Portal de Periódicos da CAPES

Expression of simian CETP in normolipidemic Fisher rats has a profound effect on large sized apoE-containing HDL

2002; Elsevier BV; Volume: 43; Issue: 12 Linguagem: Inglês

10.1194/jlr.m200253-jlr200

1539-7262

Zoulika Zak, Laurent Lagrost, Thomas Gautier, David Masson, Valérie Deckert, Linda Duverneuil, Jean-Paul Paı̈s de Barros, Naïg Le Guern, Laure Dumont, Martina Schneider, Valérie Risson, Philippe Moulin, Delphine Autran, Gillian Brooker, J Sassard, Alain Bataillard,

Liver Disease Diagnosis and Treatment

In order to investigate the direct effect of cholesteryl ester transfer protein (CE22285) on the structure and composition of HDL in vivo, simian CETP was expressed in Fisher rat that spontaneously displays high plasma levels of HDL1. In the new CETPTg rat line, the production of active CETP by the liver induced a significant 48% decrease in plasma HDL cholesterol, resulting in a 34% decrease in total cholesterol level (P < 0.01 in both cases). Among the various plasma HDL subpopulations, the largest HDL were those mostly affected by CETP, with a 74% decrease in HDL1 versus a significantly weaker 38% decrease in smaller HDL2 (P < 0.0001). Apolipoprotein E (apoE)-containing HDL1 were selectively affected by CETP expression, whereas apoA content of HDL remained unmodified. The reduction in the apoE content of serum HDL observed in CETPTg rats compared to controls (53%, P < 0.02) suggests that apoE in HDL may constitute in vivo a major determinant of their ability to interact with CETP.These results bring new insight into the lack of HDL1 in plasma from CETP-deficient heterozygotes despite their substantial 50% decrease in CETP activity. In addition, they indicate that HDL1 constitute reliable and practicable sensors of very low plasma CETP activity in vivo. In order to investigate the direct effect of cholesteryl ester transfer protein (CE22285) on the structure and composition of HDL in vivo, simian CETP was expressed in Fisher rat that spontaneously displays high plasma levels of HDL1. In the new CETPTg rat line, the production of active CETP by the liver induced a significant 48% decrease in plasma HDL cholesterol, resulting in a 34% decrease in total cholesterol level (P < 0.01 in both cases). Among the various plasma HDL subpopulations, the largest HDL were those mostly affected by CETP, with a 74% decrease in HDL1 versus a significantly weaker 38% decrease in smaller HDL2 (P < 0.0001). Apolipoprotein E (apoE)-containing HDL1 were selectively affected by CETP expression, whereas apoA content of HDL remained unmodified. The reduction in the apoE content of serum HDL observed in CETPTg rats compared to controls (53%, P < 0.02) suggests that apoE in HDL may constitute in vivo a major determinant of their ability to interact with CETP. These results bring new insight into the lack of HDL1 in plasma from CETP-deficient heterozygotes despite their substantial 50% decrease in CETP activity. In addition, they indicate that HDL1 constitute reliable and practicable sensors of very low plasma CETP activity in vivo. Cholesteryl ester transfer protein (CETP) is a plasma glycoprotein that catalyzes an hetero-exchange of cholesteryl esters (CE) and triglycerides (TG) between HDL and apolipoprotein B (apoB) containing lipoproteins (1Bruce C. Chouinard Jr., R.A. Tall A.R. Plasma lipid transfer proteins, high-density lipoproteins, and reverse cholesterol transport.Annu. Rev. Nutr. 1998; 18: 297-330Google Scholar, 2Lagrost L. Regulation of cholesteryl ester transfer protein (CETP) activity: review of in vitro and in vivo studies.Biochim. Biophys. Acta. 1994; 1215: 209-236Google Scholar). Over the last decade, considerable speculations have been emitted on the pro- or anti-atherogenic properties of CETP. Recently, the experimental blockade of CETP in cholesterol-fed rabbits, an animal species with elevated CETP activity and high atherosclerosis susceptibility, by the use of either antisense oligonucleotides (3Sugano M. Makino N. Changes in plasma lipoprotein cholesterol levels by antisense oligodeoxynucleotides against cholesteryl ester transfer protein in cholesterol-fed rabbits.J. Biol. Chem. 1996; 271: 19080-19083Google Scholar, 4Sugano M. Makino N. Sawada S. Otsuka S. Watanabe M. Okamoto H. Kamada M. Mizushima A. Effect of antisense oligonucleotides against cholesteryl ester transfer protein on the development of atherosclerosis in cholesterol-fed rabbits.J. Biol. Chem. 1998; 273: 5033-5036Google Scholar), chemical inhibitors (5Okamoto H. Yonemori F. Wakitani K. Minowa T. Maeda K. Shinkai H. A cholesteryl ester transfer protein inhibitor attenuates atherosclerosis in rabbits.Nature. 2000; 406: 203-207Google Scholar), or vaccination (6Rittershaus C.W. Miller D.P. Thomas L.J. Picard M.D. Honan C.M. Emmett C.D. Pettey C.L. Adari H. Hammond R.A. Beattie D.T. Callow A.D. Marsh H.C. Ryan U.S. Vaccine-induced antibodies inhibit CETP activity in vivo and reduce aortic lesions in a rabbit model of atherosclerosis.Arterioscler. Thromb. Vasc. Biol. 2000; 20: 2106-2112Google Scholar) led to a significant decrease in the extent of atherosclerotic lesions. In the mouse, a CETP-deficient species (7Jiao S. Cole T.G. Kitchens R.T. Pfleger B. Schonfeld G. Genetic heterogeneity of lipoproteins in inbred strains of mice: analysis by gel-permeation chromatography.Metabolism. 1990; 39: 155-160Google Scholar), the pro- or antiatherogenic effects of the expression of high levels of human or simian CETP were dependent on the concomitant overexpression of other genes involved in plasma lipoprotein metabolism (8Agellon L.B. Walsh A. Hayek T. Moulin P. Jiang X.C. Shelanski S.A. Breslow J.L. Tall A.R. Reduced high density lipoprotein cholesterol in human cholesteryl ester transfer protein transgenic mice.J. Biol. Chem. 1991; 266: 10796-10801Google Scholar, 9Hayek T. Chajek-Shaul T. Walsh A. Agellon L.B. Moulin P. Tall A.R. Breslow J.L. An interaction between the human cholesteryl ester transfer protein (CETP) and apolipoprotein A-I genes in transgenic mice results in a profound CETP-mediated depression of high density lipoprotein cholesterol levels.J. Clin. Invest. 1992; 90: 505-510Google Scholar, 10Hayek T. Masucci-Magoulas L. Jiang X. Walsh A. Rubin E. Breslow J.L. Tall A.R. Decreased early atherosclerotic lesions in hypertriglyceridemic mice expressing cholesteryl ester transfer protein transgene.J. Clin. Invest. 1995; 96: 2071-2074Google Scholar, 11Foger B. Chase M. Amar M.J. Vaisman B.L. Shamburek R.D. Paigen B. Fruchart-Najib J. Paiz J.A. Koch C.A. Hoyt R.F. Brewer Jr., H.B. Santamarina-Fojo S. Cholesteryl ester transfer protein corrects dysfunctional high density lipoproteins and reduces aortic atherosclerosis in lecithin cholesterol acyltransferase transgenic mice.J. Biol. Chem. 1999; 274: 36912-36920Google Scholar). In the Dahl hyperlipidemic and hypertensive rat, another CETP deficient species, CETP expression produced a significant rise in atherogenic lesions (12Herrera V.L. Makrides S.C. Xie H.X. Adari H. Krauss R.M. Ryan U.S. Ruiz-Opazo N. Spontaneous combined hyperlipidemia, coronary heart disease and decreased survival in Dahl salt-sensitive hypertensive rats transgenic for human cholesteryl ester transfer protein.Nat. Med. 1999; 5: 1383-1389Google Scholar). Finally, studies in CETP-deficient patients did not clarify the point as to whether CETP is a pro- or antiatherogenic factor, depending on the population and the metabolic context studied (13Hirano K. Yamashita S. Matsuzawa Y. Pros and cons of inhibiting cholesteryl ester transfer protein.Curr. Opin. Lipidol. 2000; 11: 589-596Google Scholar). Besides its long-term effect on atherogenesis, CETP also exerts a strong and direct effect on HDL structure and composition. In this context, and from a metabolic point of view, the mouse and rabbit present some limitations, with large HDL1 particles representing only minor components in these species. Thus, at least for HDL purposes, the rat seems to constitute one of the most relevant models of human CETP deficiency. Indeed, and as observed in wild-type rats, plasma from patients with homozygous CETP deficiency contains large-sized, apoE-containing, and cholesteryl ester-rich HDL1 (14Yamashita S. Sprecher D.L. Sakai N. Matsuzawa Y. Tarui S. Hui D.Y. Accumulation of apolipoproteinE-rich high density lipoproteins in hyperalphalipoproteinemic human subjects with plasma cholesteryl ester transfer protein deficiency.J. Clin. Invest. 1990; 86: 688-695Google Scholar, 15Bisgaier C.L. Siebenkas M.V. Brown M.L. Inazu A. Koizumi J. Mabuchi H. Tall A.R. Familial cholesteryl ester transfer protein deficiency is associated with triglyceride-rich low density lipoproteins containing cholesteryl esters of probable intracellular origin.J. Lipid Res. 1991; 32: 21-33Google Scholar, 16Arai T. Tsukada T. Murase T. Matsumoto K. Particle size analysis of high density lipoproteins in patients with genetic cholesteryl ester transfer protein deficiency.Clin. Chim. Acta. 2000; 301: 103-117Google Scholar). Interestingly, HDL1, unlike smaller HDL2 and HDL3, are no more detectable in CETP-deficient heterozygotes with 50% decrease in CETP activity compared to control subjects (16Arai T. Tsukada T. Murase T. Matsumoto K. Particle size analysis of high density lipoproteins in patients with genetic cholesteryl ester transfer protein deficiency.Clin. Chim. Acta. 2000; 301: 103-117Google Scholar), suggesting an early and selective action of CETP on HDL1. Although infusion of partially purified human CETP in rats allowed us to document its role in the metabolism of HDL, abnormally high doses were injected, and the overexpression was only transient, not exceeding a few hours (17Ha Y.C. Chang L.B. Barter P.J. Effects of injecting exogenous lipid transfer protein into rats.Biochim. Biophys. Acta. 1985; 833: 203-210Google Scholar, 18Quig D.W. Zilversmit D.B. Disappearance and effects of exogenous lipid transfer activity in rats.Biochim. Biophys. Acta. 1986; 879: 171-178Google Scholar). Thus, the latter experimental protocol was not appropriate to the determination of the physiological impact of a controlled and persistent CETP expression as it actually occurs in humans, rabbits, or CETP-transgenic lines. To date, only one study addressed the effect of CETP expression in the rat and the consequence of elevated CETP expression was studied in combination with polygenic hypertension as an additional risk factor in order to accelerate the effect of the transgene on atherogenesis (12Herrera V.L. Makrides S.C. Xie H.X. Adari H. Krauss R.M. Ryan U.S. Ruiz-Opazo N. Spontaneous combined hyperlipidemia, coronary heart disease and decreased survival in Dahl salt-sensitive hypertensive rats transgenic for human cholesteryl ester transfer protein.Nat. Med. 1999; 5: 1383-1389Google Scholar). As a consequence, non-transgenic hypertensive rats already displayed an abnormal rise in the total cholesterol (TC) to HDL cholesterol (HDL-C) ratio as compared to other normolipidemic and normotensive genetic backgrounds (12Herrera V.L. Makrides S.C. Xie H.X. Adari H. Krauss R.M. Ryan U.S. Ruiz-Opazo N. Spontaneous combined hyperlipidemia, coronary heart disease and decreased survival in Dahl salt-sensitive hypertensive rats transgenic for human cholesteryl ester transfer protein.Nat. Med. 1999; 5: 1383-1389Google Scholar, 19Chapman M.J. Animal lipoproteins: chemistry, structure, and comparative aspects.J. Lipid Res. 1980; 21: 789-853Google Scholar). Most importantly, the Dahl salt-sensitive hypertensive rats with low HDL levels did not mimic the situation in homozygous CETP-deficient patients who display marked hyperalphalipoproteinemia, with cholesterol being mainly transported in large size HDL1 particles (14Yamashita S. Sprecher D.L. Sakai N. Matsuzawa Y. Tarui S. Hui D.Y. Accumulation of apolipoproteinE-rich high density lipoproteins in hyperalphalipoproteinemic human subjects with plasma cholesteryl ester transfer protein deficiency.J. Clin. Invest. 1990; 86: 688-695Google Scholar). In the present studies, the role of CETP in the metabolism of lipoproteins was addressed by creating a new line of CETP transgenic rats in the normolipidemic Fisher background with elevated plasma levels of large HDL1. This rat model allowed us to address the consequences in terms of lipoprotein structure, and lipid and apolipoprotein composition of the sustained expression of moderate CETP levels in a range that was compatible with that classically measured in normolipidemic and hyperlipidemic patients. The transgene was a 3.6 kb pair construct assembled by fusing the cynomolgus monkey CETP cDNA to the mouse metallothionein promoter (a generous gift from Dr. R.T. Marotti). To generate transgenic rats, the CETP transgene was microinjected into the pronucleus of superovulated Fisher females. Injected embryos were reimplanted into pseudo-pregnant female of the same homogenous genetic background. DNA from tails of 3-week-old animals were used for the identification of transgenic rats by polymerase chain reaction (PCR) amplification. The primers were directed to amplify a 603-bp fragment of the CETP cDNA (CETP forward, 5′ CTTGTCCATCGCCACCAGCC 3′; CETP reverse, 5′ AGGGAGTGGAAGACTTGCTCGGA 3′). The PCR was confirmed by Southern blot using a probe including the last 514 bp of the mouse MT-1 promoter and the first 66 bp of the CETP cDNA. Among the progeny, three male founders carried the transgene. They were bred successfully, and two of them (#8102 and #8103) transmitted the transgene to their progeny. Heterozygous male rats from the F2 generation were tested for serum CETP activity (see below), and the present studies were performed using the line with the highest expression level, i.e., line #8103. Fluorescence in situ hybridization was performed by Genaxis (France). Metaphase chromosomes were prepared from fibroblast culture of transgenic rat tendon. The transgene was nick-translated in digoxygenin and used as a probe. The signal was visualized by epifluorescence microscopy. Phenotypic characterizations were performed with wild-type and heterozygous CETP transgenic (CETPTg) rats on an homogenous Fisher background. All animals were maintained in controlled conditions of temperature (21 ± 1°C), humidity (60 ± 10%), and lighting (12 h cycle, 8 AM–8 PM). The protocols were in accordance with our institutional guidelines for animal care. Animals (16 to 24 weeks old) were fed a regular rodent chow diet (A03, UAR France). Blood samples were collected into plain glass tubes by jugular vein puncture from 1% isoflurane-anesthetized fasted rats. Total RNA was extracted from frozen liver, muscle, heart, and adipose (fat pad) tissue of control and CETPTg rats by the method of Chomczynski and Sacchi (20Chomczynski P. Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal. Biochem. 1987; 162: 156-159Google Scholar). To eliminate residual genomic DNA from RNA samples, a DNAse treatment was performed. Two micrograms of DNAse-treated RNA were subjected to RT-PCR using CETP-specific primers (see above). Glyceraldehyde-3-phosphate deshydrogenase (GAPDH) was used in each reaction for semi-quantitative analysis (GAPDH forward, 5′ ACCACAGTCCATGCCATCAC 3′; GAPDH reverse, 5′ TCCACCACCCTGTTGCTGTA 3′). Samples were separated by electrophoresis in 2% agarose gels containing 0.5 mg/ml ethidium bromide. CETP- and GAPDH-specific primers gave 603 bp and 452 bp PCR products, respectively. Signal intensity was visualised under UV light, and PCR conditions were determined as to be in the exponential phase of amplification for the two genes. Data were normalized using GADPH as an internal standard, and results were expressed as CETP to GAPDH mRNA ratio. CETP activity was measured as the capacity of the serum sample to promote the transfer of radiolabeled cholesteryl esters from a tracer dose of radiolabeled endogenous HDL3 toward apoB containing lipoproteins (21Lagrost L. Gandjini H. Athias A. Guyard-Dangremont V. Lallemant C. Gambert P. Influence of plasma cholesteryl ester transfer activity on the LDL and HDL distribution profiles in normolipidemic subjects.Arterioscler. Thromb. 1993; 13: 815-825Google Scholar). Briefly, each incubation mixture contained 25 μl of rat plasma, radiolabeled human HDL3 (2.5 nmol of cholesteryl ester), and iodoacetate (final concentration 1.5 mM) in a final volume of 50 μl. Incubations were performed in triplicate for 3 h at 37°C. At the end of the incubation, the d < 1.068 and the d > 1.068 g/ml fractions were separated by ultracentrifugation, and they were transferred into counting vials containing 2 ml of scintillation fluid. The radioactivity was assayed for 2 min in a Wallac 1410 liquid scintillation counter (Amersham Pharmacia Biotech). Results from triplicate determination were expressed as the percentage of total radioactivity transferred from the lipoprotein tracer to the d < 1.068 g/ml fraction after deduction of blank values from the non-incubated control mixtures maintained at 4°C. CETP mass concentration in rat serum was measured by using a competitive ELISA adapted to a Biomek 2000 laboratory Automation Workstation (Beckman), as previously described (22Guyard-Dangremont V. Lagrost L. Gambert P. Lallemant C. Competitive enzyme-linked immunosorbent assay of the human cholesteryl ester transfer protein (CETP).Clin. Chim. Acta. 1994; 231: 147-160Google Scholar). Anti-CETP TP2 antibodies were purchased from the Ottawa Heart Institute (Ottawa, Canada). Serum lipoproteins were fractionated by fast protein liquid chromatography (FPLC) on a Superose 6HR 10/30 gel filtration column (Amersham Pharmacia Biotech). Lipoproteins were eluted at a constant flow rate of 0.3 ml/min with TSE buffer (50 mM Tris, 0.15 M NaCl, 1 mM EDTA, and 0.02% NaN3; pH 7.4). For each serum sample, up to 44 distinct fractions were collected, and TC and TG levels were determined. The gel filtration column was calibrated with globular protein standards of known Stokes' diameter (thyroglobulin, 17.0 nm; ferritin, 12.2 nm; aldolase, 8.2 nm, albumin, 7.2 nm) (Gel Filtration Calibration Kit, Pharmacia). Fractions 4 to 11 contained VLDL, fractions 12 to 17 contained LDL, fractions 18 to 24 contained HDL1, fractions 25 to 32 contained HDL2, and fractions 33 to 44 contained HDL3. The d < 1.21 g/ml lipoprotein fraction from individual rat sera (50 μl) was ultracentrifugally isolated at 100,000 rpm in a TLA-100 rotor in a Beckman Optima TLX ultracentrifuge. The size distribution of HDL was determined by electrophoresis of total lipoproteins on Spiragel 1.5–25% (Spiral-Couternon, France), according to the general procedure recommended by the manufacturer. At the end of the electrophoresis, the gels were stained with the Coomassie Brillant Blue G, and HDL distribution profiles were obtained by analysis of polyacrylamide gradient gels on a Bio-Rad GS-670 imaging densitometer. The size of the HDL subfractions was determined by comparison with globular protein standards (HMW protein calibration kit, Pharmacia) that were submitted to electrophoresis together with the samples. The relative abundance of HDL1 (12.9–20.0 nm) and HDL2 (8.7–12.9 nm) was quantitated as the corresponding area under the scan curve, and results were expressed in AUC units. The 1.02 < d < 1.21 g/ml HDL fraction was ultracentrifugally isolated from rat sera at 100,000 rpm in a TL-100 rotor on a Beckman Optima TLX ultracentrifuge. Isolated HDL (protein, 0.5 g/l) were incubated for 15 min at 80°C in the presence of SDS (25 g/l) and dithiotreitol (33 g/l) in TBS buffer (Tris, 10 mmol/l; NaCl, 150 mmol/l; NaN3, 3 mmol/l; pH 7.4). Samples were then applied on a SDS polyacrylamide gradient gel (Phastgel 8/25, Amersham Pharmacia Biotech), and migration was conducted as recommended by the manufacturer. Apolipoproteins were stained by Coomassie Brilliant Blue G, and apparent molecular weights of individual bands were determined by comparison with protein standards (High Molecular Weight calibration kit, Pharmacia) that were submitted to electrophoresis together with the samples. Serum TC and TG were measured by enzymatic methods using Boehringer Mannheim reagents, and assays were performed on a Cobas-Fara centrifuge analyser (Hoffman Laroche). Results are expressed as mean ± SE. Student’s t-test or non-parametric Mann-Whitney U-test were used to compare differences between data means, as appropriate. A transgenic line was established from a male founder, and in the established CETP transgenic line the gene of the simian protein was transmitted to the progeny in a mendelian fashion. As determined by RT-PCR, CETP mRNA levels were expressed in the liver, with no detectable mRNA levels in other tissues, including adipose tissue, muscle, and heart (Fig. 1). No CETP mRNA was detected in tissues from control rats (Fig. 1). In CETPTg rats, a unique site of insertion was localized on chromosome 3q23-q24 as determined by fluorescence in situ hybridization. Southern blot analysis of hemizygous males indicated that approximately 10 copies of the CETP transgene were incorporated in the genome of CETPTg rats (data not shown). To determine if CETPTg rats actually expressed CETP, CETP mRNA and activity levels were determined in total plasma samples from heterozygous males. As shown in Fig. 2, the expression of both CETP mRNA in the liver and the level of serum cholesteryl ester transfer activity were quite variable from one animal to another, with a close correlation between the two parameters (r = 0.79, P < 0.01). These observations came in support of the liver as the major contributor to the serum CETP pool (Fig. 1), and the level of cholesteryl ester transfer activity in transgenic animals was mainly a function of the circulating level of the protein (Fig. 2). Interestingly, a broad variety of CETP gene/activity expression was observed from one animal to another, and we took advantage of this fact to select a population of CETPTg males with mean serum CETP level of 2.4 mg/l (i.e., similar to the mean CETP concentration reported in normolipidemic subjects) (22Guyard-Dangremont V. Lagrost L. Gambert P. Lallemant C. Competitive enzyme-linked immunosorbent assay of the human cholesteryl ester transfer protein (CETP).Clin. Chim. Acta. 1994; 231: 147-160Google Scholar). Individual CETP mass concentrations ranged from very low levels (i.e., down to the non-detectable levels measured in control rats or homozygous CETP deficient patients) to high levels (i.e., up to 4–5 mg/l concentrations similar to those reported in dyslipidemic populations) (Fig. 3).Fig. 3CETP mass and activity in serum from control and CETPTg rats. Cholesteryl ester transfer activity and mass levels were determined in total plasma from control (n = 7) and CETPTg rats (n = 14), as described in Materials and Methods.View Large Image Figure ViewerDownload (PPT) On a standard chow diet, serum TG levels did not differ significantly between control and CETPTg rats (Table 1). In contrast, the expression of the CETP transgene produced a 34% decrease in the mean concentration of serum TC. A selective 48% decrease in the HDL-C levels accounted for the change in plasma cholesterol, with no significant alterations in the cholesterol content of the VLDL and LDL fractions (Table 1). As shown on FPLC gel filtration profiles (Fig. 4), the significant decrease in cholesterol levels concerned mainly large HDL particles (fractions 18 to 24) with no change in VLDL (fractions 4 to 11), and with no detectable levels of LDL (fractions 12 to 17). In CETPTg rats (Fig. 4A), the specific loss of cholesterol in the large HDL1 gave rise to an HDL peak with a shape that was quite similar to those observed in humans and control C57BL/6 mice, i.e., two species with high and low levels of plasma LDL, respectively, and with virtually no plasma HDL1 (Fig. 4B). A more detailed analysis of the rat HDL profile by polyacrylamide gradient gel electrophoresis indicated that HDL1 (diameter, 12.9–20.0 nm) were mostly affected by CETP expression, leading to a significant decrease in the mean apparent diameter of the serum HDL population (12.16 ± 0.06 nm in controls vs. 11.88 ± 0.21 nm in CETPTg rats; P < 0.05) (Fig. 5). CETP expression produced a more profound 74% drop in the cholesterol content of large size HDL1 as compared to the limited 38% reduction in HDL2, with no significant effect on the discrete HDL3 fraction (Table 1). Consistent conclusions could be drawn from the semi-quantitative analysis of native polyacrylamide gels, with a 64% decrease in the population of HDL1 size in CETPTg rats, but only a 34% decrease in the population of HDL2 size (Fig. 6A).TABLE 1Lipid and lipoprotein concentrationsRatsLipidsControlCETPTgTotal cholesterol (g/l)0.76 ± 0.070.50 ± 0.04aSignificantly different from control rats. P < 0.01. n = 7n = 14Triglycerides (g/l)2.29 ± 0.322.18 ± 0.13 n = 7n = 14Total cholesterol (μg/ml) in lipoprotein fractionsVLDL-C90.4 ± 8.1102.2 ± 8.6LDL-C27.0 ± 2.228.3 ± 5.1HDL-C690.1 ± 64.7355.6 ± 60.7aSignificantly different from control rats. P < 0.01.HDL1 -C232.0 ± 34.061.0 ± 16.5aSignificantly different from control rats. P < 0.01.HDL2 -C433.3 ± 27.4268.1 ± 43.4aSignificantly different from control rats. P < 0.01.HDL3 -C24.9 ± 5.826.5 ± 4.6Lipoprotein preparation and lipid analysis were determined as described in Materials and Methods. Values shown are mean ± SE (n = 7 control and n = 14 CETPTg rats for total cholesterol and triglycerides; n = 5 control and n = 8 CETPTg rats for cholesterol in lipoprotein fractions).a Significantly different from control rats. P < 0.01. Open table in a new tab Fig. 5Native polyacrylamide gradient gel electrophoresis of serum HDL from control and CETPTg rats. Total serum lipoproteins from control and CETPTg rats were submitted to electrophoresis on 15–250 g/l polyacrylamide gradient gels that were subsequently stained for proteins as described in Materials and Methods. HDL profiles (insert) were obtained by image analysis, and mean apparent diameters (insert) were calculated as compared to protein standards. Vertical bars are mean ± SEM. Statistical significance by Student’s t-test.View Large Image Figure ViewerDownload (PPT)Fig. 6Effect of CETP expression on the abundance of HDL1 and HDL2 in CETPTg rats compared with control rats. Total serum lipoproteins were separated by native polyacrylamide gradient gel electrophoresis (see Fig. 5), HDL profiles were obtained by image analysis, and the relative abundance of HDL1 and HDL2 was quantitated as the relative area under the scan curve (AUC). CETP mass concentration in total sera was determined by ELISA. A: Vertical bars show the percent change in the abundance of HDL1 and HDL2 in CETPTg rats versus controls; statistical significance by Student's t-test. B and C: Correlations between the relative abundance of HDL1 and HDL2, and CETP mass concentration among control (opened squares) and CETPTg (closed circles) rats; linear regression analysis.View Large Image Figure ViewerDownload (PPT) Lipoprotein preparation and lipid analysis were determined as described in Materials and Methods. Values shown are mean ± SE (n = 7 control and n = 14 CETPTg rats for total cholesterol and triglycerides; n = 5 control and n = 8 CETPTg rats for cholesterol in lipoprotein fractions). In support of distinct behaviours of HDL1 and HDL2 as lipoprotein substrates in the CETP-mediated lipid transfer process, a marked decrease in HDL1 was observed with any level of transgene expression and it was in contrast with the gradual, dose-dependent decrease in HDL2 over the CETP activity range studied (Fig. 6B, C). Finally, and in order to bring some molecular insights into the preferential reduction of large HDL1 among all the CETPTg rat sera, the apolipoprotein content of isolated HDL was analyzed by denaturing polyacrylamide gradient gel electrophoresis. As shown in Fig. 7, the CETP transgene promoted a significant and selective reduction in the apoE content of serum HDL in CETPTg rats compared to control rats (−53%, P < 0.02) with no significant changes in apoA-I, apoA-II, and apoA-IV (i.e., the other major components of serum HDL). A new line of CETPTg rats was created in order to assess in vivo the role of CETP on the structure and composition of plasma lipoproteins in the Fisher genetic background. In contrast to what has been previously reported in other animal models used for CETP transgenesis, including C57BL/6 mice (8Agellon L.B. Walsh A. Hayek T. Moulin P. Jiang X.C. Shelanski S.A. Breslow J.L. Tall A.R. Reduced high density lipoprotein cholesterol in human cholesteryl ester transfer protein transgenic mice.J. Biol. Chem. 1991; 266: 10796-10801Google Scholar, 23Marotti K.R. Castle C.K. Boyle T.P. Lin A.H. Murray R.W. Melchior G.W. Severe atherosclerosis in transgenic mice expressing simian cholesteryl ester transfer protein.Nature. 1993; 364: 73-75Google Scholar) and Dahl rats (12Herrera V.L. Makrides S.C. Xie H.X. Adari H. Krauss R.M. Ryan U.S. Ruiz-Opazo N. Spontaneous combined hyperlipidemia, coronary heart disease and decreased survival in Dahl salt-sensitive hypertensive rats transgenic for human cholesteryl ester transfer protein.Nat. Med. 1999; 5: 1383-1389Google Scholar), Fisher rats show high plasma levels of large size HDL1 that are known to be markedly increased in human patients with CETP deficiency (24Yamashita S. Maruyama T. Hirano K.I. Sakai N. Nakajima N. Matsuzawa Y. Molecular mechanisms, lipoprotein abnormalities and atherogenicity of hyperalphalipoproteinemia.Atherosclerosis. 2000; 152: 271-285Google Scholar). Thus, in the present studies the different levels of persistent CETP expression in the high-HDL1 Fisher rat allowed us to monitor in a comprehensive and physiological manner the effect of CETP on HDL. Controlled expression of CETP levels in the Fisher rats was shown to exert a profound effect on plasma HDL, that was characterized mainly by a selective but pronounced reduction in the relative abundance of large, apoE-containing HDL1 indicating a peculiar sensitivity of these particles to CETP action. In the present studies, the expression of the CETP transgene