filter for Northern analysis was prepared from 4 μg of poly(A)+ RNA prepared as above from following cells and tissues: ANSCs, adult rat brain, heart, lung, liver, spleen, kidney, testis, and skeletal muscle. The filter was hybridized using Quick-Hyb solution (Stratagene, La Jolla, CA). Blotting was analyzed using an image analyzer (BAS 2000, Fuji Film, Tokyo, Japan). For in situ hybridization, we used riboprobes for the in situ detection of mRNAs derived from rat SDNSF as described previously (36Houtani T. Nishi M. Takeshima H. Sato K. Sakuma S. Kakimoto S. Ueyama T. Noda T. Sugimoto T. J. Comp. Neurol. 2000; 424: 489-508Crossref PubMed Scopus (66) Google Scholar). One-kb cDNA fragments including coding region and 3′-noncoding region of the rat SDNSF were generated and subcloned into pGEM-T vector (Promega, Madison, WI). Digoxigenin-labeled sense and antisense rat SDNSF probes were generated with SP6 and T7 polymerases, respectively, using the digoxigenin RNA labeling kit (Roche Applied Science). For RT-PCR, total RNA was extracted using Trizol reagent from undifferentiated ANSCs, differentiated ANSCs, embryo NSCs, C6, N18, U251 cells; rat whole embryo at 8.5 days postcoitus (dpc) and 10.5; embryonic and postnatal rat brain from 12.5, 14.5, 16.5, and 18.5 dpc and P2, P4, and P7. Equal amounts of samples were subjected to RT-PCR as previously described (25Kobuke K. Furukawa Y. Sugai M. Tanigaki K. Ohashi N. Matsumori A. Sasayama S. Honjo T. Tashiro K. J. Biol. Chem. 2001; 276: 34105-34114Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). Each reaction was standardized against a GAPDH control to permit comparison between samples in each PCR. cDNA was generated SuperScript First-strand Synthesis System for RT-PCR (Invitrogen) and amplified by the gene-specific primers for rat SDNSF as above and for rat GAPDH: 5′-TGCATCCTGCACCACCAACT-3′ and 5′-CGCCTGCTTCACCACCTTC-3′. For semiquantitative RT-PCR (37Nakayama H. Yokoi H. Fujita J. Nucleic Acids Res. 1992; 20: 4939Crossref PubMed Scopus (158) Google Scholar), total RNA was extracted from ischemic hippocampi at two time points, postoperative day 1 and 7 with sham operated control (n = 6/time point), and synthesis of cDNA was performed as above using 1 μg of total RNA from each sample. Then cDNA was amplified in 50 μl of PCRs that contained 1.5 mm MgCl2, 0.2 mm dNTP mixture, 2.5 units of Taq DNA in PCR buffer (Invitrogen), and 0.5 μm gene-specific primers using i-Cycler™ (Bio-Rad) between 22 and 40 cycles using SDNSF and GAPDH primers as above. The resultant PCR products were electrophoresed in 1.5% agarose gel and stained with ethidium bromide, the fluorescent bands were scanned, and the volume density of SDNSF was then quantified using NIH Image 1.62. These conditions produced amplicons within the linear exponential phase of the PCR curve. The quantification of SDNSF were normalized with GAPDH by dividing time point band density by that of its matched PCR. Computer Analysis and Data Base Search—Sequencing was performed with an automated sequencer (model 377A; Applied Biosystems, Foster City, CA). Handling of all the nucleotide and amino acid sequence data and the construction of hydrophobicity profiles were performed with GenetyxMac Version 9.0 (Software Development, Tokyo, Japan). Sequence alignment was executed with ClustalX (38Thompson J.D. Gibson T.J. Plewniak F. Jeanmougin F. Higgins D.G. Nucleic Acids Res. 1997; 25: 4876-4882Crossref PubMed Scopus (35497) Google Scholar). BLAST and FASTA searches were performed at www.ncbi.nlm.nih.gov/blast/blast.cgi and www.fasta.genome.ad.jp/ideas/fasta/fasta_nr-aa.html, respectively. A motif search was done at www.motif.genome.ad.jp/. The nucleotide sequences reported in this paper has been submitted to the GenBank™/EBI Data Bank with accession numbers AF475282 (rat SDNSF), AF475283 (mouse SDNSF), and AF475284 (human SDNSF). Protein Analysis and Immunological Methods—Rat SDNSF was recloned into pEF-6V5-His (Invitrogen) with swapping the original V5 epitope to the FLAG epitope tag at the C terminus (pEF-His-FLAG) to generate FLAG fusion protein, SDNSF-C′ FLAG/His. We also inserted FLAG epitope tag at the predicted signal sequence cleavage site and constructed rat SDNSF-N′ FLAG fusion protein. The primer sequences for rat FLAG-SDNSF construction were 5′-GACTAGTCATGGCATCCCTGCAGCTGCTCAGAGGTCCCTTCCTGTGTGTTCTGCTCTGGGCCTTTTGTGTTCCTGGTGCCAGGGCCGACTACAAAGACGATGACGACAAGCAGG AGCATGGGGCTGGTGTCCACC-3′ and 5′-CTACTGCAGCGACTTGGCAAACTCT-3′. HEK293T cells and COS7 cells were transfected with these expression vectors pEF-SDNSF-C′ FLAG/His, pEF-SDNSF-N′ FLAG, or pEF-His-FLAG in serum-free DMEM/Ham's F-12 medium (1:1) with N2 supplement using CellPhect (Amersham Biosciences) and were treated with lysis buffer (150 mm NaCl, 1% Triton X-100, 10 mm Tris-HCl, 1 mm EDTA, 0.2 mm phenylmethylsulfonyl fluoride, 10 μg/ml aprotinin). The conditioned medium from these transfected HEK293T cells were filtered and concentrated with Centricon YM-10 (Millipore, Bedford, MA). SDNSF proteins were purified from the concentrated conditioned medium using Ni-NTA-agarose (Qiagen, Valencia, CA). According to the manufacturer's protocol with the slight modification of buffer concentrations as below, the concentrated conditioned mediums from pEF-SDNSF-C′ FLAG/His and from pEF-His-FLAG transfected HEK 293T cells cultures were purified under native conditions. We mixed 1 ml of the 50% Ni-NTA slurry to 2 ml concentrated conditioned medium and 2 ml of 2× lysis buffer (40 mm imidazole, 100 mm NaH2PO4, pH 8.0, 1 m NaCl) at 4 °C for 60 min, loaded this mix into a column, washed with 20 mm of imidazole buffer (20 mm imidazole, 100 mm NaH2PO4, pH 8.0, 500 mm NaCl) twice, then washed with 40 mm of imidazole buffer (40 mm imidazole, 100 mm NaH2PO4, pH 8.0, 500 mm NaCl) twice, and eluted in elution buffer (250 mm imidazole, 100 mm NaH2PO4, pH 8.0, 500 mm NaCl). After this purification step, the eluted samples and the concentrated conditioned medium were electrophoresed in 15% SDS-polyacrylamide gel, and the purity of SDNSF in eluted solution was determined from the densitometric analysis of silver-stained SDS-polyacrylamide gel and NIH Image 1.62 (National Institutes of Health, Bethesda, MD). The purified SDNSF protein was dialyzed with Slide-A-Lyzer (Pierce) overnight against phosphate-buffered saline at 4 °C. The protein concentrations were determined with Coomassie protein assay reagent (Pierce). We measured endotoxin/lipopolysaccharide activity by Toxicolor LS-6 (Seikagaku Corporation, Tokyo, Japan), and the concentration of endotoxin/lipopolysaccharide turned out to be under the detection limit. The similarly treated conditioned medium from pEF-His-FLAG transfected HEK293T cells transfected by pEF-His-FLAG was used as a control in the following SDNSF survival and proliferation assays. SDS-PAGE and Western analysis were carried out with these cell lysates and conditioned medium samples following ECL (Amersham Biosciences) Western blot protocols with using mouse 1:5,000 monoclonal anti-FLAG antibody (Sigma) and 1:5,000 anti-mouse IgG-horseradish peroxidase antibody (Sigma). The COS7 cells transfected with vectors pEF-SDNSF-C′ FLAG/His or pEF-His-FLAG and the other cells tested were fixed in 4% paraformaldehyde and examined with immunofluorescence staining or immunoelectron microscopy as described previously (6Palmer T.D. Ray J. Gage F.H. Mol. Cell Neurosci. 1995; 6: 474-486Crossref PubMed Scopus (567) Google Scholar, 21Nakamura T. Yabe D. Kanazawa N. Tashiro K. Sasayama S. Honjo T. Genomics. 1998; 54: 89-98Crossref PubMed Scopus (32) Google Scholar, 39Mizoguchi A. Yano Y. Hamaguchi H. Yanagida H. Ide C. Zahraoui A. Shirataki H. Sasaki T. Takai Y. Biochem. Biophys. Res. Commun. 1994; 202: 1235-1243Crossref PubMed Scopus (92) Google Scholar). The transfected COS7 cells were stained with anti-FLAG antibody 1:5,000 and anti-mouse IgG-fluorescein isothiocyanate antibody 1:500 (Jackson Laboratories, Bar Harbor, MA) for immunofluorescence or 1.4-nm gold particles-conjugated anti-mouse IgG, 1:1,000 (Nanoprobes, Yaphank, NY) for immunoelectron microscopy. The ANSCs were stained with monoclonal anti-nestin, 1:500 (Pharmingen, Palo Alto, CA); monoclonal anti-type III β-tubulin (Tuj-1), 1:5,000 (Convance, Richmond, CA); rabbit anti-NG2 Chondroitin Sulfate Proteoglycan, 1:500 (Chemicon); and guinea pig anti-GFAP, 1:1000 (Advanced ImmunoChemical, Long Beach CA) and then labeled with fluorophore-conjugated secondary antibodies; anti-mouse IgG, 1:500; anti-rabbit IgG, 1:500; and antiguinea pig IgG, 1:500. For counterstaining of nuclei, 4′-6-diamidino-2-phenylindole (Sigma) was used. The 45Ca2+ binding assay (40Maruyama K. Mikawa T. Ebashi S. J. Biochem. (Tokyo). 1984; 95: 511-519Crossref PubMed Scopus (628) Google Scholar) and mobility shift assay for calcium binding (41Terami H. Williams B.D. Kitamura S. Sakube Y. Matsumoto S. Doi S. Obinata T. Kagawa H. J. Cell Biol. 1999; 146: 193-202Crossref PubMed Scopus (39) Google Scholar) were performed as described. The membranes of the 45Ca2+ binding assay were analyzed using an image analyzer as above. Deglycosylation assay and lectin blot analysis was performed as described (42Scherer P.E. Lederkremer G.Z. Williams S. Fogliano M. Baldini G. Lodish H.F. J. Cell Biol. 1996; 133: 257-268Crossref PubMed Scopus (127) Google Scholar, 43Blochberger T.C. Sabatine J.M. Lee Y.C. Hughey R.P. J. Biol. Chem. 1989; 264: 20718-20722Abstract Full Text PDF PubMed Google Scholar). NSCs Viability Assays and Neurosphere Assay—To test the SDNSF effects on ANSCs and mouse ES R1 cells, purified SDNSF was added into the medium, and cell survival and proliferational activities were assessed. ANSCs were plated onto Nunc 96-well or six-well plates at the density of 1,000 cells/cm2 and cultured for 6 days in the serum-free growth medium minus FGF-2. SDNSF or FGF-2 were added at concentrations of 0, 0.1, 1, 10, 100, and 500 ng/ml. As a control, the same volume of similarly treated HEK293T cell conditioned medium as purified SDNSF was added in the control group medium. To test the possibility of SDNSF as a cofactor for FGF-2, ANSCs were cultured in FGF-2+ growth medium with 100 ng/ml of SDNSF. Undifferentiated mouse ES cells were placed in Costar ultra low cluster 96-well plates (Corning, Acton, MA) at the density of 1,000 cells/cm2 and cultured in medium with 100 ng/ml of SDNSF or same volume of control solutions and without leukemia inhibitory factor for 6 days. At DIV6 cell survival and/or proliferation effects were estimated by using premix WST-1 kit (Takara, Shiga, Japan), which is added to the growth medium and measures the number of viable cells and cell viability by detecting the cleavage of tetrazolium salts and mitochondrial enzyme activity as A 450 nm. Cell proliferation activity was estimated by BrdU uptake for 3 h at DIV4, which is shown as A 492 nm, using Cell Proliferation ELISA and by BrdU (colorimetric) kit (Roche Applied Science) according to the manufacturer's protocol; also by following clonal expansion of single GFP-labeled ANSC, SDNSF effects on proliferational activity were estimated. To test the self-renewal and differentiation potential of SDNSF-treated ANSCs, after ANSCs were cultured in the SDNSF+/FGF-2– medium (100 ng/ml of SDNSF without FGF-2) for 6 days, those ANSCs were replated on noncoated Nunc 48-well plates at the density of 2,000 cells/cm2 and grown for 6 days in growth medium containing 20 ng/ml of FGF-2, and the number of neurospheres were counted. To assess the differentiation potentials, the newly formed neurospheres were replated onto poly-l-ornithine/laminin-coated Labtek 4-well chamber slides (Nunc) at the density of 10–30 spheres/well and cultured in differentiation medium for further 6 days. Under confocal laser microscope or fluorescent microscope, positively stained cells were quantified at least 20 fields systematically across the coverslips from three to four independent experiments of parallel cultures. Analytical Procedures and Data Analysis—Group changes were assessed using one-way ANOVA. When statistical differences were obtained at the p < 0.01 level between groups, post hoc comparisons were made using the Fisher least squares difference (LSD) test. Isolation of Human, Rat, and Mouse SDNSF cDNA Clones— Yeast tr

Referência(s)