Dietary trans-10,cis-12 conjugated linoleic acid induces hyperinsulinemia and fatty liver in the mouse
2002; Elsevier BV; Volume: 43; Issue: 9 Linguagem: Inglês
10.1194/jlr.m20008-jlr200
ISSN1539-7262
AutoresLionel C. Clément, Hélène Poirier, Isabelle Niot, Virginie Bocher, Michèle Guerre-Millo, Stéphane Krief, Bart Staels, Philippe Besnard,
Tópico(s)Eicosanoids and Hypertension Pharmacology
ResumoConjugated linoleic acids (CLA) are a class of positional, geometric, conjugated dienoic isomers of linoleic acid (LA). Dietary CLA supplementation results in a dramatic decrease in body fat mass in mice, but also causes considerable liver steatosis. However, little is known of the molecular mechanisms leading to hepatomegaly. Although c9,t11- and t10,c12-CLA isomers are found in similar proportions in commercial preparations, the respective roles of these two molecules in liver enlargement has not been studied. We show here that mice fed a diet enriched in t10,c12-CLA (0.4% w/w) for 4 weeks developed lipoatrophy, hyperinsulinemia, and fatty liver, whereas diets enriched in c9,t11-CLA and LA had no significant effect. In the liver, dietary t10,c12-CLA triggered the ectopic production of peroxisome proliferator-activated receptor γ (PPARγ), adipocyte lipid-binding protein and fatty acid transporter mRNAs and induced expression of the sterol responsive element-binding protein-1a and fatty acid synthase genes. In vitro transactivation assays demonstrated that t10,c12- and c9,t11-CLA were equally efficient at activating PPARα, β/δ, and γ and inhibiting liver-X-receptor.Thus, the specific effect of t10,c12-CLA is unlikely to result from direct interaction with these nuclear receptors. Instead, t10,c12-CLA-induced hyperinsulinemia may trigger liver steatosis, by inducing both fatty acid uptake and lipogenesis. Conjugated linoleic acids (CLA) are a class of positional, geometric, conjugated dienoic isomers of linoleic acid (LA). Dietary CLA supplementation results in a dramatic decrease in body fat mass in mice, but also causes considerable liver steatosis. However, little is known of the molecular mechanisms leading to hepatomegaly. Although c9,t11- and t10,c12-CLA isomers are found in similar proportions in commercial preparations, the respective roles of these two molecules in liver enlargement has not been studied. We show here that mice fed a diet enriched in t10,c12-CLA (0.4% w/w) for 4 weeks developed lipoatrophy, hyperinsulinemia, and fatty liver, whereas diets enriched in c9,t11-CLA and LA had no significant effect. In the liver, dietary t10,c12-CLA triggered the ectopic production of peroxisome proliferator-activated receptor γ (PPARγ), adipocyte lipid-binding protein and fatty acid transporter mRNAs and induced expression of the sterol responsive element-binding protein-1a and fatty acid synthase genes. In vitro transactivation assays demonstrated that t10,c12- and c9,t11-CLA were equally efficient at activating PPARα, β/δ, and γ and inhibiting liver-X-receptor. Thus, the specific effect of t10,c12-CLA is unlikely to result from direct interaction with these nuclear receptors. Instead, t10,c12-CLA-induced hyperinsulinemia may trigger liver steatosis, by inducing both fatty acid uptake and lipogenesis. Conjugated linoleic acids (CLA) are a class of positional and geometric conjugated dienoic isomers of linoleic acid (LA) found in dairy products, in bovine and ovine meat, and in partially hydrogenated vegetable oils. Although c9,t11-CLA (also known as rumenic acid) is the main CLA isomer present in food, it is found in almost equal proportions with the t10,c12-CLA isomer in commercial CLA preparations. The effects of CLA have been thoroughly studied in various animal models (1Pariza M.W. Park Y. Cook M.E. The biologically active isomers of conjugated linoleic acid.Prog. Lipid Res. 2001; 40: 283-298Google Scholar, 2Kelly G.S. Conjugated linoleic acid: a review.Altern. Med. Rev. 2001; 6: 367-382Google Scholar). CLA have anticarcinogenic properties in both mice and rats (3Durgam V.R. Fernandes G. The growth inhibitory effect of conjugated linoleic acid on MCF-7 cells is related to estrogen response system.Cancer Lett. 1997; 116: 121-130Google Scholar), and delay the onset of atherosclerosis in rabbits (4Lee K.N. Kritchevsky D. Pariza M.W. Conjugated linoleic acid and atherosclerosis in rabbits.Atherosclerosis. 1994; 108: 19-25Google Scholar) and hamsters (5Nicolosi R.J. Rogers E.J. Kritchevsky D. Scimeca J.A. Huth P.J. Dietary conjugated linoleic acid reduces plasma lipoproteins and early aortic atheroclerosis in hypercholesterolemic hamsters.Artery. 1997; 22: 266-277Google Scholar). CLA-enriched diets also cause rapid, massive changes in body composition, particularly in the mouse, in which a decrease in fat stores associated with an increase in lean body mass has been reported (6Park Y. Albright K.J. Liu W. Storkson J.M. Cook M.E. Pariza M.W. Effect of conjugated linoleic acid on body composition in mice.Lipids. 1997; 32: 853-858Google Scholar, 7West D.B. Delany J.P. Camet P.M. Blohm F. Truett A.A. Scimeca J. Effects of conjugated linoleic acid on body fat and energy metabolism in the mouse.Am. J. Physiol. 1998; 275: R667-R672Google Scholar). Much is now known about the physiological basis of the CLA-induced decrease in adipose tissue mass. CLA supplementation leads to an increase in energy expenditure (7West D.B. Delany J.P. Camet P.M. Blohm F. Truett A.A. Scimeca J. Effects of conjugated linoleic acid on body fat and energy metabolism in the mouse.Am. J. Physiol. 1998; 275: R667-R672Google Scholar), which may be secondary to a stimulation of sympathetic nervous activity (8Ohnuki K. Haramizu S. Oki K. Ishihara K. Fushiki T. A single oral administration of conjugated linoleic acid enhanced energy metabolism in mice.Lipids. 2001; 36: 583-587Google Scholar). CLA reduce lipid uptake and storage in 3T3-L1 adipocytes by inhibiting lipoprotein lipase (9Park Y. Albright K.J. Storkson J.M. Liu W. Cook M.E. Pariza M.W. Changes in body composition in mice during feeding and withdrawal of conjugated linoleic acid.Lipids. 1999; 34: 243-248Google Scholar, 10Lin Y. Schuurbiers E. Van der Veen S. De Deckere E.A. Conjugated linoleic acid isomers have differential effects on triglyceride secretion in Hep G2 cells.Biochim. Biophys. Acta. 2001; 1533: 38-46Google Scholar) and stearoyl-CoA desaturase-I (11Choi Y. Park Y. Pariza M.W. Ntambi J.M. Regulation of stearoyl-CoA desaturase activity by the trans-10,cis-12 isomer of conjugated linoleic acid in HepG2 cells.Biochem. Biophys. Res. 2001; 284: 689-693Google Scholar) activities. Finally, it has been suggested that the decrease in adipose tissue involves an apoptotic mechanism linked to an increase in tumor necrosis factor α production (12Tsuboyama-Kasaoka N. Takahashi M. Tanemura K. Kim H.J. Tange T. Okuyama H. Kasai M. Ikemoto S. Ezaki O. Conjugated linoleic acid supplementation reduces adipose tissue by apoptosis and develops lipodystrophy in mice.Diabetes. 2000; 49: 1534-1542Google Scholar). Recent studies with purified isomers have strongly suggested that CLA-induced fat loss is dependent on the t10,c12-CLA isomer in the mouse (13Park Y. Storkson J.M. Albright K.J. Liu W. Pariza M.W. Evidence that the trans-10,cis-12 isomer of conjugated linoleic acid induces body composition changes in mice.Lipids. 1999; 34: 235-241Google Scholar). Another consequence of dietary CLA supplementation in mice is massive liver enlargement (12Tsuboyama-Kasaoka N. Takahashi M. Tanemura K. Kim H.J. Tange T. Okuyama H. Kasai M. Ikemoto S. Ezaki O. Conjugated linoleic acid supplementation reduces adipose tissue by apoptosis and develops lipodystrophy in mice.Diabetes. 2000; 49: 1534-1542Google Scholar, 14DeLany J.P. Blohm F. Truett A.A. Scimeca J.A. West D.B. Conjugated linoleic acid rapidly reduces body fat content in mice without affecting energy intake.Am. J. Physiol. 1999; 276: R1172-R1179Google Scholar, 15DeLany J.P. West D.B. Changes in body composition with conjugated linoleic acid.J. Am. Coll. Nutr. 2000; 19: 487S-493SGoogle Scholar, 16West D.B. Blohm F.Y. Truett A.A. DeLany J.P. Conjugated linoleic acid persistently increases total energy expenditure in AKR/J mice without increasing uncoupling protein gene expression.J. Nutr. 2000; 130: 2471-2477Google Scholar). However, the cellular and molecular mechanisms involved in this process are unknown. It has been suggested that the effects of CLA on the liver may be partially controlled by peroxisome proliferator-activated receptor α (PPARα) (17Moya-Camarena S.Y. Vanden Heuvel J.P. Belury M.A. Conjugated linoleic acid activates peroxisome proliferator-activated receptor α and β subtypes but does not induce hepatic peroxisome proliferation in Sprague-Dawley rats.Biochim. Biophys. Acta. 1999; 1436: 331-342Google Scholar), a nuclear receptor known to regulate lipid metabolism in this organ (18Schoonjans K. Peinado-Onsurbe J. Lefebvre A-M. Heyman R.A. Briggs M. Deeb S. Staels B. Auwerx J. PPARα and PPARγ activators direct a distinct tissue-specific transcriptional response via a PPRE in the lipoprotein lipase gene.EMBO J. 1996; 15: 5336-5348Google Scholar). Indeed, both c9,t11-CLA and t10,c12-CLA have been shown to activate PPARα in transfection assays (17Moya-Camarena S.Y. Vanden Heuvel J.P. Belury M.A. Conjugated linoleic acid activates peroxisome proliferator-activated receptor α and β subtypes but does not induce hepatic peroxisome proliferation in Sprague-Dawley rats.Biochim. Biophys. Acta. 1999; 1436: 331-342Google Scholar). Consistent with this finding, an isomeric CLA mixture induced the expression of typical PPARα target genes encoding proteins involved in hepatic lipid transport (liver fatty acid-binding protein or L-FABP) and catabolism (acyl-CoA oxidase, and cytochrome P450 4A1) (19Belury M.A. Moya-Camarena S.Y. Liu K-L. Vanden Heuvel J.P. Dietary conjugated linoleic acid induces peroxisome-specific enzyme accumulation and ornithine decarboxylase activity in mouse liver.J. Nutr. Biochem. 1997; 8: 579-584Google Scholar). However, the role of PPARα in CLA-mediated steatosis remains to be clarified. Other transcription factors in addition to PPARα, such as liver-X-receptors (LXRs) and sterol responsive element-binding protein 1 (SREBP1), play a critical role in hepatic lipid metabolism by controlling de novo fatty acid synthesis (20Peet J. Janowski B.A. Mangelsdorf D.J. The LXRs: a new class of oxysterol receptors.Curr. Opin. Genet. Dev. 1998; 8: 571-575Google Scholar, 21Shimano H. Sterol regulatory element-binding protein-1 as a dominant transcription factor for gene regulation of lipogenic enzymes in the liver.Trends Cardiovas. Med. 2000; 10: 275-278Google Scholar). It was recently suggested that the balance within the cell between oxysterols and polyunsaturated fatty acids (PUFA), which interfere with LXR activation in vitro, is a crucial determinant of hepatic lipogenesis (22Yoshikawa T. Shimano H. Yahagi N. Ide T. Amemiya-Kudo M. Matsuzaka T. Nakakuki M. Tomita S. Okazaki H. Tamura Y. Iizuka Y. Ohashi K. Takahashi A. Sone H. Osuga Ji J. Gotoda T. Ishibashi S. Yamada N. Polyunsaturated fatty acids suppress sterol regulatory element-binding protein 1c promoter activity by inhibition of liver X receptor (LXR) binding to LXR response elements.J. Biol. Chem. 2002; 277: 1705-1711Google Scholar). It has also been established that SREBP1 is a major regulator of this pathway. This study was designed to explore the effects of dietary supplementation with purified CLA isomers. The effects of purified c9,t11-CLA and t10,c12-CLA were investigated in mice fed an isomer enriched-diet for 4 weeks. We found that the t10,c12-CLA isomer was responsible for CLA-induced lipoatrophy and liver steatosis. A profound change in the pattern of hepatic gene expression, favoring lipid accumulation, was observed in mice fed a diet rich in t10,c12-CLA. In vitro transactivation assays showed that this effect on gene expression was not mediated by the direct activation of PPARs or LXRs. Instead, it may have been triggered by the marked increase in circulating insulin levels induced by dietary t10,c12-CLA. French guidelines for the use and care of laboratory animals were followed. C57Bl/6J mice weighing 22.5 ± 0.1 g at the beginning of the experiment were individually housed in a controlled environment (constant temperature, humidity, and darkness from 8 AM to 8 PM). The food intake and body mass gain of each mouse were monitored at regular intervals. To explore the effects on body composition of the two main CLA isomers found in commercial preparations, female mice were fed ad libitum for 4 weeks on a semi-synthetic diet (UAR, France) containing either 2.4% sunflower oil (control diet), or 2% sunflower oil plus 0.4% linoleic acid (LA diet; Sigma), or highly purified CLA isomers (i.e., c9,t -CLA, or t10,c12-CLA diets; Natural Lipids Ltd, Norway) (Table 1). The diets were freshly prepared every day. We used females rather than males because they are more responsive to CLA supplementation (6Park Y. Albright K.J. Liu W. Storkson J.M. Cook M.E. Pariza M.W. Effect of conjugated linoleic acid on body composition in mice.Lipids. 1997; 32: 853-858Google Scholar). Anesthetized animals were bled by sectioning auxiliary vessels. The mice were killed, and liver and periuteral white adipose tissue (WAT) was collected, weighed, then rapidly frozen in liquid nitrogen and stored at −80°C.TABLE 1Composition of dietsIngredientsControlLAc9,t11-CLAt10,c12-CLAg/100gSunflower oil2.42.02.02.0Fatty acidsLA (99% of purity)0.4c9,t11-CLA (91.6% of purity)0.40.004t10,c12-CLA (96.2% of purity)0.0080.4Casein13131313Carbohydrates48.748.748.748.7Cellulose3.33.33.33.3Mineral+Vitamin mix4444 Open table in a new tab Total RNA was extracted from liver and WAT by the phenol-chloroform-LiCl method (23Chomczynski P. Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate- phenol-chloroform extraction.Anal. Biochem. 1987; 162: 156-159Google Scholar). It was subjected to electrophoresis in a 1% agarose gel and transferred to a GeneScreen membrane (NEN) as previously described (24Besnard P. Mallordy A. Carlier H. Transcriptional induction of the fatty acid binding protein gene in mouse liver by bezafibrate.FEBS Lett. 1993; 327: 219-223Google Scholar). cDNA probes were obtained from various sources: the liver fatty acid-binding protein (L-FABP) cDNA was obtained from J. I. Gordon (Washington University, St Louis MO), adipocyte lipid-binding protein (ALBP) cDNA and fatty acid transporter (FAT/CD36) cDNA were obtained from P.A. Grimaldi (INSERM U460, Nice, France), fatty acid synthase (FAS) cDNA was obtained from P. Ferré (INSERM U465, Paris, France) and phosphoenol-pyruvate carboxykinase (PEPCK) cDNA was obtained from C. Forest (INSERM U530, Paris, France). The probes were labeled with [α32P]dCTP (3000 Ci/mmol; Amersham) using a megaprime kit (Amersham). A 24-residue oligonucleotide specific for rat 18S rRNA was used as a control to ensure that equivalent amounts of RNA were loaded and transferred. This oligonucleotide was 5′ end-labeled using T4 polynucleotide kinase and [γ32P]ATP (3000 Ci/mmol, Amersham). cDNA was synthesized by reverse transcription of 5 μg of total RNA in a total volume of 20 μl using random hexamers and murine Moloney leukemia virus reverse transcriptase (Life Technologies). Real-time quantitative RT-PCR was then performed with 50 ng of reverse transcription products (diluted in 5 μl of 1× Sybr Green buffer), with 200 nM sense and antisense primers (Genset) in a final volume of 25 μl, using Sybr Green PCR core reagents in an ABI PRISM 7700 Sequence Detection System instrument (Applied Biosystems). As we used Sybr Green to determine amplification-associated fluorescence for real-time quantitative RT-PCR, it was important to check that the fluorescence generated was not overestimated due to contamination resulting from residual genomic DNA amplification (using controls without reverse transcriptase) and/or from the formation of primer dimers (controls with no DNA template or reverse transcriptase). RT-PCR products were also analyzed by electrophoresis in an ethidium bromide-stained agarose gel to check that a single amplicon of the expected size was indeed obtained. 18S rRNA and glyceraldehyde-3-phosphate dehydrogenase amplifications were used to assess variability in the initial quantities of cDNA. Relative quantification for any given gene, expressed as fold variation over control, was calculated by determining the difference between the cycle threshold (CT) of the given gene in the control (A) and treated (B) samples, using the 2-Δ(CTA-CTB) formula, according to manufacturer's protocol. CT values are expressed as means of triplicate measurements. The sense and antisense primers used were: GGGAGCCTGAGAAACGGC and GGGTCGGGAGTGGGTAATTT for 18S, GGCCATCCACAGTCTTCTGG and ACCACAGTCCATGCCATCACTGCCA for GAPDH, GCGCCATGGACGAGCTG and TTGGCACCTGGGCTGCT for SREBP1a, GGAGCCATGGATTGCACATT and GCTTCCAGAGAGGAGGCCAG for SREBP1c, CCCTTGACTTCCTTGCTGCA and GCGTGAGTGTGGGCGAAT for SREBP2, AGGCCGAGAAGGAGAAGCTGTTG and TGGCCACCTCTTTGCTCTGCTC for PPARγ. Transient transfections were performed in undifferentiated human enterocyte-like Caco-2 cells (passage 40). These cells were cultured in 60 mm dishes at 37°C, under a humidified atmosphere (95% air/5% CO2) in DMEM supplemented with 20% FCS, 4 mM l-glutamine, 1% non essential amino acids, 50 mg/ml streptomycin, and 200 IU/ml penicillin. One day before transfection, Caco2 cells were treated with 0.5% trypsin and 0.25 mg/ml EDTA, then replated in 6-well plates. They were supplied with fresh medium supplemented with 10% delipidated FCS (Sigma) 4 h before transfection. Cells were typically cotransfected with 4 μg of L-FABP promoter construct (25Poirier H. Niot I. Monnot M.C. Braissant O. Meunier-Durmort C. Costet P. Pineau T. Wahli W. Willson T.M. Besnard P. Differential involvement of peroxisome-proliferator-activated receptors alpha and delta in fibrate and fatty-acid-mediated inductions of the gene encoding liver fatty-acid-binding protein in the liver and the small intestine.Biochem. J. 2001; 355: 481-488Google Scholar) and with 0.1 μg of pSG5 effector plasmid expressing full-length cDNAs for mouse PPARα (26Issemann I. Green S. Activation of members of the steroid hormone receptor superfamily by peroxisome proliferators.Nature. 1990; 347: 645-649Google Scholar), PPARβ/δ (27Amri E-Z. Bonino F. Ailhaud G. Abumrad N.A. Grimaldi P.A. Cloning of a protein that mediates transcriptional effects of fatty acids in preadipocytes.J. Biol. Chem. 1995; 270: 2367-2371Google Scholar), PPARγ (28Kliewer S.A. Forman B.M. Blumberg B. Ong E.S. Borgemeyer U. Mangelsdorf D.J. Umesono K. Evans R.M. Differential expression and activation of a family of murine peroxisome proliferator activated receptors.Proc. Natl. Acad. Sci. USA. 1994; 91: 7355-7359Google Scholar), or pSG5 alone. We included 1 μg of the CMVβ-gal plasmid, in which expression of the β-galactosidase reporter gene is driven by the cytomegalovirus promoter/enhancer, as an internal control of transfection efficiency. Transfection was carried out by the calcium-phosphate method (29Sambrook J. Fritsch E.F. Maniatis T. In Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Sping Harbor, NY1989Google Scholar). Experiments were performed with 100 μM LA, c9,t11-CLA, or t10,c12-CLA complexed with 12.5 μM fatty acid-free BSA in DMEM supplemented with 10% delipidated FCS. Cells were harvested 24 h after induction. Cell extracts were prepared and assayed for β-galactosidase (β-Gal) and chloramphenicol acetyltransferase (CAT) activities. All points correspond to triplicate determinations. We evaluated the effects of LA and CLA isomers on PPAR transactivation by carrying out transient transfection assays with a vector encoding chimeric proteins comprising the DNA-binding site of the yeast transcription factor Gal4 fused to the ligand-binding domain of human PPARα, PPARβ/δ, or PPARγ and a reporter vector containing five copies of the Gal4-responsive element cloned upstream from the Herpes simplex thymidine kinase promoter and the luciferase gene, as previously described (30Raspe E. Madsen L. Lefebvre A.M. Leitersdorf I. Gelman L. Peinado-Onsurbe J. Dallongeville J. Fruchart J.C. Berge R. Staels B. Modulation of rat liver apolipoprotein gene expression and serum lipid levels by tetradecylthioacetic acid (TTA) via PPARalpha activation.J. Lipid Res. 1999; 40: 2099-2110Google Scholar). Briefly, COS-1 cells were transfected by incubation for 2 h at 37°C in culture medium without fetal calf serum (FCS), with the cationic lipid RPR 120535B, 20 ng/well of reporter vector (pG5TkpGL3), and 100 ng/well of expression vector (pGal4-PPARαDEF, pGal4-PPARβ/δDEF, or pGal4-PPARγDEF). One nanogram per well of pRL-CMV (Promega, Madison, WI) was used as a control for transfection efficiency. Cells were treated for 36 h with vehicle alone (0.1% DMSO v/v) or with various concentrations of LA, c9,t11-CLA, or t10,c12-CLA (10 to 200 μM). Activation efficiency was compared in the presence and absence of specific agonists of PPARα, PPARβ/δ, and PPARγ: Wy14643 (50 μM), MW166 Check (10 μM), and BRL 49653 (10 μM), respectively. At the end of the experiment, the cells were washed once with ice-cold 0.15 M NaCl in 0.01 M sodium phosphate buffer (pH 7.2), and luciferase activity was determined with the Dual-LuciferaseTM reporter assay system (Promega, Madison, WI). The protein content of the extract was determined by Bradford's assay using the kit from Bio-Rad (Bio-Rad, Munich, Germany). One day before transfection, HEK 293 cells were plated in DMEM supplemented with 10% FCS, in 24-well plates, at a density of 6 × 104 cells/well. Transfection mixtures contained 50 ng of TkpGl3 reporter plasmid, which carried five copies of the Gal4 response element, and 10 ng of a chimeric Gal4 construct containing the ligand-binding domain of LXRα (or 10 ng of insert-less plasmid as a control). We added 50 ng of the β-gal pSVβ-gal construct for standardization of the results. Cells were transfected by lipofection, involving incubation for 2 h with RPR-120535B in serum-free medium. The medium was then replaced with DMEM supplemented with 10% FCS and various concentrations of LA, c9,t11-CLA, or t10,c12-CLA (10 to 100 μM), or the ethanol vehicle alone. The cells were incubated for 16 h, after which we added 10 μM 22(R)-hydroxycholesterol (22R-CS) and incubated the cells for a further 20 h. Cell extracts were prepared and assayed for luciferase activity. Results were standardized on the basis of β-galactosidase activity. All points correspond to triplicate determinations. The total lipid content of livers was determined by Delsal's method (31Delsal J.L. Nouveau procédé d'extraction des lipides du sérum par le méthylal. Application aux microdosages du cholestérol total, des phospholipides et des protéines.Bull. Soc. Chim. Biol. 1944; 26: 99-105Google Scholar). Blood glucose concentration was determined by enzymatic methods (Biotrol Diagnostics). Plasma insulin and leptin levels were determined by radioimmunoassay (CIS Bio and Linco, respectively). The results are expressed as means ± SE. The significance of differences between groups was determined by carrying out Student's t-test. CLA supplementation led to a significant decrease in daily energy intake (15.6 ± 0.3 Kcal/mouse/day for c9,t11-CLA, and 16.5 ± 0.7 for t10,c12-CLA versus 23.3 ± 1.5 in controls, P < 0.001). This effect has been reported in previous studies (9Park Y. Albright K.J. Storkson J.M. Liu W. Cook M.E. Pariza M.W. Changes in body composition in mice during feeding and withdrawal of conjugated linoleic acid.Lipids. 1999; 34: 243-248Google Scholar) and is not CLA-specific. Indeed, a similar decrease was also found in mice fed a diet supplemented with LA (16.9 + 0.7 Kcal/mouse/day, P < 0.05 vs. controls). The addition of LA and CLA as fatty acids rather than as triglycerides might lead to sensorial and/or post-ingestive problems, resulting in partial aversion for these diets (7West D.B. Delany J.P. Camet P.M. Blohm F. Truett A.A. Scimeca J. Effects of conjugated linoleic acid on body fat and energy metabolism in the mouse.Am. J. Physiol. 1998; 275: R667-R672Google Scholar). A short-term decrease in body mass occurred in mice fed a diet rich in t10,c12-CLA, but no significant difference was found at the end of the experiment (data not shown). In contrast to the results obtained for LA- and c9,t11-CLA-enriched diets, the diet enriched in t10,c12-CLA resulted in a dramatic decrease in the mass of peri-uteral WAT (Fig. 1A). The abundance of the mRNAs encoding adipocyte lipid-binding protein (ALBP, also termed aP2) and fatty acid synthase (FAS), two proteins known to be involved in fatty acid uptake and accumulation in the adipocyte, was also markedly lower in mice fed this diet than in other mice (Fig. 1B). Similarly, only the t10,c12-CLA diet triggered a massive enlargement of the liver (3.1-fold increase, P > 0.001), which displayed the typical features of a fatty liver: pale color and accumulation of intracellular lipids (Fig. 2).Fig. 2Liver steatosis is induced by t10,c12-CLA supplementation. Female C57Bl/6J mice were fed for 4 weeks on diets containing 2.4% (w/w) sunflower oil alone (Control), or 2% sunflower oil plus 0.4% linoleic acid (LA), 0.4% c9,t11-CLA, or 0.4% t10,c12-CLA. A: Typical gross changes. B: Relative liver mass and hepatic lipid content. Means ± SE, n = 8. ***P < 0.01%.View Large Image Figure ViewerDownload (PPT) We investigated whether the isomer-specific CLA-mediated effect on adipose tissue and liver lipid metabolism was due to the direct activation of PPARs by means of a sensitive and specific assay involving chimeric proteins comprising the DNA-binding site of the yeast transcription factor Gal4 fused to the ligand-binding domain of each of the three known PPAR isoforms (PPARα, PPARβ/δ, and PPARγ) and a reporter gene system driven by five copies of the Gal4 response element inserted upstream from the luciferase gene (30Raspe E. Madsen L. Lefebvre A.M. Leitersdorf I. Gelman L. Peinado-Onsurbe J. Dallongeville J. Fruchart J.C. Berge R. Staels B. Modulation of rat liver apolipoprotein gene expression and serum lipid levels by tetradecylthioacetic acid (TTA) via PPARalpha activation.J. Lipid Res. 1999; 40: 2099-2110Google Scholar). LA and the two CLA isomers were found to be potent PPARα activators, whereas PPARβ/δ was activated to a lesser extent and the effect on PPARγ activation was negligible (Fig. 3). Consistent with the results obtained by Moya-Camarena et al. (17Moya-Camarena S.Y. Vanden Heuvel J.P. Belury M.A. Conjugated linoleic acid activates peroxisome proliferator-activated receptor α and β subtypes but does not induce hepatic peroxisome proliferation in Sprague-Dawley rats.Biochim. Biophys. Acta. 1999; 1436: 331-342Google Scholar), c9,t11-CLA appeared to be more efficient than t10,c12-CLA at activating PPARα. Indeed, 200 μM t10,c12-CLA was required to obtain the same level of PPARα activation obtained with 50 μM c9,t11-CLA (Fig. 3). Thus, the direct activation of PPARs by t10,c12-CLA cannot account for the induction of fatty liver by this compound. However, CLA may upregulate typical PPARα target genes. We investigated this possibility by cotransfecting Caco-2 cells with a construct consisting of the L-FABP promoter cloned upstream from a CAT reporter gene and PPAR expression vectors. The PPARα isoform gave the greatest increase in L-FABP promoter activity. Moreover, slightly higher levels of PPARα-mediated transactivation of the L-FABP promoter were obtained in the presence of c9,t11-CLA than with t10,c12-CLA or LA (Fig. 4A). In vivo, both c9,t11-CLA- and t10,c12-CLA-enriched diets induced a significant increase in liver L-FABP mRNA levels, whereas the LA diet did not (Fig. 4B). The accumulation of CLA in the liver and/or the transformation of CLA into more active metabolites may account for this difference.Fig. 4Comparison of the effect of linoleic acid (LA), c9,t11-CLA, or t10,c12-CLA on the regulation of a typical PPARα target gene. A: Caco-2 cells were transiently cotransfected with a construct in which the L-FABP promoter was cloned upstream from the CAT reporter gene, and with plasmids encoding murine PPARα, PPARβ/δ, or PPARγ. Cells were treated as described in the Materials and Methods section, with 100 μM LA or purified isomers, 24 h before harvesting. Control cultures (solid bar) received only the vehicle (12.5 μM BSA). Transcriptional activity is expressed as CAT activity standardized with respect to β-galactosidase activity. Means ± SE, n = 3. B: Female C57Bl/6J mice were fed for 4 weeks on diets containing 2.4% (w/w) sunflower oil alone (Control), 2% sunflower oil plus 0.4% linoleic acid (LA), or 0.4% c9,t11-CLA, or 0.4% t10,c12-CLA. Liver fatty acid-binding protein (L-FABP) mRNA levels were analyzed by northern blotting. Changes with respect to the control were calculated after correcting for loading differences according to18S rRNA levels. Means ± SE, n = 5. *P < 0.05; ***P < 0.001.View Large Image Figure ViewerDownload (PPT) PUFA are known to inhibit the lipogenic pathway. The molecular basis of this regulation was recently described and involves competitive inhibition between physiological LXR agonists (oxysterols) and PUFA for the LXR ligand-binding domain, leading to the inhibition of SREBP1c induction by LXR, a crucial step in lipogenesis (22Yoshikawa T. Shimano H. Yahagi N. Ide T. Amemiya-Kudo M. Matsuzaka T. Nakakuki M. Tomita S. Okazaki H. Tamura Y. Iizuka Y. Ohashi K. Takahashi A. Sone H. Osuga Ji J. Gotoda T. Ishibashi S. Yamada N. Polyunsaturated fatty acids suppress sterol regulatory element-binding protein 1c promoter activity by inhibition of liver X receptor (LXR) binding to LXR response elements.J. Biol. Chem. 2002; 277: 1705-1711Google Scholar). We investigated the effects of CLA on LXR activity by cotransfecting cells with a construct encoding a Gal-4 DNA-binding domain fused to the
Referência(s)