Portal de Periódicos da CAPES

Biochemical and biophysical characterization of human recombinant IgE-binding protein, an S-type animal lectin.

1992; Elsevier BV; Volume: 267; Issue: 20 Linguagem: Inglês

10.1016/s0021-9258(19)49693-2

1083-351X

Daniel K. Hsu, Riaz I. Zuberi, F T Liu,

Monoclonal and Polyclonal Antibodies Research

Properties of IgE-binding Lectinpressed recombinant human eBP in Escherichia coli and generated a polypeptide by collagenase digestion that contains only the carboxyl-terminal domain (eBP-C) and performed detailed analyses of various functional properties of both eBP and tBP-C. EXPERIMENTAL PROCEDURESMaterials-The E. coli expression vector pKK233-2 was from Pharmacia LKB Biotechnology Inc.Restriction enzymes were obtained from New England Biolabs or U. S. Biochemical Corp. Collagenase (Achromobacter iophagus) was from Boehringer Mannheim.[ l-~4C-~-Glucose]Lactose, specific activity 54.8 Ci/mmol, and Na"'1, specific activity 21.4 Ci/mmol, were from Amersham Corp., and 1,5difluoro-2,4-dinitrobenzene (DFDNB) was obtained from Pierce Chemical Co.Murine monoclonal antidinitrophenyl IgE has been described (20).Lactosyl-and sucrosyl-Sepharose 4B were prepared as described (19).Expression of Human cBP-Clone 2.2 coding for human tBP (9) was used as a template using the primers "AGCGGACCATGGCA-GACAAT and "CCCCAAGCTTCTTTCACTGTAATATTT, for the polymerase chain reaction (21) to generate DNA coding for intact tBP that includes an artificial NcoI site coinciding with the initiating ATG and a Hind111 site 3' to the termination codon.This DNA was inserted into the pKK233-2 vector at the NcoI-Hind111 sites, and the product, pDHtBP, was used to transform E. coli (strain JM107) by using standard procedures ( 22).Plasmids were isolated by the boiling lysis method ( 23) and positive transformants identified by restriction analysis.One positive clone, 2.2.3, was cultured in 2YT medium containing 1 mM isopropyl 1-thio-P-D-galactopyranoside.The bacteria were lysed by sonication ( 19), and the clarified lysates were mixed with lactosyl-or sucrosyl-Sepharose 4B.The bound proteins were eluted with electrophoresis sample buffer and subjected to SDS-PAGE and immunoblotting analysis using rabbit antibodies (antipeptide 1) directed against a peptide sequence shared by human and rat cBP (17).Nucleotide sequencing of clone 2.2.3 (24) confirmed its identity with cDNA clone 2.2 (9).Purification of tBP-Bacterial lysates were prepared as described previously ( 19), with the following modifications.Cultures of 2.2.3 were grown in 2YT medium and induced overnight with 1 mM isopropyl 1-thio-P-D-galactopyranoside.Bacterial pellets were resuspended in 0.20 culture volume of 20 mM Tris-HC1, pH 7.5, containing 5 mM EDTA, 1 mM dithiothreitol, 1 pg/ml leupeptin, 1 pg/ml pepstatin, 0.25 IU/ml aprotinin, and 20 mM cysteine and lysed by sonication (120 watts) at 4 "C over eight 30 s cycles separated by 1-min intervals.Lysates were clarified at 36,000 X g for 20 min at 4 "C and used immediately.cBP was purified from lysates by affinity chromatography in a column containing 13 ml of lactosyl-Sepharose 4B and washed with 20 mM Tris-HC1, pH 7.5, containing 150 mM NaCl, 10 mM EDTA, 0.25 IU/ml aprotinin followed by PBS containing 1 mM dithiothreitol (19).Elution was performed with a 30-ml 0-0.25 M linear gradient of lactose in PBS containing 1 mM dithiothreitol.Two pools of tBP were prepared from the column fractions based on SDS-PAGE profiles and are consistent with that reported for recombinant rat tBP (19).Earlier fractions (pool A) consisted of 18-kDa fragments of tBP in addition to cBP and were used to generate cBP-C by collagenase digestion.Later fractions (pool B) contained tBP appearing as a doublet at M, 29,000, typical of purified cBP and were used in experiments requiring tBP.Pools were concentrated with polyethylene glycol as before (19), and purified tBP was stored in PBS (10 mM sodium phosphate, 0.15 M NaCl, pH 7.2) containing 10% (v/v) glycerol at -85 'C.Digestion of cBP with Collagenase and Purification of End Product-Crystalline collagenase from A. wphugus with specificity for