Synthetic Zinc Finger Transcription Factor Action at an Endogenous Chromosomal Site
2000; Elsevier BV; Volume: 275; Issue: 43 Linguagem: Inglês
10.1074/jbc.m005341200
ISSN1083-351X
AutoresLei Zhang, S. Kaye Spratt, Qiang Liu, Brian H. Johnstone, Hong Qi, Eva Raschke, Andrew C. Jamieson, Edward J. Rebar, Alan P. Wolffe, Casey C. Case,
Tópico(s)RNA Research and Splicing
ResumoWe have targeted the activation of an endogenous chromosomal locus including the human erythropoietin gene using synthetic transcription factors. These transcription factors are targeted to particular DNA sequences in the 5′-flanking region of the erythropoietin gene through engineering of a zinc finger DNA binding domain. The DNA binding domain is linked to a VP16 transcriptional activation domain. We find that these synthetic transcription factors invariably activate transiently transfected templates in which sequences within the 5′ flank of the erythropoietin gene are fused to a luciferase reporter. The efficiency of activation under these circumstances at a defined site is dependent on DNA binding affinity. In contrast, only a subset of these same zinc finger proteins is able to activate the endogenous chromosomal locus. The activity of these proteins is influenced by their capacity to gain access to their recognition elements within the chromatin infrastructure. Zinc finger transcription factors will provide a powerful tool to probe the determinants of chromatin accessibility and remodeling within endogenous chromosomal loci. We have targeted the activation of an endogenous chromosomal locus including the human erythropoietin gene using synthetic transcription factors. These transcription factors are targeted to particular DNA sequences in the 5′-flanking region of the erythropoietin gene through engineering of a zinc finger DNA binding domain. The DNA binding domain is linked to a VP16 transcriptional activation domain. We find that these synthetic transcription factors invariably activate transiently transfected templates in which sequences within the 5′ flank of the erythropoietin gene are fused to a luciferase reporter. The efficiency of activation under these circumstances at a defined site is dependent on DNA binding affinity. In contrast, only a subset of these same zinc finger proteins is able to activate the endogenous chromosomal locus. The activity of these proteins is influenced by their capacity to gain access to their recognition elements within the chromatin infrastructure. Zinc finger transcription factors will provide a powerful tool to probe the determinants of chromatin accessibility and remodeling within endogenous chromosomal loci. transcription factor IIIA base pair(s) polymerase chain reaction oligonucleotide cytomegalovirus β-galactosidase phosphate-buffered saline zinc finger protein erythropoietin human embryonic kidney doxycycline enzyme-linked immunosorbent assay glyceraldehyde-3-phosphate dehydrogenase erythropoietin-directed zinc finger proteins The enormous progress in our understanding of gene control in eukaryotes using model systems presents substantial opportunities to apply this knowledge for therapeutic benefit in man. The rational design and engineering of components of the transcriptional machinery provide a powerful means to test conventional paradigms for the roles of protein-DNA and protein-protein interactions in gene regulation. These designer transcription factors may also provide novel means of regulating endogenous chromosomal loci for a variety of beneficial purposes. Over the past decade, the primary structural determinants of DNA recognition by zinc fingers of the Cys2-His2 type have been elucidated (1Desjarais J.R. Berg J.M. Proteins Struct. Funct. Genet. 1992; 12: 101-104Crossref PubMed Scopus (83) Google Scholar, 2Desjarais J.R. Berg J.M. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 2256-2260Crossref PubMed Scopus (202) Google Scholar, 3Rebar E.J. Pabo C.O. Science. 1994; 263: 671-673Crossref PubMed Scopus (387) Google Scholar, 4Jamieson A.C. Kim S.-H. Wells J.A. Biochemistry. 1994; 33: 5689-5695Crossref PubMed Scopus (212) Google Scholar, 5Choo Y. Klug A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 11163-11167Crossref PubMed Scopus (324) Google Scholar, 6Wu H. Yang W.-P. Barbas III, C.F. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 344-348Crossref PubMed Scopus (185) Google Scholar, 7Jamieson A.C. Wang H. Kim S.-H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12834-12839Crossref PubMed Scopus (99) Google Scholar, 8Greisman H.A. Pabo C.O. Science. 1997; 275: 657-661Crossref PubMed Scopus (352) Google Scholar). Designer transcriptional regulators containing three or more zinc finger domains have been used in isolation (9Choo Y. Sanchez-Garcia I. Klug A. Nature. 1994; 372: 642-645Crossref PubMed Scopus (246) Google Scholar, 10Kim J.-S. Pabo C.O. J. Biol. Chem. 1997; 272: 29795-29800Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar) or following linkage to transcriptional activation (9Choo Y. Sanchez-Garcia I. Klug A. Nature. 1994; 372: 642-645Crossref PubMed Scopus (246) Google Scholar, 11Kim J.-M. Kim J. Cepek K.L. Sharp P.A. Pabo C.O. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3616-3620Crossref PubMed Scopus (54) Google Scholar, 12Beerli R.R. Segal D.J. Dreier B. Barbas III, C.F. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14628-14633Crossref PubMed Scopus (420) Google Scholar, 13Beerli R.R. Dreier B. Barbas III, C.F. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1495-1500Crossref PubMed Scopus (309) Google Scholar) or repression domains (12Beerli R.R. Segal D.J. Dreier B. Barbas III, C.F. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14628-14633Crossref PubMed Scopus (420) Google Scholar,13Beerli R.R. Dreier B. Barbas III, C.F. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1495-1500Crossref PubMed Scopus (309) Google Scholar). These novel proteins control the transcription of reporter genes both transiently transfected into human cells (9Choo Y. Sanchez-Garcia I. Klug A. Nature. 1994; 372: 642-645Crossref PubMed Scopus (246) Google Scholar, 11Kim J.-M. Kim J. Cepek K.L. Sharp P.A. Pabo C.O. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3616-3620Crossref PubMed Scopus (54) Google Scholar, 12Beerli R.R. Segal D.J. Dreier B. Barbas III, C.F. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 14628-14633Crossref PubMed Scopus (420) Google Scholar, 13Beerli R.R. Dreier B. Barbas III, C.F. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1495-1500Crossref PubMed Scopus (309) Google Scholar) and endogenous chromosomal loci (9Choo Y. Sanchez-Garcia I. Klug A. Nature. 1994; 372: 642-645Crossref PubMed Scopus (246) Google Scholar, 13Beerli R.R. Dreier B. Barbas III, C.F. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1495-1500Crossref PubMed Scopus (309) Google Scholar). Exactly how these regulatory functions are exerted remains to be resolved. An important issue in considering transcription factor function in eukaryotes is the capacity of the regulator to gain access to specific sites in chromatin and recruit transcriptional co-activators and co-repressors that modify the chromatin environment (14Wolffe A.P. Hayes J.J. Nucleic Acids Res. 1999; 27: 711-720Crossref PubMed Scopus (439) Google Scholar). These issues have been investigated for the archetypal Cys2-His2 zinc finger protein and transcriptional regulator TFIIIA1 (15–26). There is general agreement that the nucleosome can impede recognition of specific promoter elements by TFIIIA (15Gottesfeld J. Bloomer L.S. Cell. 1982; 28: 781-791Abstract Full Text PDF PubMed Scopus (94) Google Scholar, 17Tremethick D. Zucker D. Worcel A. J. Biol. Chem. 1990; 265: 5014-5023Abstract Full Text PDF PubMed Google Scholar, 18Ura K. Hayes J.J. Wolffe A.P. EMBO J. 1995; 14: 3752-3765Crossref PubMed Scopus (157) Google Scholar, 19Panetta G. Buttinelli M. Flaus A. Richmond T.J. Rhodes D. J. Mol. Biol. 1998; 282: 683-697Crossref PubMed Scopus (54) Google Scholar, 20Hayes J.J. Wolffe A.P. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1229-1233Crossref PubMed Scopus (100) Google Scholar, 21Tse C. Fletcher T.M. Hansen J.C. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12169-12173Crossref PubMed Scopus (33) Google Scholar, 22Lee D.Y. Hayes J.J. Pruss D. Wolffe A.P. Cell. 1993; 72: 73-84Abstract Full Text PDF PubMed Scopus (967) Google Scholar, 23Vitolo J.M. Thiriet C. Hayes J.J. Mol. Cell. Biol. 2000; 20: 2167-2175Crossref PubMed Scopus (57) Google Scholar, 24Bouvet P. Dimitrov S. Wolffe A.P. Genes Dev. 1994; 8: 1147-1159Crossref PubMed Scopus (210) Google Scholar, 25Chipev C.C. Wolffe A.P. Mol. Cell. Biol. 1992; 12: 45-55Crossref PubMed Scopus (61) Google Scholar, 26Sera T. Wolffe A.P. Mol. Cell. Biol. 1998; 18: 3668-3680Crossref PubMed Google Scholar) and that modification of histone-DNA interactions through nucleosome repositioning (18Ura K. Hayes J.J. Wolffe A.P. EMBO J. 1995; 14: 3752-3765Crossref PubMed Scopus (157) Google Scholar, 19Panetta G. Buttinelli M. Flaus A. Richmond T.J. Rhodes D. J. Mol. Biol. 1998; 282: 683-697Crossref PubMed Scopus (54) Google Scholar), histone depletion (20Hayes J.J. Wolffe A.P. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 1229-1233Crossref PubMed Scopus (100) Google Scholar, 21Tse C. Fletcher T.M. Hansen J.C. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12169-12173Crossref PubMed Scopus (33) Google Scholar), and removal of the histone tails (22Lee D.Y. Hayes J.J. Pruss D. Wolffe A.P. Cell. 1993; 72: 73-84Abstract Full Text PDF PubMed Scopus (967) Google Scholar, 23Vitolo J.M. Thiriet C. Hayes J.J. Mol. Cell. Biol. 2000; 20: 2167-2175Crossref PubMed Scopus (57) Google Scholar) can promote TFIIIA binding to a nucleosomal infrastructure. Accumulation of histone H1 in chromatin can specifically interfere with TFIIIA function in vivo (24Bouvet P. Dimitrov S. Wolffe A.P. Genes Dev. 1994; 8: 1147-1159Crossref PubMed Scopus (210) Google Scholar, 25Chipev C.C. Wolffe A.P. Mol. Cell. Biol. 1992; 12: 45-55Crossref PubMed Scopus (61) Google Scholar) in a process that involves the repositioning of nucleosomes (25Chipev C.C. Wolffe A.P. Mol. Cell. Biol. 1992; 12: 45-55Crossref PubMed Scopus (61) Google Scholar, 26Sera T. Wolffe A.P. Mol. Cell. Biol. 1998; 18: 3668-3680Crossref PubMed Google Scholar). These studies demonstrate the role of chromatin infrastructure access by transcription regulators containing zinc finger DNA binding domains of the Cys2-His2 type. In this work, we first designed 10 novel zinc finger DNA binding domains to recognize specific 9-bp sequences in the 5′ flank of the erythropoietin gene and characterized their unique DNA recognition selectivities and variable affinities for DNA. These zinc finger domains were then linked to the VP16 transcriptional activation domain (27Triezenberg S.J. Kingsbury R.C. McKnight S.L. Genes Dev. 1988; 2: 718-729Crossref PubMed Scopus (596) Google Scholar) and tested for their capacity to activate transcription in both transient transfections and from endogenous chromosomal loci. Our results indicate that all of our synthetic regulators that bind DNAin vitro with dissociation constants <10 nm can activate transiently transfected templates. This activation of a particular site is dependent on DNA binding affinity. In contrast, only a subset of the synthetic regulators can activate the endogenous chromosomal locus. We find that the regulators that work in the endogenous chromosome can bind within the chromatin infrastructure, but that the differential binding of distinct regulators at a particular site is largely independent of primary DNA binding affinity. These studies indicate that chromosome and chromatin organization is a determinant of zinc finger transcription factor function within endogenous chromosomal loci. The foundation for our design strategy was to scan 1000 bp of the 5′-flanking sequences of the human erythropoietin (EPO) gene to choose the best candidate recognition elements for which to design zinc finger DNA binding domains. The human transcription factor Sp1 (amino acids 532–624) was used as the backbone to assemble 10 distinct zinc finger DNA binding domains. The design determinants of these proteins will be described elsewhere 2A. C. Jamieson, Q. Liu, E. J. Rebar, manuscript in preparation.; however, the amino acid sequences chosen to recognize particular sequences are illustrated in Table I. Our strategy to synthesize the zinc finger DNA binding domains is outlined in Fig. 1. To create the synthetic genes encoding EPO-directed zinc finger proteins (EPOZFPs), a polymerase chain reaction (PCR)-based assembly procedure was applied using six overlapping oligonucleotides. Three oligonucleotides for the zinc finger coding sequences encode portions of the DNA binding domain containing the β sheet and linker regions between the α-helical DNA recognition sequences of the Sp1 zinc finger DNA binding domain scaffold (Fig. 1 A, oligos 1, 3, and 5). The other three oligonucleotides encode the recognition helices (oligos 2, 4, and 6). The overlap between adjacent oligonucleotides is 15 base pairs. The PCR synthesis was carried out in two steps (Fig. 1 B). First, the double-stranded DNA template was created by combining the six oligos and filling the gaps with a four-cycle PCR reaction (usingTaq and Pfu thermostable DNA polymerases). The annealing temperature was 25 °C, a temperature at which the six oligos would anneal to form a DNA scaffold. In the second phase of construction, the template was amplified using a pair or external primers containing KpnI and BamHI restriction sites. The PCR products were directly cloned into the Tac promoter vector, pMal-c2 (New England Biolabs, Beverly, MA), usingKpnI and BamHI restriction sites. The zinc finger proteins were purified as fusions with the maltose-binding protein (Fig. 1 C) according to the manufacturer's instructions (New England Biolabs, Beverly, MA). The purified ZFPs (see Fig.2 A) were tested for their affinities for the DNA recognition sites within the 5′ flank of the EPO gene. DNA oligonucleotides 30 base pairs in length that contain the various sites were synthesized, annealed, and end-labeled using polynucleotide kinase and [γ-32P]ATP. Binding of the ZFPs to target oligonucleotides was performed by titrating protein against a fixed amount of duplex substrate. Twenty-μl binding reactions contained 50 pm 5′-32P-labeled double-stranded target DNA, 10 mm Tris-HCl (pH 7.5), 100 mm KCl, 1 mm MgCl2, 1 mm dithiothreitol, 10% glycerol, 200 μg/ml bovine serum albumin, 0.02% Nonidet P-40, and 100 μm ZnCl2. Binding was allowed to proceed for 45 min at room temperature. Polyacrylamide gel electrophoresis was carried out at room temperature using precast 10% or 10–20% Tris-HCl gels (Bio-Rad) and Tris-glycine running buffer (25 mmTris-HCl, 192 mm glycine (pH 8.3)). The radioactive signals were quantitated with a PhosphorImager and autoradiographed. Once the DNA binding properties of the zinc finger DNA binding domains had been tested, these domains were subcloned into eukaryotic expression vectors. The vector used was generated based upon a ZFP-less expression vector pcDNA-NVF, which was modified from pcDNA3.1 (Invitrogen). pcDNA-NVF contains a CMV promoter driving expression of the coding sequence encoding a nuclear localization signal (Pro-Lys-Lys-Lys-Arg-Lys-Val) from SV40 large T antigen, a herpes simplex virus VP16 activation domain (amino acids 413–490), and a Flag peptide (Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys). All of the ZFP expression vectors were constructed by subcloning of the ZFP fragments into theKpnI and BamHI sites in pcDNA-NVF (see Fig.5 A). pEPOZFP−862c-NF plasmid is similar to EPOZFP−862c, except that the VP16 transactivation domain was removed. The pBS579 construct, which was used as a negative control, encodes a nonspecific ZFP gene.Table IThe designs of the EPO-binding ZFPsNameTarget sequence 5′ → 3′Subsites 5′ → 3′Designs −1 → +6F1GCTcQSSDLQREPOZFP−862aGCGGTGGCTcF2GTGgRSDALSRF3GCGgRSDERKRF1GCTcQSSDLQREPOZFP−862bGCGGTGGCTcF2GTGgRSDALSRF3GCGgRSDTLKKF1GCTcQSSDLTREPOZFP−862cGCGGTGGCTcF2GTGgRSDALSRF3GCGgRSDERKRF1GAGtRSDNLAREPOZFP−545aGGTGAGGAGtF2GAGgRSDNLARF3GGTgDSSKLSRF1GAGtRSDNLAREPOZFP−545bGGTGAGGAGtF2GAGgRSDNLARF3GGTgMSDHLSRF1GGGaRSDHLAREPOZFP−535GAGGTGGGGaF2GTGgRSDALSRF3GAGgRSDNLSRF1GCGgRADTLRREPOZFP−233TGGGTCGCGgF2GTCgDRSALARF3TGGgRSDHLTTF1GAGaRSDNLAREPOZFP−82GTGGGGGAGaF2GGGgRSDHLSRF3GTGgRSDALARF1GGGgRSDHLAREPOZFP−72GCGGGTGGGgF2GGTgQSSHLARF3GCGgRSDDLTRF1GGGtKTSHLRASp1GGGGCGGGGtF2GCGgRSDELQRF3GGGgRSDHLSKF1GCGtRSDELTRZif268GCGTGGGCGtF2TGGgRSDHLTTF3GCGtRSDERKR Open table in a new tab Figure 2The properties of EPOZFPs. A, schematic representation of the human EPO gene, showing key structural features. Horizontal arrow, start of transcription; open rectangle, coding region;hatched boxes, Alu elements; black boxes, targeted sequences, sites 1, 2, 3, and 4;wavy lines, CpG island. Abbreviations are as follows: Ba, BamHI; X,XbaI; Bg, BglII; PstI;HRE, hypoxic response element. Numbering is relative to the start site of transcription (+1). The targeted sites and the positions of the first nucleotide in the sequences is shown at thebottom. B, the protein gel shows all the purified EPOZFP, Sp1, and Zif268 proteins. The proteins were expressed as maltose-binding fusion proteins and purified as described (see "Experimental Procedures"). The leftmost lanecontains size markers. C, gel-shift assays using the various EPOZFPs binding to their target sites. The name of each EPOZFP is indicated by the number in the top left-hand corner of each gel panel. Proteins are used to bind to their targets in 2-fold serial dilutions, with the highest protein concentration in lane 2, and the lowest concentration in lane 16 fromleft to right. Lane 1 is a control lane containing radiolabeled DNA alone. The equilibrium dissociation constants of each EPOZFP are indicated at thetop of each panel.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 5The relationship of DNA binding affinity to transcriptional activation for EPOZFP−862c on transiently transfected DNA. A, schematic representation of the experiment. The organization of the EPOZFP−862 protein is shown. In this experiment the stably integrated EPOZFP−862c gene was induced by Dox in 293 cells. The expressed EPOZFP−862 protein binds to the transiently transfected luciferase reporter gene whose activity is dependent on three tandem copies of the EPOZFP−862 target sequence. The perfect EPOZFP−862 target sequence and mutant versions of this sequence to which EPOZFP−862 binds with varying affinity were inserted into the luciferase reporter construct and the capacity of EPOZFP−862 protein to activate these reporters quantitated relative to CMV-driven β-gal as a control. B, luciferase assays versusEPOZFP−862c. The individual reporter constructs as indicated were transfected into the T-Rex EPOZFP−862c stably transformed 293 cells. After 24 h of induction with Dox (0.05 μg/ml), the activities of the luciferase and internal control β-gal were measured. The normalized luciferase activities were graphed against the correspondingKd values, which are represented on a log scale. Standard deviations are shown.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Human embryonic kidney cells (HEK293) were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. To generate stable Tet-inducible EPOZFP cell lines, the coding region from the pEPOZFP−862 cDNA was subcloned into pcDNA4/TO (Invitrogen) using AflIII and HindIII restriction sites. The resulting pTO-EPOZFP−862 construct was transfected into the T-Rex-293TM (Invitrogen) cell line using LipofectAMINE (Life Technologies, Inc.). After 2 weeks of selection in medium containing ZeocinTM (Invitrogen), stable clones were isolated and analyzed for doxycycline (Dox)-dependent activation of ZFP expression. The luciferase reporter constructs were generated by annealing two complementary oligonucleotides in an annealing buffer containing 50 mm NaCl, 10 mm Tris-HCl, 10 mmMgCl2, 1 mm dithiothreitol. The oligo mixture was heated at 95 °C for 5 min and allowed to cool down slowly to room temperature. The annealed oligonucleotides containing three tandem repeats of the ZFP target sequences were inserted into the pGL3 promoter vector (Promega) between the MluI andBglII sites upstream of the SV40 promoter. All constructs were confirmed by DNA sequencing. Transient transfection was carried out using LipofectAMINE. Luciferase reporter assays were performed by co-transfection of ZFP effector DNA (50 ng), luciferase reporter DNA (900 ng), and pCMV-β-gal (100 ng, used as an internal control) into HEK293 cells seeded in six-well plates. Cell lysates were harvested 40 h after transfection, and the luciferase activities were measured by the Dual-Light luciferase and β-galactosidase reporter assay system (Tropix). To assay the activation of the endogenous chromosomal EPO gene, we made use of established procedures to carry out Northern analysis of EPO mRNA. Briefly, poly(A)+ RNA was isolated from either mock-transfected or pcV-EPOZFP−862-transfected HEK293 cells using the Oligotex kit (Qiagen, Valencia, CA). 7 μg were resolved on a 2.4% agarose gel containing 2.4 m formaldehyde and blotted onto Nytran SuPerCharge membrane using 20× SSC. The membrane was hybridized at 65 °C for 1 h in Rapid-Hyb Buffer (Amersham Pharmacia Biotech) containing 32P-labeled EPO cDNA probe. The same membrane was re-hybridized with a 32P-labeled GAPDH DNA probe after stripping the EPO probe. The EPO cDNA construct, pcEPO was generated by inserting a human EPO cDNA fragment obtained by PCR amplification into the pcDNA3.1 vector (Invitrogen) at theXbaI and EcoRI sites. The clone was confirmed by sequencing. The pTBAHVP16 plasmid, which was used to generate riboprobes for detection of both human β-actin and ZFP genes, was generated by inserting the VP16 fragment from the pcDNANVF vector into the pTRI-β-actin-125-human vector (Ambion, Austin, TX). The pcDNA-NVF DNA was digested with XhoI, repaired with Klenow enzyme, and digested again with BamHI. The TRI-β-actin vector was digested with SmaI andBamHI. For Taqman analysis of mRNA abundance, total cellular RNA from transfected HEK293 cells was isolated using the RNeasy kit (Qiagen, Valencia, CA). Real time PCR analysis (Taqman) was performed in a 96-well format on an ABI 7700 SDS machine (Perkin Elmer) and analyzed with SDS version 1.6.3 software. RNA samples (25 ng) were mixed with 0.3 μm each primer, 0.1 μm probe, 5.5 mm MgCl2 and 0.3 mm each dNTP, 0.625 unit of AmpliTaq Gold RNA polymerase, 6.25 units of Multiscribe reverse transcriptase, and 5 units of RNase inhibitor in Taqman buffer A from Perkin Elmer. The reverse transcription was performed at 48 °C for 30 min. After denaturing at 95 °C for 10 min, PCR amplification reactions were conducted for 40 cycles at 95 °C for 15 s and at 60 °C for 1 min. The EPO primer and probe set (GACTGTGTGCTCTGTGCACT, CTCTCAAAGTGCTGGGATTGCA, FAM-TGAGCCACCGCACCCAGCCCCCA-TAMRA) and the VP16 primer and probe set (CATGACGATTTCGATCTGGA, CTACTTGTCATCGTCGTCCTTG, FAM-ATCGGTAAACATCTGCTCAAACTCGA-TAMRA) were used to measure the human EPO and ZFP expression levels, respectively. The GAPDH primer and probe set (CCTTTTGCAGACCACAGTCCA, GCAGGGATGATGTTCTGGAGA, FAM-CACTGCCACCCAGAAGACTGTGG-TAMRA) were used to monitor the internal control GAPDH mRNA. The abundance of expressed ZFPs was controlled for at both the RNA level as described above, but also by Western blotting. This analysis was performed by resolving 10 μg of whole cell lysates on a 10–20% Tris-HCl polyacrylamide gel containing SDS. Proteins were transferred onto a nitrocellulose membrane using 1× SDS, 20% Methanol, and then the filter was blocked using 5% nonfat dry milk for 1 h at room temperature. Blotting was done with anti-Flag M2 monoclonal antibody (Sigma) diluted 1:1000 in 5% (w/v) nonfat dry milk, 0.1% PBS-Tween) for 1 h at room temperature. Subsequently, an anti-mouse horseradish peroxidase conjugate (Amersham Pharmacia Biotech) was used at a 1:3000 dilution in 5% (w/v) nonfat dry milk, 0.1% PBS-Tween for 1 h at room temperature. All washes were done in 0.1% PBS-Tween. The protein bands were detected by the ECL system (Amersham Pharmacia Biotech). Endogenous EPO expression was assayed either in response to transient transfection with ZFP effectors or in response to the induction of pEPOZFP−862a following stable transformation. Assays were performed at the indicated time after transfection. Either RNA was extracted as indicated above, or the culture medium was harvested for measurement of secreted EPO protein using the human EPO ELISA kit (R&D Systems, Minneapolis, MN). Chromatin immunoprecipitation was performed using a ChIP assay kit according to the instructions from the manufacturer (Upstate Biotechnology, Inc., Lake Placid, NY). Approximately 2 million cells were cross-linked with 1% formaldehyde for 10 min, washed with PBS, and lysed in lysis buffer. The cell lysate was sonicated on ice, resulting in a DNA fragment length of approximately 500 bp. After removing cell debris by centrifugation, immunoprecipitation was performed in ChIP dilution buffer overnight with 3 μg of VP16 1–21 antibody (Santa Cruz) or 10 μg of anti acetylated H3 antibody (Upstate Biotechnology). The antibodies were collected with Protein A-agarose and washed. The cross-linking was reversed by incubation at 65 °C for 4 h in the presence of 200 mm NaCl. The DNA was recovered by phenol/chloroform extraction and the abundance of particular sequences quantitated using real time PCR with the ABI 7700 sequence detector from Perkin Elmer/Applied Biosystems as described above. The standard Taqman reagents and the universal thermal cycling parameters were used (10 min at 95 °C, followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C). The primers had the following sequences: −1838F, TGGTACATCTGGTGCATTGTTG; 1838R, AAATAATAGACACACACAAGATAGTGAAAGC; −927F, ACACCACAGGTCAAATAAACAGATG; −927R, ACTTTTAGTGCACAGAGCACACAGT; −363F, GGCTTCCAGACCCAGCTACATT; −363R, GGTCTTGGGCGGAGACTCA; +538F, GTGCCAGTGGAGAGGAAGCT; +538R, CAAACTTCAATCCTGGTGTGACA; +6839F, TGGGAGTACAGGCGTGAGC; +6839R, GGGAAAATGATGAAAGAGAAATCAA; hGAPDH-F, GACATCAAGAAGGTGGTGAAG; hGAPDH-R, AGCTTGACAAAGTGGTCGTTG. The Taqman probes were labeled with FAM at the 5′ end and with TAMRA at the 3′end. They had the following sequences: −1834P, AAGGCGGTGACCCCCCTGGAC; −927P, CATTGTGCAGGACACACATGCACCTTG; −363P, CGGAACTCAGCAACCCAGGCATCT; +538P, TGGGCGCTGGAGCCACCACTTA; +6839P ACCGCGCCAGCCCGTGTC; hGAPDH-P, CACTGAGCACCAGGTGGTCTCCT. For nuclease digestion, nuclei were isolated from HEK293 cells essentially as described (25Chipev C.C. Wolffe A.P. Mol. Cell. Biol. 1992; 12: 45-55Crossref PubMed Scopus (61) Google Scholar). The nuclei were resuspended at 10,000/μl in digestion buffer. This suspension was aliquoted (100 μl) into tubes and digested with nuclease for 5 min at 22 °C. DNase I or micrococcal nuclease (Worthington) was added at 0, 5, 10, 20, or 40 units/ml for nuclei or 100-fold lower concentrations for naked DNA. The reaction was stopped by adding Qiagen buffer AL, followed by proteinase K treatment and purification (DNAeasy kit, Qiagen). The recovered DNA was digested to completion overnight at 37 °C with the indicated restriction endonuclease and then concentrated by ethanol precipitation. The entire sample is loaded onto an agarose gel of 1–2%, before electrophoresis and transfer to a Nytran membrane (Schleicher & Schuell). Indirect end labeling was used to detect the sites of nuclease cleavage. Hybridization was carried out in Rapid Hyb buffer (Amersham Pharmacia Biotech) using PCR-amplified genomic DNA fragments as indicated. The DNA probes were radiolabeled with [α-32P]dCTP to a specific activity of 106 cpm/ng DNA. Hybridization and subsequent washings were performed at 65 °C. Membranes were visualized in the PhosphorImager. We made use of existing information concerning the recognition of specific sequences by zinc finger domains to design 10 proteins that we predicted would recognize sequences in the 5′ flank of the human EPO gene. The strategy for assembly is illustrated in Fig. 1, and the details of design are summarized in TableI. The details of design and selection of zinc fingers capable of recognizing particular DNA sequences will be described in detail elsewhere.2 The positions of the sequences within the human EPO gene that are targeted by our ZFP designs are illustrated in Fig.2 A. The ZFPs were designed to bind at four sites; site 1 and site 2 flank an Alu element. Alu elements are known to position nucleosomes (28Englander E.W. Wolffe A.P. Howard B.H. J. Biol. Chem. 1993; 268: 19565-19573Abstract Full Text PDF PubMed Google Scholar, 29Englander E.W. Howard B.H. J. Biol. Chem. 1995; 270: 10091-10096Abstract Full Text Full Text PDF PubMed Scopus (90) Google Scholar); we chose these flanking sites because we wished to avoid sites within the presumed position of stable histone-DNA interactions. Sites 3 and 4 were located −72 to −300 bp from the transcription start site (+1). We wished to introduce ZFPs here because they would be adjacent to a known region (−61 to −45 bp) important in the regulation of the human EPO gene (30Gupta M. Goldwasser E. Nucleic Acids Res. 1995; 24: 4768-4774Crossref Scopus (19) Google Scholar). We expressed these diverse zinc finger proteins in recombinant form and purified them (Fig. 2 B). In the nomenclature that we use to describe these proteins, each of which interacts with 9 bp of DNA, the number after the prefix EPOZFP delineates the position of the first nucleotide of the recognition sequence relative to the transcription start site (+1). Thus, EPOZFP−862 describes a zinc finger protein that binds to a 9-bp sequence that is positioned −862 bp to the 5′ of the transcription start site. Where there are multiple designs to particular sequence, this is indicated by, e.g., −862a, −862b, and −862c (see Table I). The
Referência(s)