Single Monochrome Real-Time RT-PCR Assay for Identification, Quantification, and Breakpoint Cluster Region Determination of t(9;22) Transcripts
2005; Elsevier BV; Volume: 7; Issue: 1 Linguagem: Inglês
10.1016/s1525-1578(10)60007-4
ISSN1943-7811
AutoresMarina Gutiérrez, Georgina Timson, Abdul K. Siraj, Rong Bu, Shakuntala Barbhaya, Sripad Banavali, Kishor Bhatia,
Tópico(s)Eosinophilic Disorders and Syndromes
Resumot(9;22) generates the BCR-ABL fusion gene, the hallmark of chronic myeloid leukemia (CML) but also found in acute lymphoblastic leukemia (ALL). Multiple chimeric transcripts translate to proteins of 190 or 210 kd and, rarely, 230 kd. CML typically carries p210 BCR-ABL while ALL is most often associated with p190. Detection and quantification of these fusion transcripts is useful in clinical management. We have exploited the unique melting profiles of these transcripts to design a new, simple, and cost-effective assay based on monochrome multiplex real-time RT-PCR for identification and quantification of each of these transcripts (b3-a2, b2-a2, and e1-a2) without further manipulation. The sensitivity of this assay was 10−4 for e1-a2 and 10−5 for b3-a2/b2-a2, which is appropriate for detection of minimal residual disease (MRD). Inter- and intra-assay variation was minimal. We applied this assay to assess the distribution of p190 and p210 in 260 childhood ALL samples from India. BCR-ABL was detected in 19 (7.3%), including one T-ALL. Eight patients (3.1%) demonstrated mBCR-ABL (p190) and 11 (4.2%) had MBCR-ABL (p210). Transcript levels varied markedly (up to 3000-fold) but e1-a2 were generally expressed at higher levels than b3/b2-a2 (P = 0.05). This simple real-time multiplex assay can thus be easily applied to monitor patients with ALL as well as CML. t(9;22) generates the BCR-ABL fusion gene, the hallmark of chronic myeloid leukemia (CML) but also found in acute lymphoblastic leukemia (ALL). Multiple chimeric transcripts translate to proteins of 190 or 210 kd and, rarely, 230 kd. CML typically carries p210 BCR-ABL while ALL is most often associated with p190. Detection and quantification of these fusion transcripts is useful in clinical management. We have exploited the unique melting profiles of these transcripts to design a new, simple, and cost-effective assay based on monochrome multiplex real-time RT-PCR for identification and quantification of each of these transcripts (b3-a2, b2-a2, and e1-a2) without further manipulation. The sensitivity of this assay was 10−4 for e1-a2 and 10−5 for b3-a2/b2-a2, which is appropriate for detection of minimal residual disease (MRD). Inter- and intra-assay variation was minimal. We applied this assay to assess the distribution of p190 and p210 in 260 childhood ALL samples from India. BCR-ABL was detected in 19 (7.3%), including one T-ALL. Eight patients (3.1%) demonstrated mBCR-ABL (p190) and 11 (4.2%) had MBCR-ABL (p210). Transcript levels varied markedly (up to 3000-fold) but e1-a2 were generally expressed at higher levels than b3/b2-a2 (P = 0.05). This simple real-time multiplex assay can thus be easily applied to monitor patients with ALL as well as CML. Present day treatment protocols for leukemia are based on prognostic factors that allow stratification of therapy. The typical risk factors identified over the years include age, WBC counts, immunophenotype, and gene rearrangements, most commonly, chromosomal translocations.1Pui C-H Treatment of acute leukemias.in: Pui C-H New Directions for Clinical Research. Humana Press, Totowa, NJ2003: 87-157Google Scholar, 2Melo JV Hughes TP Apperley JF Chronic myeloid leukemia.in: Broudy VC Prehal JT Berliner N Tricot GJ Hematology. American Society of Hematology, Washington, DC2003: 132-152Google Scholar, 3Cortes JE, Kantarjian H: Acute lymphoblastic leukemia. Pazdur R. PRR eds. Medical Oncology: A Comprehensive Review, ed 2. 1997:pp 1-45 www.cancernetwork.com/textbook/mores01.htmGoogle Scholar, 4Greaves M Childhood leukaemias.Br Med J. 2002; 324: 283-287Crossref PubMed Scopus (226) Google Scholar The t(9;22) which juxtaposes the ABL proto-oncogene to the BCR gene generating a chimeric gene, BCR-ABL, is the hallmark of chronic myeloid leukemia (CML).5Kantarjian H Melo JV Tura S Giralt S Talpaz M Chronic myelogenous leukemia: disease biology and current and future therapeutic strategies.in: Schechter GP Berliner N Telen MJ Hematology. American Society of Hematology, Washington, DC2000: 90-109Google Scholar It is also well-established that a fraction of acute lymphoblastic leukemias (ALL) carry this chromosomal translocation.6Kurzrock R Gutterman JU Talpaz M The molecular genetics of Philadelphia chromosome-positive leukemias.N Engl J Med. 1988; 319: 990-998Crossref PubMed Scopus (735) Google Scholar The t(9;22) is more frequent in ALL in adults (20 to 40%) than in ALL in children (<5%).3Cortes JE, Kantarjian H: Acute lymphoblastic leukemia. Pazdur R. PRR eds. Medical Oncology: A Comprehensive Review, ed 2. 1997:pp 1-45 www.cancernetwork.com/textbook/mores01.htmGoogle Scholar Furthermore, the presence of a BCR-ABL fusion gene in ALL is associated with poor prognosis and is indicative of bone marrow transplantation in certain treatment protocols.7Gleissner B Gokbuget N Bartram CR Janssen B Rieder H Janssen JW Fonatsch C Heyll A Voliotis D Beck J Lipp T Munzert G Maurer J Hoelzer D Thiel E German Multicenter Trials of Adult Acute Lymphoblastic Leukemia Study Group Leading prognostic relevance of the BCR-ABL translocation in adult acute B-lineage lymphoblastic leukemia: a prospective study of the German Multicenter Trial Group and confirmed polymerase chain reaction analysis.Blood. 2002; 99: 1536-1543Crossref PubMed Scopus (271) Google Scholar, 8Arico M Valsecchi MG Camitta B Schrappe M Chessells J Baruchel A Gaynon P Silverman L Janka-Schaub G Kamps W Pui CH Masera G Outcome of treatment in children with Philadelphia chromosome-positive acute lymphoblastic leukemia.N Engl J Med. 2000; 342: 998-1006Crossref PubMed Scopus (482) Google Scholar At the genomic level, different breakpoints have been defined that will, in turn, generate different transcripts and somewhat different proteins.9Melo JV BCR-ABL gene variants.Baillieres Clin Haematol. 1997; 10: 203-222Abstract Full Text PDF PubMed Scopus (125) Google Scholar The most common BCR-ABL rearrangement defines the major breakpoint cluster region (MBCR-ABL) and encodes for a protein of 210 kd (p210). This chimeric protein is generated by the juxtaposition b2-a2 (exon 13 of BCR –exon 2 of ABL) or b3-a2 (exon 14 of BCR –exon 2 of ABL). Another fusion transcript is due to a rearrangement in the minor breakpoint region (mBCR-ABL) that causes an e1-a2 (exon 1 of BCR –exon 2 of ABL) fusion that encodes for the smaller p190 protein. A third, very rare transcript (e19-a2) that is translated into a p230 was also described in CML.10Saglio G Guerrasio A Rosso C Zaccaria A Tassinari A Serra A Rege-Cambrin G Mazza U Gavosto F New type of BCR/ABL junction in Philadelphia chromosome-positive chronic myelogenous leukemia.Blood. 1990; 76: 1819-1824PubMed Google Scholar Although the vast majority of CMLs express p210, sporadic cases of CML expressing p190 were reported. Furthermore, CMLs patients at diagnosis may co-express very low amounts of p190 by alternative splicing events.11van Rhee F Hochhaus A Lin F Melo JV Goldman JM Cross NC p190 BCR-ABL m-RNA is expressed at low levels in p210-positive chronic myeloid and acute lymphoblastic leukemias.Blood. 1996; 87: 5213-5217PubMed Google Scholar Similarly, ALL cells typically express p190 but p210 expression has been observed, especially in adult patients.12Kantarjian HM Talpaz M Dhingra K Estey E Keating MJ Ku S Trujillo J Huh Y Stass S Kurzrock R Significance of the P210 versus P190 molecular abnormalities in adults with Philadelphia chromosome-positive acute leukemia.Blood. 1991; 78: 2411-2418PubMed Google Scholar All BCR-ABL chimeric proteins have tyrosine kinase activity. However, transgenic mice demonstrated that p190 is associated with a shorter latency to develop leukemia than p210. Moreover, p190 transgenic develop B-lineage leukemia while p210 transgenic develop B, T, or myeloid leukemia.13Voncken JW Kaartinen V Pattengale PK Germeraad WT Groffen J Heisterkamp N BCR/ABL P210 and P190 cause distinct leukemia in transgenic mice.Blood. 1995; 86: 4603-4611Crossref PubMed Google Scholar These animal models suggest that p190 and p210 associate with clinically different conditions. In a study on CML, it was suggested that patients with b3-a2 have a longer survival than patients expressing b2-a2.14Prejzner W Relationship of the BCR gene breakpoint and the type of BCR/ABL transcript to clinical course, prognostic indexes, and survival in patients with chronic myeloid leukemia.Med Sci Monit. 2002; 8: 191-197Google Scholar However, very little information is available on the distribution of these variants and their clinical relevance, especially in childhood ALL. Response to initial therapy provides a further prognostic marker in both acute and chronic leukemias.15Kantarjian HM O'Brien S Cortes JE Shan J Giles FJ Rios MB Faderl SH Wierda WG Ferrajoli A Verstovsek S Keating MJ Freireich EJ Talpaz M Complete cytogenetic and molecular responses to interferon-a-based therapy for chronic myelogenous leukemia are associated with excellent long-term prognosis.Cancer. 2003; 97: 1033-1041Crossref PubMed Scopus (195) Google Scholar, 16Cazzaniga G Lanciotti M Rossi V Di Martino D Arico M Valsecchi MG Basso G Masera G Micalizzi C Biondi A Prospective molecular monitoring of BCR-ABL transcript in children with Ph+ acute lymphoblastic leukemia unravels differences in treatment response.Br J Haematol. 2002; 119: 445-453Crossref PubMed Scopus (32) Google Scholar, 17Hughes TP Kaeda J Branford S Rudzki Z Hochhaus A Hensley ML Gathmann I Bolton AE van Hoomissen IC Goldman JM Radich JP International Randomised Study of Interferon versus STI571 (IRIS) Study Group Frequency of major molecular responses to imatinib or interferon alfa plus cytarabine in newly diagnosed chronic myeloid leukemia.N Engl J Med. 2003; 349: 1423-1432Crossref PubMed Scopus (1084) Google Scholar MRD information is today considered an independent prognostic factor in at least three diseases: in childhood ALL after induction therapy; in CML after allogenic stem cell transplantation, imatinib, or interferon treatment; and in promyelocytic leukemia after consolidation therapy. Therefore, detection of minimal residual disease (MRD) by molecular monitoring of the patients has become a major focus of diagnostic laboratories to enable detection of leukemic cells beyond the threshold of cytomorphology or karyotyping. Since quantification is a must, several methodologies are reported and continuously improved for standardized usage in multi-center trials.18van Dongen JJ Macintyre EA Gabert JA Delabesse E Rossi V Saglio G Gottardi E Rambaldi A Dotti G Griesinger F Parreira A Gameiro P Diaz MG Malec M Langerak AW San Miguel JF Biondi A Standardized RT-PCR analysis of fusion gene transcripts from chromosome aberrations in acute leukemia for detection of minimal residual disease: report of the BIOMED-1 Concerted Action: investigation of minimal residual disease in acute leukemia.Leukemia. 1999; 13: 1901-1928Crossref PubMed Scopus (1017) Google Scholar Some leukemogenic translocations, including BCR-ABL, can be detected in peripheral blood from healthy individuals.19Janz S Potter M Rabkin CS Lymphoma- and leukemia-associated chromosomal translocations in healthy individuals.Genes Chromosomes Cancer. 2003; 36: 211-223Crossref PubMed Scopus (134) Google Scholar Thus, MRD assays should be designed to discriminate such false-positive results. The sensitivity of an assay should be sufficient enough to detect minimal disease but at the same time should indicate only levels of transcripts (above a threshold) that arise from the presence of leukemic cells. Over time, different methodologies have been applied to determine the presence of fusion genes either for diagnosis or for monitoring disease (MRD). These included cytogenetics, FISH, Southern blot, and RT-PCR.20Schoch C Schnittger S Bursch S Gerstner D Hochhaus A Berger U Hehlmann R Hiddemann W Haferlach T Comparison of chromosome banding analysis, interphase- and hypermetaphase-FISH, qualitative and quantitative PCR for diagnosis and for follow-up in chronic myeloid leukemia: a study on 350 cases.Leukemia. 2002; 16: 53-59Crossref PubMed Scopus (250) Google Scholar, 21Nashed A Rao KW Gulley ML Clinical applications of BCR-ABL molecular testing in acute leukemia.J Mol Diagn. 2003; 5: 63-72Abstract Full Text Full Text PDF PubMed Scopus (40) Google Scholar These procedures are time-consuming, cumbersome, or are not appropriate for quantification of the transcript level. More recently, real-time RT-PCR using TaqMan or hybridization probes strategies have also been described for detection of BCR-ABL.22Kreuzer KA Lass U Bohn A Landt O Schmidt CA LightCycler technology for the quantification of bcr/abl fusion transcripts.Cancer Res. 1999; 59: 3171-3174PubMed Google Scholar, 23Emig M Saussele S Wittor H Weisser A Reiter A Willer A Berger U Hehlmann R Cross NC Hochhaus A Accurate and rapid analysis of residual disease in patients with CML using specific fluorescent hybridization probes for real time quantitative RT-PCR.Leukemia. 1999; 13: 1825-1832Crossref PubMed Scopus (250) Google Scholar, 24Bolufer P Sanz GF Barragan E Sanz MA Cervera J Lerma E Senent L Moreno I Planelles MD Rapid quantitative detection of BCR-ABL transcripts in chronic myeloid leukemia patients by real-time reverse transcriptase polymerase-chain reaction using fluorescently labeled probes.Haematologica. 2000; 85: 1248-1254PubMed Google Scholar, 25Amabile M Giannini B Testoni N Montefusco V Rosti G Zardini C Terragna C Buonamici S Ottaviani E Soverini S Fiacchini M Bassi S de Vivo A Trabacchi E Saglio G Pane F Baccarani M Tura S Martinelli G Real-time quantification of different types of bcr-abl transcript in chronic myeloid leukemia.Haematologica. 2001; 86: 252-259PubMed Google Scholar, 26Lee WI Kantarjian H Glassman A Talpaz M Lee MS Quantitative measurement of BCR/abl transcripts using real-time polymerase chain reaction.Ann Oncol. 2002; 13: 781-788Crossref PubMed Scopus (23) Google Scholar, 27Yokota H Tsuno NH Tanaka Y Fukui T Kitamura K Hirai H Osumi K Itou N Satoh H Okabe M Nakahara K Quantification of minimal residual disease in patients with e1a2 BCR-ABL-positive acute lymphoblastic leukemia using a real-time RT-PCR assay.Leukemia. 2002; 16: 1167-1175Crossref PubMed Scopus (21) Google Scholar, 28Neumann F Herold C Hildebrandt B Kobbe G Aivado M Rong A Free M Rossig R Fenk R Schneider P Gattermann N Royer-Pokora B Haas R Kronenwett R Quantitative real-time reverse-transcription polymerase chain reaction for diagnosis of BCR-ABL-positive leukemias and molecular monitoring following allogeneic stem cell transplantation.Eur J Haematol. 2003; 70: 1-10Crossref PubMed Scopus (28) Google Scholar, 29Jones CD Yeung C Zehnder JL Comprehensive validation of a real time quantitative bcr-abl assay for clinical laboratory use.Am J Clin Pathol. 2003; 120: 42-48Crossref PubMed Scopus (26) Google Scholar, 30Gabert J Beillard E van der Velden VH Bi W Grimwade D Pallisgaard N Barbany G Cazzaniga G Cayuela JM Cave H Pane F Aerts JL De Micheli D Thirion X Pradel V Gonzalez M Viehmann S Malec M Saglio G van Dongen JJ Standardization and quality control studies of “real-time” quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia: a Europe Against Cancer Program.Leukemia. 2003; 17: 2318-2357Crossref PubMed Scopus (1243) Google Scholar These strategies have the inherent advantages of allowing quantification, specificity, and high sensitivity. However, all of these real-time RT-PCR assays require using expensive fluorescently labeled oligonucleotides. A single assay that allows simultaneous determination of the breakpoint cluster region and quantification of the transcript is not available. Although several independent reactions with sequence-specific probes can be used, this increases the complexity, workload, and cost. Alternatively, a real-time quantitative RT-PCR followed by capillary electrophoresis has been recently proposed31Luthra R Sanchez-Vega B Medeiros LJ TaqMan RT-PCR assay coupled with capillary electrophoresis for quantification and identification of bcr-abl transcript type.Mod Pathol. 2004; 17: 96-103Crossref PubMed Google Scholar but it requires additional equipment and manipulation of PCR products. We have previously demonstrated that the melting profile of amplicons can be exploited for reliable and consistent identification of various leukemogenic fusions, without the need for hybridization probes.32Siraj AK Ozbek U Sazawal S Sirma S Timson G Al-Nasser A Bhargava M El Solh H Bhatia K Gutierrez MI Pre-clinical validation of a monochrome real-time multiplex assay for translocations in childhood acute lymphoblastic leukemia.Clin Cancer Res. 2002; 8: 3832-3840PubMed Google Scholar We have now used this to develop a simple monochrome multiplex RT-PCR using the LightCycler technology to identify the type of BCR-ABL transcript (b2-a2, b3-a2, and e1-a2) and quantify its level without any further procedures. We have also applied this assay to blood mononuclear cells from healthy individuals and confirmed that the potential background BCR-ABL positivity in normal cells does not interfere with the quantification of leukemic cells. We have reported that the relative distribution of molecular subtypes of pediatric ALL in India differs from USA/Europe.33Siraj AK Kamat S Gutierrez MI Banavali S Timpson G Sazawal S Bhargava M Advani S Adde M Magrath I Bhatia K The frequencies of the major subgroups of precursor B-cell acute lymphoblastic leukemia in Indian children differ from the West.Leukemia. 2003; 17: 1192-1193Crossref PubMed Scopus (33) Google Scholar For example, the t(12;21) was present in only 7% of precursor B cell ALL patients. This observation is relevant for designing therapeutic strategies, since the presence of translocations define risk-stratification groups. We have now applied our new monochrome multiplex real-time RT-PCR assay to further characterize the distribution of variant BCR-ABL fusions and their relative levels in childhood ALL from India. We used the leukemia cell lines K562 and SupB15 carrying the t(9;22)(q34;q11) and expressing b3-a2 and e1-a2 BCR-ABL transcripts, respectively. The RS4;11 cell line was used as a negative control. Cells were grown at 37°C in a 5% CO2 atmosphere in RPMI 1640 (BioWhittaker, Walkersville, MD) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT), 2 mmol/L glutamine, 100 U/ml penicillin, and 0.1 mg/ml streptomycin (Sigma, St. Louis, MO). Samples from 260 children with primary ALL were available from previous studies.33Siraj AK Kamat S Gutierrez MI Banavali S Timpson G Sazawal S Bhargava M Advani S Adde M Magrath I Bhatia K The frequencies of the major subgroups of precursor B-cell acute lymphoblastic leukemia in Indian children differ from the West.Leukemia. 2003; 17: 1192-1193Crossref PubMed Scopus (33) Google Scholar The median age of the patients was 7 years (range, 6 months to 18 years). Male to female ratio was 2.9:1. Bone marrow aspirates or peripheral blood samples were collected at the time of routine diagnostic procedures. Written informed consent was obtained and this study was approved by an Institutional Review Board. Peripheral blood mononuclear cells from 97 healthy individuals were also collected. A single donation of 20-ml peripheral blood was obtained from each individual after informed consent was obtained and the samples were immediately coded to ensure anonymity of the donors. Patient and donor mononuclear cells were obtained from Ficoll-Hypaque density gradient centrifugation and lyzed with Trizol (Invitrogen, Carlsbad, CA) for RNA extraction. Two and one-half μg of total RNA was reverse-transcribed using the Superscript first-strand system for RT-PCR (Invitrogen, Carlsbad, CA) and random hexamers. Aliquots representing 1/100 (ie, 25 ng RNA) were used as templates in the LightCycler (Roche, Mannheim, Germany). We used the Lightcycler instrument and fluorogenic SYBR Green I. The primers were previously designed to identify the most common BCR-ABL transcripts. Three primers were used in each reaction, one reverse primer in ABL exon 2 (tccactggccacaaaatcatacagt) and two forward primers in BCR exon 13 (b2, tcagaagcttctccctgacatccgt) and BCR exon 1 (e1, acctcacctccagcgaggaggactt) (Figure 1). The PCR reactions were carried out in 10 μl, including 4 pmoles of each primer, 2.5 mmol/L MgCl2, and reagents from the FastStart DNA master SYBR Green I kit (Roche, Mannheim, Germany) using 2 μl of the indicated dilution of cDNA. The amplification consisted of 10 minutes at 95°C followed by a touchdown setting of 45 cycles of 10 seconds at 95°C, 5 seconds at 64 to 56°C, and 10 seconds at 72°C. To analyze the melting profile, a final cycle of 20 seconds at 97°C, 15 seconds at 50°C, and a slow increase in the temperature until 98°C was added. Three independent experiments were conducted to ensure reproducibility always including the appropriate positive, negative, and no-template controls. Fluorescence emission spectra were monitored in real time for amplification kinetics and melting curve analyses were performed to assess the specificity of the amplified products. Standard RT-PCR and direct sequencing of RT-PCR products were used to confirm the presence and identity of the translocations. Frequencies were statistically compared by Fisher's exact test using SPSS.10 software. PCR products were measured by the threshold cycle (or crossing point, Cp) at which fluorescence became detectable above the baseline. The Cp was used for kinetic analysis and was proportional to the initial number of target copies in the sample. We calculated the relative expression of BCR-ABL transcripts as the ratio between the level of BCR-ABL and the level of GAPDH. For this purpose, we generated a standard curve by measuring the Cp values for GAPDH transcripts from serial dilutions of ALL cell lines cDNA to allow a relative expression value for the target transcript per ng of RNA (normalizer). GAPDH primers were cgggaagcttgtcatcaatgg and catggttcacacccatgacg. As per our previous experience, we considered a sample adequate for analysis when the Cp value for GAPDH was ≤30.32Siraj AK Ozbek U Sazawal S Sirma S Timson G Al-Nasser A Bhargava M El Solh H Bhatia K Gutierrez MI Pre-clinical validation of a monochrome real-time multiplex assay for translocations in childhood acute lymphoblastic leukemia.Clin Cancer Res. 2002; 8: 3832-3840PubMed Google Scholar Therefore, each sample (cell lines, normal controls, and patients) was initially analyzed to determine the GAPDH level. BCR-ABL amplicons were cloned in a TA vector (Invitrogen) and serial 10-fold dilutions of plasmids, corresponding to known copy numbers, were run in triplicate to obtain the corresponding standard curves. These standards were systematically run in every experiment. Test samples were analyzed by our duplex assay, amplicons b2-a2 and b3-a2 were identified by the melting peak and quantified using the standard curve for MBCR-ABL. The e1-a2 amplicon could be easily distinguished from the previous transcripts by the melting peak and quantified based on the corresponding standard curve for mBCR-ABL. To standardize an easy, simple, and cost-effective method to identify and quantify BCR-ABL transcripts, we designed a new duplex real-time RT-PCR for the LightCycler instrument using only Sybr Green I. We have previously detected mBCR-ABL transcripts using a single pair of primers that yield a product with a characteristic melting peak of 92.2 ± 0.3°C.32Siraj AK Ozbek U Sazawal S Sirma S Timson G Al-Nasser A Bhargava M El Solh H Bhatia K Gutierrez MI Pre-clinical validation of a monochrome real-time multiplex assay for translocations in childhood acute lymphoblastic leukemia.Clin Cancer Res. 2002; 8: 3832-3840PubMed Google Scholar We have now added another BCR primer that allows amplification of the MBCR-ABL transcripts in a duplex reaction. This strategy takes advantage of the different melting profiles for each amplicon generated for proper identification. As shown in Figure 1A, each amplicon, ie, b3-a2, b2-a2, and e1-a2, yielded a unique, characteristic, and reproducible melting profile detected only from amplification of the corresponding positive cDNA. The melting peak for e1-a2 was 91.85 ± 0.25°C while the peaks for b3-a2 was 85.6 ± 0.3°C and for b2-a2 was 86.55 ± 0.25°C. Although these last two peaks were close to each other, we could unequivocally resolve them (see the confirmation below) in three independent runs, indicating that these two peaks can be distinguished when clinical samples are analyzed. Negative-control cDNA consistently demonstrated absence of any of these signals, indicating the absence of false positives. These observations were confirmed by the size of the PCR products following electrophoresis in a 4% agarose gel (Figure 1B). The primers generate PCR products of 326 bp (b3-a2), 251 bp (b2-a2), and 418 bp (e1-a2). Final confirmation of the nature of the amplicons was obtained by direct sequencing of seven MBCR-ABL products (Figure 2). We applied this assay to 260 samples from Indian childhood ALL, including 215 precursor B-cell and 45 T-ALL. We identified 19 samples positive for BCR-ABL (7.3%). While eight patients carried e1-a2 (indicative of p190), 11 patients, including one with T-ALL, carried MBCR-ABL fusions indicative of p210 (six b2-a2 and five b3-a2). One of these patients with precursor B-ALL demonstrated co-expression of b3-a2 and e1-a2. The same assay can be used to specifically quantify relative transcript levels with respect to GAPDH expression as the endogenous RNA control. A real-time RT-PCR for GAPDH was previously established with a characteristic melting profile (89.1 ± 0.3°C).32Siraj AK Ozbek U Sazawal S Sirma S Timson G Al-Nasser A Bhargava M El Solh H Bhatia K Gutierrez MI Pre-clinical validation of a monochrome real-time multiplex assay for translocations in childhood acute lymphoblastic leukemia.Clin Cancer Res. 2002; 8: 3832-3840PubMed Google Scholar To generate a calibration curve for GAPDH transcripts, serial fivefold dilutions of leukemic cell line cDNA were run in triplicate. Similar data were obtained for different cell lines. We cloned the MBCR-ABL amplicon obtained from K562 and the mBCR-ABL amplicon obtained from SupB15 in a TA vector (pCR2.1) and used known amounts of these plasmids to independently generate a standard curve for each fusion template, measured as copy number. Data from triplicates were plotted as curves with r = −1.00 and error <0.103 (Figure 3). These standard curves indicate a linear detection of BCR-ABL transcripts over at least six logs. We could easily detect as little as 20 copies of plasmid. Standard deviation (SD) of less than 0.5 cycles was consistently observed, even in the reactions containing the least amount of copies (Table 1).Table 1Quantification of BCR-ABL Transcripts in Control SamplesMBCR-ABL (b3-a2)mBCR-ABL (e1-a2)BCR-ABL copies*Average copy number from three independent experiments.Relative level (copies/ng RNA)†Average BCR-ABL level (measured as copies) after normalization with GAPDH level (measured as ng RNA).Plasmid copy numberMean CpSDMean CpSD21,000,000NDND12.130.252100,00012.710.1716.050.06210,00016.350.1320.420.2621,00020.020.1624.640.94210023.590.0728.510.1121026.940.2732.230.402130.330.2236.600.19K562 (25 ng)21.080.156649132.98‡Average from the three dilutions shown, 119.53; standard deviation, 16.12.K562 (2.5 ng)24.800.01595123.96‡Average from the three dilutions shown, 119.53; standard deviation, 16.12.K562 (0.25 ng)28.360.3961101.67‡Average from the three dilutions shown, 119.53; standard deviation, 16.12.SupB15 (25 ng)26.232.11263997.74§Average from the three dilutions shown, 82.01; standard deviation, 13.70.SupB15 (2.5 ng)30.751.6018975.60§Average from the three dilutions shown, 82.01; standard deviation, 13.70.SupB15 (0.25 ng)33.830.741972.69§Average from the three dilutions shown, 82.01; standard deviation, 13.70.* Average copy number from three independent experiments.† Average BCR-ABL level (measured as copies) after normalization with GAPDH level (measured as ng RNA).‡ Average from the three dilutions shown, 119.53; standard deviation, 16.12.§ Average from the three dilutions shown, 82.01; standard deviation, 13.70. Open table in a new tab We calculated the inter- and intra-experiment variability using 10-fold dilutions of cell line cDNA (two independent reverse-transcription reactions) in three independent experiments in the LightCycler for MBCR-ABL and mBCR-ABL transcripts (Table 1). Normalized b3-a2 transcript levels in K562 ranged from 102 to 133 per ng of RNA, with an average of 119 and a SD of 16 (13%). Normalized e1-a2 transcript levels in SupB15 were lower, ranging from 73 to 98/ng RNA, with an average of 82 and a SD of 14 (16%). Inter-experiment variability was higher than intra-experiment variability; however, these variations were less than 1.4-fold. Further serial 10-fold dilutions of cell line cDNA were run in three independent experiments and fusion transcripts were easily detectable up to 10−4 for SupB15 and 10−5 for K562, indicating linearity of the assay over 4 and 5 logs, respectively, when cDNA is used as template. Having established these quantification parameters, we estimated the expression level of BCR-ABL in the positive patients. The level of fusion transcripts in individual patients varied notably, from 0.108 to 340.5 copies/ng RNA, representing more than 3000-fold difference at the time of presentation (Table 2). The average expression level was 64.3 copies/ng RNA. Patients with mBCR-ABL expressed higher levels (median 78.1 copies/ng RNA) than patients with MBCR-ABL (median 17.7 copies/ng RNA) (P = 0.05). Correlation of laboratory and clinical features including age, WBC counts, and gender is shown in Table 3.Table 2Relative Level of BCR-ABL Tra
Referência(s)