Portal de Periódicos da CAPES

Activation of peroxisome proliferator-activated receptor-alpha stimulates both differentiation and fatty acid oxidation in adipocytes

2011; Elsevier BV; Volume: 52; Issue: 5 Linguagem: Inglês

10.1194/jlr.m011320

1539-7262

Tsuyoshi Goto, Jooyoung Lee, Aki Teraminami, Yong‐Il Kim, Shizuka Hirai, Taku Uemura, Hiroyasu Inoue, Nobuyuki Takahashi, Teruo Kawada,

Metabolism, Diabetes, and Cancer

Peroxisome proliferator-activated receptor-α (PPARα) is a dietary lipid sensor, whose activation results in hypolipidemic effects. In this study, we investigated whether PPARα activation affects energy metabolism in white adipose tissue (WAT). Activation of PPARα by its agonist (bezafibrate) markedly reduced adiposity in KK mice fed a high-fat diet. In 3T3-L1 adipocytes, addition of GW7647, a highly specific PPARα agonist, during adipocyte differentiation enhanced glycerol-3-phosphate dehydrogenase activity, insulin-stimulated glucose uptake, and adipogenic gene expression. However, triglyceride accumulation was not increased by PPARα activation. PPARα activation induced expression of target genes involved in FA oxidation and stimulated FA oxidation. In WAT of KK mice treated with bezafibrate, both adipogenic and FA oxidation-related genes were significantly upregulated. These changes in mRNA expression were not observed in PPARα-deficient mice. Bezafibrate treatment enhanced FA oxidation in isolated adipocytes, suppressing adipocyte hypertrophy. Chromatin immunoprecipitation (ChIP) assay revealed that PPARα was recruited to promoter regions of both adipogenic and FA oxidation-related genes in the presence of GW7647 in 3T3-L1 adipocytes. These findings indicate that the activation of PPARα affects energy metabolism in adipocytes, and PPARα activation in WAT may contribute to the clinical effects of fibrate drugs. Peroxisome proliferator-activated receptor-α (PPARα) is a dietary lipid sensor, whose activation results in hypolipidemic effects. In this study, we investigated whether PPARα activation affects energy metabolism in white adipose tissue (WAT). Activation of PPARα by its agonist (bezafibrate) markedly reduced adiposity in KK mice fed a high-fat diet. In 3T3-L1 adipocytes, addition of GW7647, a highly specific PPARα agonist, during adipocyte differentiation enhanced glycerol-3-phosphate dehydrogenase activity, insulin-stimulated glucose uptake, and adipogenic gene expression. However, triglyceride accumulation was not increased by PPARα activation. PPARα activation induced expression of target genes involved in FA oxidation and stimulated FA oxidation. In WAT of KK mice treated with bezafibrate, both adipogenic and FA oxidation-related genes were significantly upregulated. These changes in mRNA expression were not observed in PPARα-deficient mice. Bezafibrate treatment enhanced FA oxidation in isolated adipocytes, suppressing adipocyte hypertrophy. Chromatin immunoprecipitation (ChIP) assay revealed that PPARα was recruited to promoter regions of both adipogenic and FA oxidation-related genes in the presence of GW7647 in 3T3-L1 adipocytes. These findings indicate that the activation of PPARα affects energy metabolism in adipocytes, and PPARα activation in WAT may contribute to the clinical effects of fibrate drugs. The prevalence of obesity has markedly increased over the last few decades not only in wealthy industrialized countries, but also in poor underdeveloped nations (1Ogden C.L. Yanovski S.Z. Carroll M.D. Flegal K.M. The epidemiology of obesity.Gastroenterology. 2007; 132: 2087-2102Abstract Full Text Full Text PDF PubMed Scopus (1156) Google Scholar). Obesity and overweight have adverse health effects and affect the risk and prognosis of many serious medical conditions, such as type 2 diabetes, coronary heart disease, high blood pressure, and some forms of cancer. Obesity causes excess fat accumulation not only in various tissues, particularly adipose tissues, but also in other insulin-responsive organs such as the skeletal muscle and liver, predisposing one to the development of insulin resistance (2Collins S. Overview of clinical perspectives and mechanisms of obesity.Birth Defects Res. A Clin. Mol. Teratol. 2005; 73: 470-471Crossref PubMed Scopus (28) Google Scholar, 3Mokdad A.H. Ford E.S. Bowman B.A. Dietz W.H. Vinicor F. Bales V.S. Marks J.S. Prevalence of obesity, diabetes, and obesity-related health risk factors, 2001.JAMA. 2003; 289: 76-79Crossref PubMed Scopus (4590) Google Scholar, 4Unger R.H. Orci L. Diseases of liporegulation: new perspective on obesity and related disorders.FASEB J. 2001; 15: 312-321Crossref PubMed Scopus (375) Google Scholar, 5van Herpen N.A. Schrauwen-Hinderling V.B. Lipid accumulation in non-adipose tissue and lipotoxicity.Physiol. Behav. 2008; 94: 231-241Crossref PubMed Scopus (368) Google Scholar). However, the molecular mechanisms underlying insulin resistance and obesity have not been fully clarified, and effective therapeutic approaches are currently of general interest. Peroxisome proliferator-activated receptors (PPAR) -α, -γ, and -δ are FA-activated nuclear transcription factors that control mRNA expression of numerous genes involved in energy metabolism (6Issemann I. Green S. Activation of a member of the steroid hormone receptor superfamily by peroxisome proliferators.Nature. 1990; 347: 645-650Crossref PubMed Scopus (3059) Google Scholar, 7Evans R.M. Barish G.D. Wang Y.X. PPARs and the complex journey to obesity.Nat. Med. 2004; 10: 355-361Crossref PubMed Scopus (1293) Google Scholar, 8Cho M.C. Lee K. Paik S.G. Yoon D.Y. Peroxisome proliferators-activated receptor (PPAR) modulators and metabolic disorders.PPAR Res. 2008; (Vol. 2008, 14 pages; doi:10.1155/2008/679137)Crossref PubMed Scopus (78) Google Scholar). In particular, PPARα is expressed mostly in tissues with high rates of FA oxidation and peroxisomal metabolism (9Lefebvre P. Chinetti G. Fruchart J.C. Staels B. Sorting out the roles of PPAR alpha in energy metabolism and vascular homeostasis.J. Clin. Invest. 2006; 116: 571-580Crossref PubMed Scopus (754) Google Scholar), such as the liver, brown fat, and heart (10Kersten S. Desvergne B. Wahli W. Roles of PPARs in health and disease.Nature. 2000; 405: 421-424Crossref PubMed Scopus (1678) Google Scholar, 11Hashimoto T. Cook W. Qi C. Yeldandi A. Reddy J. Rao M. Defect in peroxisome proliferator-activated receptor alpha-inducible fatty acid oxidation determines the severity of hepatic steatosis in response to fasting.J. Biol. Chem. 2000; 275: 28918-28928Abstract Full Text Full Text PDF PubMed Scopus (356) Google Scholar, 12Minnich A. Tian N. Byan L. Bilder G. A potent PPAR agonist stimulates mitochondrial fatty acid-oxidation in liver and skeletal muscle.Am. J. Physiol. Endocrinol. Metab. 2001; 280: E270-E279Crossref PubMed Google Scholar). In these tissues, PPARα regulates mRNA expression of genes involved in FA oxidation, and synthetic PPARα agonists, such as fibrates, decrease circulating lipid levels and are commonly used to treat hyperlipidemia and other dyslipidemic states (9Lefebvre P. Chinetti G. Fruchart J.C. Staels B. Sorting out the roles of PPAR alpha in energy metabolism and vascular homeostasis.J. Clin. Invest. 2006; 116: 571-580Crossref PubMed Scopus (754) Google Scholar, 13Schoonjans K. Staels B. Auwerx J. Role of the peroxisome proliferator-activated receptor (PPAR) in mediating the effects of fibrates and fatty acids on gene expression.J. Lipid Res. 1996; 37: 907-925Abstract Full Text PDF PubMed Google Scholar). PPARα-deficient (PPARα−/−) mice exhibit higher levels of serum triglyceride (TG) (14Akiyama T.E. Nicol C.J. Fievet C. Staels B. Ward J.M. Auwerx J. Lee S.S. Gonzalez F.J. Peters J.M. Peroxisome proliferator-activated receptor-alpha regulates lipid homeostasis, but is not associated with obesity: studies with congenic mouse lines.J. Biol. Chem. 2001; 276: 39088-39093Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar). Moreover, these mice show extensive hepatic lipid accumulation and increased gonadal adipose storage and plasma FFA levels (15Kersten S. Seydoux J. Peters J.M. Gonzalez F.J. Desvergne B. Wahli W. Peroxisome proliferator-activated receptor alpha mediates the adaptive response to fasting.J. Clin. Invest. 1999; 103: 1489-1498Crossref PubMed Scopus (1371) Google Scholar). In addition, the presence of severe hypoketonemia, hypoglycemia, and hypothermia in PPARα−/− mice clearly supports a function of PPARα in metabolic regulation. Previous studies showed that adipose tissue dysfunction plays an important role in the development of obesity and obesity-associated diseases (16Cawthorn W.P. Sethi J.K. TNF-alpha and adipocyte biology.FEBS Lett. 2008; 582: 117-131Crossref PubMed Scopus (571) Google Scholar, 17Stern N. Osher E. Greenman Y. Hypoadiponectinemia as a marker of adipocyte dysfunction–part II: the functional significance of low adiponectin secretion.J. Cardiometab. Syndr. 2007; 2: 288-294Crossref PubMed Scopus (23) Google Scholar). Adipose tissue also participates in the regulation of energy homeostasis as an important endocrine organ that secretes many biologically active molecules called adipocytokines (16Cawthorn W.P. Sethi J.K. TNF-alpha and adipocyte biology.FEBS Lett. 2008; 582: 117-131Crossref PubMed Scopus (571) Google Scholar, 17Stern N. Osher E. Greenman Y. Hypoadiponectinemia as a marker of adipocyte dysfunction–part II: the functional significance of low adiponectin secretion.J. Cardiometab. Syndr. 2007; 2: 288-294Crossref PubMed Scopus (23) Google Scholar, 18Matsuzawa Y. The metabolic syndrome and adipocytokines.FEBS Lett. 2006; 580: 2917-2921Crossref PubMed Scopus (448) Google Scholar, 19Kadowaki T. Hara K. Yamauchi T. Terauchi Y. Tobe K. Nagai R. Molecular mechanism of insulin resistance and obesity.Exp. Biol. Med. (Maywood). 2003; 228: 1111-1117Crossref PubMed Scopus (163) Google Scholar). The secretion pattern of adipocytokines is closely related to adipocyte condition (18Matsuzawa Y. The metabolic syndrome and adipocytokines.FEBS Lett. 2006; 580: 2917-2921Crossref PubMed Scopus (448) Google Scholar). Small adipocytes secrete insulin-sensitizing hormones such as adiponectin, although hypertrophied adipocytes exhibit low expression levels of these factors but increased expression levels of hormones related to insulin resistance, such as such as tumor necrosis factor-α (TNFα), monocyte chemoattractant protein-1 (MCP-1), and interleukin-6 (IL-6), resulting in insulin resistance observed in obesity (19Kadowaki T. Hara K. Yamauchi T. Terauchi Y. Tobe K. Nagai R. Molecular mechanism of insulin resistance and obesity.Exp. Biol. Med. (Maywood). 2003; 228: 1111-1117Crossref PubMed Scopus (163) Google Scholar). Indeed, thiazolidinediones (TZD), insulin sensitizers, promote differentiation of preadipocytes by PPARγ activation to increase the number of small adipocytes and to decrease the number of hypertrophied adipocytes by promoting apoptosis (20Yamauchi T. Kamon J. Waki H. Murakami K. Motojima K. Komeda K. Ide T. Kubota N. Terauchi Y. Tobe K. The mechanisms by which both heterozygous peroxisome proliferator-activated receptor gamma (PPARgamma) deficiency and PPARgamma agonist improve insulin resistance.J. Biol. Chem. 2001; 276: 41245-41254Abstract Full Text Full Text PDF PubMed Scopus (567) Google Scholar). Besides their hypolipidemic effects, PPARα activators attenuate adiposity in animal models of obesity and type-2 diabetes mellitus (21Guerre-Millo M. Gervois P. Raspé E. Madsen L. Poulain P. Derudas B. Herbert J.M. Winegar D.A. Willson T.M. Fruchart J.C. Peroxisome proliferator-activated receptor alpha activators improve insulin sensitivity and reduce adiposity.J. Biol. Chem. 2000; 275: 16638-16642Abstract Full Text Full Text PDF PubMed Scopus (549) Google Scholar, 22Tsuchida A. Yamauchi T. Takekawa S. Hada Y. Ito Y. Maki T. Kadowaki T. Peroxisome proliferator-activated receptor (PPAR)alpha activation increases adiponectin receptors and reduces obesity-related inflammation in adipose tissue: comparison of activation of PPARalpha, PPARgamma, and their combination.Diabetes. 2005; 54: 3358-3370Crossref PubMed Scopus (367) Google Scholar). Recently, several studies have shown that PPARα is expressed in the adipose tissue of humans and rodents, indicating that adipose tissue might also be a target organ of PPARα activators (22Tsuchida A. Yamauchi T. Takekawa S. Hada Y. Ito Y. Maki T. Kadowaki T. Peroxisome proliferator-activated receptor (PPAR)alpha activation increases adiponectin receptors and reduces obesity-related inflammation in adipose tissue: comparison of activation of PPARalpha, PPARgamma, and their combination.Diabetes. 2005; 54: 3358-3370Crossref PubMed Scopus (367) Google Scholar, 23Hiuge A. Tenenbaum A. Maeda N. Benderly M. Kumada M. Fisman E.Z. Tanne D. Matas Z. Hibuse T. Fujita K. Effects of peroxisome proliferator-activated receptor ligands, bezafibrate and fenofibrate, on adiponectin level.Arterioscler. Thromb. Vasc. Biol. 2007; 27: 635-641Crossref PubMed Scopus (120) Google Scholar, 24Loviscach M. Rehman N. Carter L. Mudaliar S. Mohadeen P. Ciaraldi T.P. Veerkamp J.H. Henry R.R. Distribution of peroxisome proliferator-activated receptors (PPARs) in human skeletal muscle and adipose tissue: relation to insulin action.Diabetologia. 2000; 43: 304-311Crossref PubMed Scopus (153) Google Scholar, 25Guzman M. Lo Verme J. Fu J. Oveisi F. Blazquez C. Piomelli D. Oleoylethanolamide stimulates lipolysis by activating the nuclear receptor peroxisome proliferator-activated receptor alpha (PPAR-alpha).J. Biol. Chem. 2004; 279: 27849-27854Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar). Hiuge et al. demonstrated that fibrates directly and transcriptionally increase adiponectin expression level via adipose PPARα (23Hiuge A. Tenenbaum A. Maeda N. Benderly M. Kumada M. Fisman E.Z. Tanne D. Matas Z. Hibuse T. Fujita K. Effects of peroxisome proliferator-activated receptor ligands, bezafibrate and fenofibrate, on adiponectin level.Arterioscler. Thromb. Vasc. Biol. 2007; 27: 635-641Crossref PubMed Scopus (120) Google Scholar). Furthermore, it was suggested that PPARα ligands directly stimulate lipolysis in wild-type (WT) adipocytes, but this effect is not observed in PPARα-deficient adipocytes (25Guzman M. Lo Verme J. Fu J. Oveisi F. Blazquez C. Piomelli D. Oleoylethanolamide stimulates lipolysis by activating the nuclear receptor peroxisome proliferator-activated receptor alpha (PPAR-alpha).J. Biol. Chem. 2004; 279: 27849-27854Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar). These previous findings indicate that PPARα functions in adipocytes. However, the role of PPARα in adipose tissue is not fully understood. In this study, we investigated whether PPARα activation affects the energy metabolism in white adipose tissue (WAT). Treatment with bezafibrate, a PPARα agonist, markedly attenuated adiposity in WT mice but not in PPARα−/− mice fed a high-fat diet (HFD). Both genetic and HFD-induced obesity decreased PPARα mRNA expression level, and fasting increased the expression level in WAT. PPARα activation promoted both adipocyte differentiation and FA oxidation in 3T3-L1 adipocytes. These effects were also observed in vivo, which resulted in the enhancement of whole-body oxygen consumption and suppression of adipocyte hypertrophy. These findings indicate that the pharmacological activation of PPARα affects energy metabolism in adipocytes and that the PPARα activation in WAT may contribute to the clinical effects of fibrate drugs. All the mice were maintained in a temperature-controlled (23°C) facility with a constant 12 h light/dark cycle and free access to water. For the analysis of organ PPARα expression levels, 8-week-old male C57BL/6 mice (CLEA Japan, Tokyo, Japan) were fed a standard diet (CRF-1, Charles River Japan, Tokyo, Japan). Non-fasted, fasted (24 h), and fasted (24 h)/refed (24 h) C57BL/6 mice were used before euthanization. After euthanization, their tissues were harvested for RNA isolation. The harvested tissues were immediately frozen in liquid nitrogen and stored at −80°C until use. We used male C57BL/6 mice fed either the standard diet or 60% HFD (D12492 Research Diet, MO) for 12 months for the diet-induced obese model mice. Male ob/ob mice and lean control mice (age 12 weeks from Charles River Japan) received a standard diet for genetically obese mice. To investigate the effect of the PPARα agonist on adipose tissue metabolism, we used KK mice or WT and PPARα−/− mice with a Sv/129 genetic background. Five-week-old male KK (CLEA Japan) mice were maintained for five to eight weeks either on HFD or on HFD containing 0.2% bezafibrate. The energy intake of all mice was adjusted by pair-feeding. Five to eight weeks after feeding, the mice were subjected to analyses of their oxygen consumption, locomotor activity, oral glucose tolerance test (OGTT), insulin tolerance test (ITT), mRNA expression, FA oxidation in isolated adipocytes, and histological features. Eight-week-old WT and PPARα−/− mice were fed HFD or HFD containing 0.2% bezafibrate for six weeks. The same amount of food was given to all mice. Ten h after fasting, tissues were harvested for RNA analysis. The animal care procedures and methods were approved by the Animal Care Committee of Kyoto University. To analyze the oxygen consumption of mice, male KK mice fed HFD or HFD containing 0.2% bezafibrate for five weeks were used. The oxygen consumption rate (OCR) of mice under the fed condition was measured using an indirect calorimetric system (Oxymax, Columbus Instruments, OH) every 9 min for 20 h. The measurements started at 9:00 PM and ended at 6:00 PM (both the dark and light phases were 10 h). Male KK mice were maintained for five weeks either on HFD or HFD containing 0.2% bezafibrate. For OGTT, d-glucose (2 g/kg body weight) was administered through a gastric feeding tube after overnight fasting. For ITT, human insulin (Eli Lilly Japan, Kobe, Japan) was injected intraperitoneally (0.6 units/kg body weight) into nonfasted animals. Blood samples were collected from the tail vein before and 30, 60, 90, and 120 min after injection. Plasma glucose level was determined by the glucose C-test Wako (Wako Pure Chemicals, Osaka, Japan) in accordance with the manufacturer's protocols. Epididymal WAT was removed from each animal, fixed in 10% formaldehyde/PBS, and maintained at 4°C until use. The fixed samples were embedded in paraffin. They were cut into 12 µm sections using a microtome and mounted on silanized slides. Adipocyte size distribution was determined using National Institutes of Health (NIH) Image J software. To prepare stromal-vascular (SV) cells and adipocytes from WAT, epididymal WAT from male mice was removed under sterile conditions and washed in KRH buffer (20 mM HEPES, 140 mM NaCl, 5 mM KCl, 2.5 mM MgSO4, 1 mM CaCl2; pH 7.4). Minced tissue was transferred to a sterile polypropylene tube containing collagenase (1 mg/ml, type II, Sigma) and 1% FA-free BSA (BSA). After incubation at 37°C for 45 min with shaking, the digested tissue was filtered through a sterile 250 μm nylon mesh. The digested tissue was centrifuged at 200 g for 2 min, and mature adipocytes and SV cells were collected. Both cell types were washed twice by centrifugation using KRH buffer containing 1% FA-free BSA. After washing, cells were subjected to each assay. 3T3-L1 murine preadipocytes (from American Type Culture Collection, Manassas, VA) were cultured as previously described (26Takahashi N. Goto T. Taimatsu A. Egawa K. Kato S. Kusudo T. Sakamoto T. Ohyane C. Lee J.Y. Kim Y.I. Bixin regulates mRNA expression involved in adipogenesis and enhances insulin sensitivity in 3T3–L1 adipocytes through PPARgamma activation.Biochem. Biophys. Res. Commun. 2009; 390: 1372-1376Crossref PubMed Scopus (81) Google Scholar). Human multipotent adipose tissue-derived stem cells were cultured as previously reported (27Rodriguez A.M. Elabd C. Delteil F. Astier J. Vernochet C. Saint-Marc P. Guesnet J. Guezennec A. Amri E.Z. Dani C. Adipocyte differentiation of multipotent cells established from human adipose tissue.Biochem. Biophys. Res. Commun. 2004; 315: 255-263Crossref PubMed Scopus (255) Google Scholar). Cells 14 days after the induction of differentiation were used as mature adipocytes. A PCR fragment coding mouse PPARα obtained by RT-PCR using total liver RNA from C57BL/6 mice was inserted into the site between BamHI and NotI of pMX-puro (a kind gift from Dr. T. Kitamura, University of Tokyo, Tokyo, Japan) (pMX-PPARα). The PCR primers used were as follows: the 5′-primer, TTTGGATCCATGGTGGACACAGAGAGCCCCATC; and the 3′-primer, TTTGCGGCCGCTCAGTACATGTCTCTGTAGATCTCTTGC. Plat-E cells (kindly provided by Dr. Naohito Aoki, Mie University, Tsu, Japan) were cultured in a growth medium at 37°C in 5% CO2. The pMX-PPARα was transfected into Plat-E packaging cells using Lipofectamine2000 (Invitrogen, CA) in accordance with the manufacturer's instructions. Viral supernatants were harvested 48 h after transfection. Viral supernatants were applied to 3T3-L1 cells in the growth medium supplemented with 5 μg/ml polybrene. To eliminate uninfected cells, the medium was replaced with a growth medium containing 2.5 μg/ml puromycin. The level of uptake of 2-deoxy-d-[1,2-3H]glucose (2-DG) was measured as previously described (26Takahashi N. Goto T. Taimatsu A. Egawa K. Kato S. Kusudo T. Sakamoto T. Ohyane C. Lee J.Y. Kim Y.I. Bixin regulates mRNA expression involved in adipogenesis and enhances insulin sensitivity in 3T3–L1 adipocytes through PPARgamma activation.Biochem. Biophys. Res. Commun. 2009; 390: 1372-1376Crossref PubMed Scopus (81) Google Scholar). Briefly, 10 days after differentiation induction, 3T3-L1 cells were deprived of serum by incubation for 5 h in 12-well plates containing DMEM. The cells were then incubated with 100 nM insulin for 20 min in 450 µl of KRH buffer containing 1% FA-free BSA. Glucose uptake was initiated by adding 50 µl KRH buffer containing 1 mM 2-deoxy-d-[1,2-3H]glucose (1 µCi) (American Radiolabeled Chemicals, MO) to each well, and after 10 min, uptake was terminated by washing the cells three times with ice-cold PBS buffer. The cells were solubilized with 0.1N NaOH, and incorporated radioactivity was measured by liquid scintillation counting. The radioactivity was normalized to protein content determined by the method of Bradford (Bio-Rad Laboratories, CA). Ten days after differentiation induction, 3T3-L1 cells overexpressing PPARα (L1-PPARα) or control cells (L1-Mock) were incubated in DMEM containing 0.2 mM palmitic acid, 2.5% FA-free BSA, 200 μM l-carnitine, and [14C]palmitic acid (1 μCi/ml) (American Radiolabeled Chemicals) for 16 h. FA oxidation products were assessed as previously described (28Lewin T.M. Wang S. Nagle C.A. Van Horn C.G. Coleman R.A. Mitochondrial glycerol-3-phosphate acyltransferase-1 directs the metabolic fate of exogenous fatty acids in hepatocytes.Am. J. Physiol. Endocrinol. Metab. 2005; 288: E835-E844Crossref PubMed Scopus (49) Google Scholar) with modification. Briefly, the labeling medium was collected and centrifuged, and the supernatant was transferred to a 50-ml polypropylene tube. An uncapped Eppendorf tube containing a piece of filter paper soaked in benzethonium hydroxide was placed inside a 50 ml tube. After the tube was sealed, 200 μl of 70% perchloric acid was added to the medium sample to release [14C]CO2. The tube was then shaken at 37°C for 1 h. The saturated filter paper containing trapped [14C]CO2 was assessed for radioactivity in a liquid scintillation counter. The acidified medium was centrifuged twice to remove particulate matter, and 200 μl of supernatant was assessed for the amount of [14C]labeled acid-soluble FA metabolites (ASM). FA oxidation with isolated adipocytes was analyzed as previously described (29Wilson-Fritch L. Nicoloro S. Chouinard M. Lazar M.A. Chui P.C. Leszyk J. Straubhaar J. Czech M.P. Corvera S. Mitochondrial remodeling in adipose tissue associated with obesity and treatment with rosiglitazone.J. Clin. Invest. 2004; 114: 1281-1289Crossref PubMed Scopus (383) Google Scholar). In brief, isolated adipocytes were prepared from epididymal WAT and washed in KRH with 1% BSA. A fresh buffer was added to the cells at a volume twice the packed cell volume. Tubes containing cells and buffer were inverted several times to obtain a homogenous mixture, and equal aliquots of each sample were distributed into 50 ml polystyrene tubes. [14C]palmitic acid was added at a final concentration of 1 μCi/ml. The tubes with a piece of filter paper soaked in benzethonium hydroxide were then sealed and incubated at 37°C for 2 h. The tubes were gently shaken every 30 min during the incubation. After 2 h, 12 M HCl was added to the cells to release [14C]CO2, and each tube was resealed and incubated at 37°C overnight. The amount of [14C]CO2 released was measured by scintillation counting of the filter paper. Radioactivity was normalized to genomic DNA content in each packed cell. Packed cells were incubated overnight with proteinase K (150 μg/ml). Genomic DNA was purified using phenol/chloroform, and its content was quantified by measuring the absorbance at 260 nm. Cellular OCR was measured using a Seahorse Bioscience XF24 analyzer (30Wu M. Neilson A. Swift A.L. Moran R. Tamagnine J. Parslow D. Armistead S. Lemire K. Orrell J. Teich J. Multiparameter metabolic analysis reveals a close link between attenuated mitochondrial bioenergetic function and enhanced glycolysis dependency in human tumor cells.Am. J. Physiol. Cell Physiol. 2007; 292: C125-C136Crossref PubMed Scopus (728) Google Scholar) in 24-well plates at 37°C, with correction for positional temperature variations adjusted from 4 empty wells evenly distributed within the plate. L1-Mock or L1-PPARα cells were induced to differentiate and were maintained for 10 days with or without the PPARα agonist GW7647. Immediately before the measurement, cells were washed, and 675 μl of nonbuffered (sodium-carbonate-free) pH 7.4 DMEM medium supplemented with 0.2 mM palmitic acid, 0.2 mM l-carnitine, and 2% FA-free BSA was added to each well. After a 15 min equilibration period, four successive 1.5 min measurements were performed at 7 min intervals with intermeasurement mixing to homogenize the oxygen concentration in the medium. Rotenone (final concentration of 100 nM) was injected to each well using the internal injectors of the cartridge, and four successive 1.5 min measurements were performed at 7 min intervals with intermeasurement mixing. To determine intracellular TG amount, 3T3-L1 cells grown in 12-well plates were washed with PBS, and lipids were extracted by hexane-isopropyl alcohol (3:2, v/v) for 1 h at room temperature. Aliquots were transferred and evaporated under a decreased pressure. Samples were resuspended in 10% TritonX-100 in isopropyl alcohol, and TG content was measured enzymatically using triglyceride G test Wako (Wako Pure Chemicals). For Oil Red O staining, 3T3-L1 cells 10 days after the induction of differentiation were fixed with 10% formaldehyde/PBS and stained with Oil Red O solution [0.5% Oil Red O-isopropyl alcohol/H2O (3:2, v/v)]. Cells were washed twice with PBS and collected with a cell scraper into 25 mM Tris-HCl (pH 7.4) containing 1 mM EDTA. The harvested cells were sonicated for 5 s at 40 watts with a microson ULTRASONIC CELL DISRUPTOR (Misonix, Inc., NY). After centrifugation at 12,800 g for 5 min at 4°C, the supernatants were assayed for glycerol-3-phosphate dehydrogenase (GPDH) activity as described elsewhere (31Takahashi N. Kawada T. Yamamoto T. Goto T. Taimatsu A. Aoki N. Kawasaki H. Taira K. Yokoyama K.K. Kamei Y. Overexpression and ribozyme-mediated targeting of transcriptional coactivators CREB-binding protein and p300 revealed their indispensable roles in adipocyte differentiation through the regulation of peroxisome proliferator-activated receptor gamma.J. Biol. Chem. 2002; 277: 16906-16912Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). Total RNA was prepared from mouse tissues or cultured 3T3-L1 and human multipotent adipose tissue-derived stem adipocytes using Qiazol lysis reagent (QIAGEN, CA) or Sepasol(R)-RNA I Super (Nacalai Tesuque) in accordance with the manufacturer's protocol. Total RNA was reverse-transcribed using M-MLV reverse transcriptase (Promega, WI) in accordance with the manufacturer's instructions using a thermal cycler (Takara PCR Thermal Cycler SP, Takara, Shiga, Japan). To visualize and compare the expression levels of PPARα and 36B4, semiquantitative PCR was performed. PCR amplification was performed with denaturation at 94°C for 20 s, annealing at 60°C for 40 s, and polymerization at 72°C for 20 s. PCR was performed for 35 cycles. PCR products were electrophoresed on 2% agarose gels and stained with ethidium bromide. To quantify mRNA expression, real-time RT-PCR was performed with a LightCycler System (Roche Diagnostics, Mannheim, Germany) using SYBR Green fluorescence signals as described previously (31Takahashi N. Kawada T. Yamamoto T. Goto T. Taimatsu A. Aoki N. Kawasaki H. Taira K. Yokoyama K.K. Kamei Y. Overexpression and ribozyme-mediated targeting of transcriptional coactivators CREB-binding protein and p300 revealed their indispensable roles in adipocyte differentiation through the regulation of peroxisome proliferator-activated receptor gamma.J. Biol. Chem. 2002; 277: 16906-16912Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar, 32Takahashi N. Kawada T. Goto T. Yamamoto T. Taimatsu A. Matsui N. Kimura K. Saito M. Hosokawa M. Miyashita K. Dual action of isoprenols from herbal medicines on both PPARgamma and PPARalpha in 3T3–L1 adipocytes and HepG2 hepatocytes.FEBS Lett. 2002; 514: 315-322Crossref PubMed Scopus (197) Google Scholar, 33Goto T. Takahashi N. Kato S. Egawa K. Ebisu S. Moriyama T. Fushiki T. Kawada T. Double dioxygenation by mouse 8S-lipoxygenase: specific formation of a potent peroxisome proliferator-activated receptor alpha agonist.Biochem. Biophys. Res. Commun. 2005; 338: 136-143Crossref PubMed Scopus (15) Google Scholar, 34Kuroyanagi K. Kang M.S. Goto T. Hirai S. Ohyama K. Kusudo T. Yu R. Yano M. Sasaki T. Takahashi N. Citrus auraptene acts as an agonist for PPARs and enhances adiponectin production and MCP-