Cooperative Primers
2013; Elsevier BV; Volume: 16; Issue: 2 Linguagem: Inglês
10.1016/j.jmoldx.2013.10.004
ISSN1943-7811
Autores Tópico(s)Advanced biosensing and bioanalysis techniques
ResumoThe increasing need to multiplex nucleic acid reactions presses test designers to the limits of amplification specificity in PCR. Although more than a dozen hot starts have been developed for PCR to reduce primer-dimer formation, none can stop the propagation of primer-dimers once formed. Even a small number of primer-dimers can result in false-negatives and/or false-positives. Herein, we demonstrate a new class of primer technology that greatly reduces primer-dimer propagation, showing successful amplification of 60 template copies with no signal dampening in a background of 150,000,000 primer-dimers. In contrast, normal primers, with or without a hot start, experienced signal dampening with as few as 60 primer-dimers and false-negatives with only 600 primer-dimers. This represents more than a 2.5 million–fold improvement in reduction of nonspecific amplification. We also show how a probe can be incorporated into the cooperative primer, with 2.5 times more signal than conventional fluorescent probes. The increasing need to multiplex nucleic acid reactions presses test designers to the limits of amplification specificity in PCR. Although more than a dozen hot starts have been developed for PCR to reduce primer-dimer formation, none can stop the propagation of primer-dimers once formed. Even a small number of primer-dimers can result in false-negatives and/or false-positives. Herein, we demonstrate a new class of primer technology that greatly reduces primer-dimer propagation, showing successful amplification of 60 template copies with no signal dampening in a background of 150,000,000 primer-dimers. In contrast, normal primers, with or without a hot start, experienced signal dampening with as few as 60 primer-dimers and false-negatives with only 600 primer-dimers. This represents more than a 2.5 million–fold improvement in reduction of nonspecific amplification. We also show how a probe can be incorporated into the cooperative primer, with 2.5 times more signal than conventional fluorescent probes. In the short time since its inception, PCR has become an almost indispensable part of medical and diagnostic sciences.1Mullis K. Faloona F. Scharf S. Saiki R. Horn G. Erlich H. Specific enzymatic amplification of DNA in vitro: the polymerase chain reaction.Cold Spring Harb Symp Quant Biol. 1986; 51: 263-273Crossref PubMed Google Scholar, 2Mullis K.B. The unusual origin of the polymerase chain reaction.Sci Am. 1990; 262 (64–65): 56-61Crossref PubMed Scopus (542) Google Scholar In PCR, a short DNA segment, called a primer, anneals to a target nucleic acid segment and is extended by the polymerase, amplifying the DNA present. Although rules have been described for the selection of primers,3Vallone P.M. Butler J.M. AutoDimer: a screening tool for primer-dimer and hairpin structures.Biotechniques. 2004; 37: 226-231PubMed Google Scholar primers often anneal to and amplify each other in an unpredictable manner, forming primer-dimers. This problem is compounded in multiplexed tests, where the large number of primers increases the probability of primer-dimer formation exponentially.3Vallone P.M. Butler J.M. AutoDimer: a screening tool for primer-dimer and hairpin structures.Biotechniques. 2004; 37: 226-231PubMed Google Scholar Primer-dimers compete with the target for the primers and can result in signal dampening, false-negatives, or even false-positives if the nonspecific amplification product also interacts with a probe. To try to prevent formation of primer-dimers, more than a dozen hot start methods have been invented, each of which limits the activity of the polymerase before an initial denaturing step.4Faloona F, Weiss S, Ferre F, Mullis K: Direct detection of HIV sequences in blood: high-gain polymerase chain reaction. Abstract 1019. Presented at the Sixth International Conference on AIDS, 1990 June 20-24. San Francisco, CAGoogle Scholar, 5Chou Q. Russell M. Birch D.E. Raymond J. Bloch W. Prevention of pre-PCR mis-priming and primer dimerization improves low-copy-number amplifications.Nucleic Acids Res. 1992; 20: 1717-1723Crossref PubMed Scopus (588) Google Scholar, 6Kaijalainen S. Karhunen P.J. Lalu K. Lindstrom K. An alternative hot start technique for PCR in small volumes using beads of wax-embedded reaction components dried in trehalose.Nucleic Acids Res. 1993; 21: 2959-2960Crossref PubMed Scopus (37) Google Scholar, 7Rapley R. Enhancing PCR amplification and sequencing using DNA-binding proteins.Mol Biotechnol. 1994; 2: 295-298Crossref PubMed Scopus (45) Google Scholar, 8Kaboev O.K. Luchkina L.A. Tret'iakov A.N. Bahrmand A.R. PCR hot start using primers with the structure of molecular beacons (hairpin-like structure).Nucleic Acids Res. 2000; 28: E94Crossref PubMed Scopus (45) Google Scholar, 9Kainz P. Schmiedlechner A. Strack H.B. Specificity-enhanced hot-start PCR: addition of double-stranded DNA fragments adapted to the annealing temperature.Biotechniques. 2000; 28: 278-282Crossref PubMed Scopus (24) Google Scholar, 10Kermekchiev M.B. Tzekov A. Barnes W.M. Cold-sensitive mutants of Taq DNA polymerase provide a hot start for PCR.Nucleic Acids Res. 2003; 31: 6139-6147Crossref PubMed Scopus (67) Google Scholar, 11Barnes W.M. Rowlyk K.R. Magnesium precipitate hot start method for PCR.Mol Cell Probes. 2002; 16: 167-171Crossref PubMed Scopus (13) Google Scholar, 12Koukhareva I. Haoqiang H. Yee J. Shum J. Paul N. Hogrefe R.I. Lebedev A.V. Heat activatable 3'-modified dNTPs: synthesis and application for hot start PCR.Nucleic Acids Symp Ser (Oxf). 2008; : 259-260Crossref PubMed Google Scholar, 13Lebedev A.V. Paul N. Yee J. Timoshchuk V.A. Shum J. Miyagi K. Kellum J. Hogrefe R.I. Zon G. Hot start PCR with heat-activatable primers: a novel approach for improved PCR performance.Nucleic Acids Res. 2008; 36: e131Crossref PubMed Scopus (42) Google Scholar, 14Kellogg D.E. Rybalkin I. Chen S. Mukhamedova N. Vlasik T. Siebert P.D. Chenchik A. TaqStart antibody: “hot start” PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase.Biotechniques. 1994; 16: 1134-1137PubMed Google Scholar, 15Birch D.E. Simplified hot start PCR.Nature. 1996; 381: 445-446Crossref PubMed Scopus (127) Google Scholar However, none of these can stop 100% of primer-dimer formation. Furthermore, the hot start protection is lost after the initial denaturing step, allowing more primer-dimers to be formed and propagated during amplification. Because the number of possible primer-dimer products increases polynomially with the number of primers in the reaction according to the function (n2+n)/2 where n is the number of primers, highly multiplexed tests can be difficult to design. With the increasing demand for highly multiplexed assays to diagnose cancers, drug resistance, and other disease, a solution must be found to the primer-dimer problem. Herein, we report on cooperative primers, the first technology to prevent primer-dimer formation and propagation during the actual amplification rounds (Figure 1). The primers consist of short sequences that would ordinarily not amplify the template. Because of the low primer melting temperature (Tm), unless the capture sequence binds holding the primer in close proximity to the template, the primers will not amplify. The polyethylene glycol linker connecting the primer and the capture sequence prevents the polymerase from extending through the capture sequence, retaining the primer specificity in each round of amplification. Nonspecific amplicons that do not have a complementary region to the capture sequence, such as primer-dimers, are not propagated. Because this process is repeated in every round of amplification, it results in an polynomial reduction of nonspecific amplification, in contrast to traditional hot starts, which are effective only before starting the reaction. In addition, when the capture sequence is labeled, it can double as a sequence-specific probe in reactions using a 5′-3′ exonuclease active polymerase. Because the capture sequence must bind for the primer to extend, theoretically 100% of primer extensions also result in probe hybridization and cleavage, increasing the signal-to-noise ratio. We hypothesized that these cooperative constructs would allow efficient amplification of the template while simultaneously reducing the impact of primer-dimers on assay results. The following reagents were obtained through the Malaria Research and Reference Reagent Resource Center as part of the Biodefense and Emerging Infections Research Resources Repository, National Institute of Allergy and Infectious Diseases, NIH: Genomic DNA, P. falciparum St. Lucia, MRA-331G; P. vivax Panama in Aotus, MRA-343G; P. brasilianum Peruvian III in Saimiri, MRA-349G; P. cynomolgi bastianellii in Rhesus, MRA-350G; P. cynomolgi Smithsonian in Rhesus, MRA-351G; P. fragile-type strain in Rhesus, MRA-352G; P. simium Howler in Saimiri, MRA-353G; P. knowlesi H strain, MRA-456 G; and P. falciparum FCR-3/Gambia clone D-4, knobless, MRA-739G. Adapting math previously derived for cooperative probes16Satterfield B.C. Bartosiewicz M. West J.A. Caplan M.R. Surpassing specificity limits of nucleic acid probes via cooperativity.J Mol Diagn. 2010; 12: 359-367Abstract Full Text Full Text PDF PubMed Scopus (6) Google Scholar, 17Satterfield B.C. West J.A. Caplan M.R. Tentacle probes: eliminating false positives without sacrificing sensitivity.Nucleic Acids Res. 2007; 35: e76Crossref PubMed Scopus (18) Google Scholar and neglecting entropic/enthalpic penalties due to restricting mobility from the linker, the effective equilibrium constant for cooperative primers can be expressed as follows:Keff=Kprimer+Kcap+PLKprimerKcap=Ccap+Cprimer+CbothPT(1) where K is the equilibrium constant, with the added subscripts cap, primer, both, and eff referring to capture sequence, primer, both capture sequence and primer, and effective, respectively.P=Po−Ccap−Cprimer−Cboth,T=To−Ccap−Cprimer−Cboth(2) where Po and To are initial primer and target concentrations, respectively, PL refers to the local primer concentration [PL = 1 molecule/(volume swept out by linker length × Avogadro's number)], and C is the concentration of the sequence indicated by the subscript that is hybridized to the template. From this equation, the effective primer binding efficiency (Eff) in the initial rounds of amplification (eg, Po >> To) can be calculated as follows:Eff=Cprimer+CbothT0=(Kprimer+PLKprimerKcap)P01+KeffP0(3) Exploration of predicted enthalpy and entropy values to evaluate the equilibrium constants in equation (1) reveals that primers with predicted Tms 7°C to 12°C below the reaction temperature can still amplify with up to 99% efficiency when coupled with capture sequences with an equal or greater Tm and when separated by three or fewer hexaethylene glycol sequences (HEGs). When six HEG linkers separate the primer and the capture sequence, 99% efficiencies can still be obtained with predicted primer Tms 4°C to 7°C below the reaction temperature. For proof of concept, cooperative primers were designed to the human beta-actin gene, the mitochondrial sequence of Plasmodium spp., and the rpoB D516V mutation in Mycobacterium tuberculosis (Table 1). The primer sequence was designed with a Tm 3°C to 9°C below the reaction temperature. The capture sequence was designed with a Tm 3°C to 11°C below the reaction temperature or 5°C and 7°C above the reaction temperature. The capture sequence was also labeled with a FAM/Dabcyl FRET pair to determine an optimal method of incorporating a probe into the cooperative primer. One of the primers, PfcF inv 62HP, had hairpin secondary structure intentionally designed into the capture sequence to improve quenching of the fluorophore. Sufficient HEGs were used as linkers for the primer and the capture sequence to bind in a rigid double helix. Three or six HEGs (for cooperative primers with the linker attached to the 5′ or 3′ end of the capture sequence, respectively) were used to link the capture sequence to the primer.Table 1Oligonucleotide SequencesNameSequences∗Some of the cooperative primers have inverted bases as indicated by containing sequences 3′-5′ and 5′-3′.Tm primerTm captureBeta-actin (amplification efficiency) Normal primers/probesb-act P5′-[FAM]TGTGGCCGAGGACTTTGACGGC[BHQ1]-3′ Cooperative primersb-act cF3′-AGTGGCAAGGTC-5′[Sp18][Sp18][Sp18]5′-GGTGACAGCAGTC[Sp3]-3′52.350.8b-act cR3′-TAGGATTTTCGGTG-5′[Sp18][Sp18][Sp18]5′-GCAAGGGACTTCC[Sp3]-3′48.151.4 TemplatesBeta-actin5′-AGGATTTAAAAACTGGAACGGTGAAGGTGACAGCAGTCGGTTGGAGCGAGCATCCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTTTTTAATAGTCATTCCAAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCCATCCTAAAAGCCACCCCA-3′P. falciparum (impact of primer-dimers and probe selection) Normal primers/probesPfnF5′-CGCATCGCTTCTAACGGTGA-3′PfnR5′-GAAGCAAACACTAGCGGTGGAA-3′PfP5′-[FAM]ACTCTCATTCCAATGGAACCTTGTTCAAGTTCAAACCATTGGAA[DABC]-3′ Cooperative primers/probesPfcF inv3′-TCGCTACGCA-5′[Sp18][Sp18][Sp18]5′-[FAM]ACGGTGAACTCTCA[DABC]-3′46.652.8PfcF inv623′-TCGCTACGCA-5′ [Sp18][Sp18][Sp18] 5′-[T(FAM)]ACGGTGAACTCTCATTCCA[DABC]-3′46.662.0PfcF inv62HP3′-TCGCTACGCA-5′[Sp18][Sp18][Sp18]5′-[T(FAM)]ACGGTGAACTCTCATTCCACCG[DABC]-3′46.662.0PfcF5′-[FAM]ACGGTGAACTCTCA[DABC][Sp18][Sp18][Sp18][Sp18][Sp18][Sp18]ACGCATCGCT-3′46.652.8PfcR inv3′-ATTGACATACCTGC-5′[Sp18][Sp18][Sp18]5′-AGCAAGTGGAATGTT [Phos]-3′47.353.2 Low-Tm primers minus capture sequencePf Low Tm F5′-ACGCATCGCT-3′46.6Pf Low Tm R5′-CGTCCATACAGTTA-3′47.3 TemplatesNormal primer-dimer5′-GAAGCAAACACTAGCGGTGGAATCACCGTTAGAAGCGATGCG-3′Cooperative primer-dimer5′-CGTCCATACAGTTAAGCGATGCGT-3′P. falciparum5′-CCAGCTCACGCATCGCTTCTAACGGTGAACTCTCATTCCAATGGAACCTTGTTCAAGTTCAAATAGATTGGTAAGGTATAGTGTTTACTATCAAATGAAACAATGTGTTCCACCGCTAGTGTTTGCTCTAACATTCCACTTGCTTATAACTGTATGGACG-3′M. tuberculosis (SNP differentiation) Normal primers/probesMTb P5′-[FAM]CGCCGCGATCAAGGAGTTCGCG[BHQ1]-3′ Cooperative primers/probesMTb cF3′-ACACTAGCGGAG-5′[Sp18][Sp18][Sp18]5′-CGCAGACGTTGAT [Phos]-3′46.552.5MTb cR15′-[CF 560]TGGACCATGAATTGGCT[BHQ1][Sp18][Sp18][Sp18][Sp18][Sp18][Sp18]CAGCGGGTTGTT-3′50.959.5MTb cR25′-[CF 560]TGGaCCATGAATTGG[BHQ1][Sp18][Sp18][Sp18][Sp18][Sp18][Sp18]CAGCGGGTTGTT-3′50.952.5MTb cR35′-[CF 560]CATGAATTGGCTCAGCTG[BHQ1][Sp18][Sp18][Sp18][Sp18][Sp18][Sp18]GGGTTGTTCTGGA-3′48.759.3MTb cR45′-[CF 560]CATGAATTGGCTCAGCTG[BHQ1][Sp18][Sp18][Sp18][Sp18][Sp18][Sp18]CGGGTTGTTCTAGA-3′44.859.3MTb cR55′-[CF 560]TGGACCATGAATTGG [BHQ1][Sp18][Sp18][Sp18][Sp18][Sp18][Sp18]AGCGGGTTGTT-3′48.452.5MTb cR65′-[CF 560]TGGACCATGAATTG[BHQ1] [Sp18][Sp18][Sp18][Sp18][Sp18][Sp18]CAGCGGGTTGTT-3′50.947.9MTb cR75′-[CF 560]TGGaCCATGAATT[BHQ1][Sp18][Sp18][Sp18][Sp18][Sp18][Sp18]CAGCGGGTTGTT-3′50.943.3MTb cR85′-[CF 560]CATGAATTGGCTCAGCTG[BHQ1][Sp18][Sp18][Sp18][Sp18][Sp18][Sp18]GGGTTGTTCTcGa-3′34.859.3MTb cR95′-[CF 560]CATGAATTGGCTCAGCTG[BHQ1][Sp18][Sp18][Sp18][Sp18][Sp18][Sp18]GGGTTcTTCTGGA-3′29.559.3 TemplatesMTb WT5′-CGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGA-3′MTb D516V5′-CGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGCCAATTCATGGTCCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGA-3′The boldfaced bases in the probes are the bases added to the 3′ end to form the stem. [FAM] or [CF 560] is the fluorophore FAM or Cal Fluor 560 at the 5′ end of the probes. [Sp18] is an 18-atom polyethylene glycol linker (eg, a HEG linker approximately six nucleotides in length). [Sp3] and [Phos] block extension at the 3′ end of some of the capture sequences and are a three-carbon linker and a phosphate molecule, respectively. [DABC] is the dabcyl quencher, and [BHQ1] is the Black Hole Quencher 1.∗ Some of the cooperative primers have inverted bases as indicated by containing sequences 3′-5′ and 5′-3′. Open table in a new tab The boldfaced bases in the probes are the bases added to the 3′ end to form the stem. [FAM] or [CF 560] is the fluorophore FAM or Cal Fluor 560 at the 5′ end of the probes. [Sp18] is an 18-atom polyethylene glycol linker (eg, a HEG linker approximately six nucleotides in length). [Sp3] and [Phos] block extension at the 3′ end of some of the capture sequences and are a three-carbon linker and a phosphate molecule, respectively. [DABC] is the dabcyl quencher, and [BHQ1] is the Black Hole Quencher 1. For the cooperative primers with the linker attached to the 5′ end of the capture sequence, a blocking carbon chain was placed at the 3′ end of the capture sequence to prevent it from being used as a primer. To attach the linker to the 5′ end of the capture sequence (eg, with the 5′ end of the primer linked to the 5′ end of the capture sequence), the primer had to be synthesized with an inverted linkage (Table 1). Reverse amidites were used to switch the strand polarity at this linkage using otherwise standard solid-phase synthesis for oligonucleotide manufacture. A reverse amidite comprises a dimethoxytrityl or similar protecting group at the 3′-hydroxyl of a deoxynuceloside and a phosphate group at the 5′-hydroxyl of a deoxynucleoside such that the 5′ region of the reverse amidite is amenable for linkage to a 5′-OH or 3′-OH of another nucleoside. Sequences made from inverted bases function like normal primers. The orientation affects only the direction of binding (Figure 1A). Control primers for determining normal primer amplification efficiency and susceptibility to primer-dimers were designed with a Tm 5°C to 7°C above the reaction temperature. This gave the primers just enough affinity to maximize binding to the template for good amplification efficiency without unduly increasing the likelihood of spurious product formation. An additional set of control primers was identical to the short primer sequence in the cooperative primer and was designed to verify that cooperative primers cannot amplify properly without the capture sequence. Primer-dimers, by definition, were designed as the perfect complement of each primer set, with 3′ ends touching each other. Synthesis of cooperative primers was performed by Biosearch Technologies (Petaluma, CA). Dual high-performance liquid chromatography purification was used to purify the cooperative primers. Template was synthesized by either Biosearch Technologies or Integrated DNA Technologies (Coralville, IA) with no purification. Human beta-actin real-time PCR was run by making a master mix with a 250-nmol/L final concentration of each primer/probe (b-act P, b-act cF, b-act cR), a 5-mmol/L final concentration of MgCl2, and an additional 0.275 U per reaction of GoTaq polymerase in GoTaq colorless master mix (Promega Corp., Madison, WI). Dilutions of template were made using 600,000, 6000, 60, and 0 copies. The reaction was run on the StepOne system (Applied Biosystems, Foster City, CA) and included a 20-second denaturing step at 95°C followed by 45 cycles at 95°C for 1 second and 55°C for 20 seconds. Reactions were run in duplicate. A log plot of the concentration versus the CT was used to find the slope from which to calculate PCR efficiency. Plasmodium falciparum PCR was run by making a master mix with a 250-nmol/L final concentration of each primer for cooperative primers (PfcF inv62, PfcR inv) or normal primers (PfnF, PfnR, PfP), a 5-mmol/L final concentration of MgCl2, and an additional 0.275 U per reaction of GoTaq polymerase in GoTaq colorless master mix (Promega Corp.). Sixty copies of template were added to each reaction and 0, 60, 600, 6000, 600,000, 6,000,000, 60,000,000, 150,000,000, or 150,000,000,000 primer-dimers were placed in each. Each reaction was run in duplicate. The reaction with normal primers was repeated using GoTaq hot start and GoTaq hot start colorless master mix. The reactions were run on the StepOne system (Applied Biosystems) and included a 20-second denaturing step at 95°C followed by 50 cycles at 95°C for 1 second and 55°C for 20 seconds. After amplification, the PCR products were run on a 2.2% FlashGel system (Lonza Inc., Walkersville, MD) and were imaged. As a follow-up to verify that the results from the cooperative primers were due to cooperativity, the cooperative primers were made without a capture sequence (Pf Low Tm F and Pf Low Tm R). Combined with the probe (PfP) and using the same master mix and thermocycling conditions as noted previously herein, 0, 60, 6000, 600,000, or 6,000,000 copies of template were added to the reaction. Reactions were run in duplicate. To analyze performance in complex samples, 5000 copies of P. falciparum DNA were spiked into 0, 0.6, 1.2, or 3 μg of human gDNA (BioChain Institue Inc., Newark, CA). A cooperative primer with a long capture sequence (PfcF inv62) and a cooperative primer with a short capture sequence (PfcF) were compared with normal primers (PfnF and PfnR). Each master mix had a 500-nmol/L final concentration of primers, a 5-mmol/L final concentration of MgCl2, and an additional 0.275 U per reaction of GoTaq polymerase in GoTaq colorless master mix (Promega Corp.). Each reaction was run in duplicate. The reactions were run using the ABI 7500 system (Applied Biosystems) and included a 20-second denaturing step at 95°C followed by 50 cycles at 95°C for 3 seconds and 55°C for 32 seconds. After amplification, the PCR products were run on a 2.2% FlashGel system (Lonza Inc.) and were imaged. P. falciparum real-time PCR was run by making a master mix with a 250-nmol/L final concentration of each primer (PfcF inv, PfcF inv62, PfcF inv62HP, or PfcF with PfcR inv), a 5-mmol/L final concentration of MgCl2, and an additional 0.275 U per reaction of GoTaq polymerase in GoTaq colorless master mix (Promega Corp.). Five million, 600,000, 50,000, 500, or 0 copies of template were added to each reaction. The reaction was run on the StepOne system (Applied Biosystems) and included a 20-second denaturing step at 95°C followed by 45 cycles at 95°C for 1 second and 55°C for 20 seconds. Each reaction was run in duplicate. Because of higher fluorescent signals, the capture sequence with the 3′ end attached to the linker was selected as the method for making the probe in the remaining experiments. The cooperative primers PfcF and PfcR inv, selected previously herein, were then used with the same cycling conditions to analyze 5 μL of 1:1000 dilutions (approximately 50 pg of purified genetic material, frozen for 4 years) from Plasmodium samples obtained from BEI Resources Repository (Manassas, VA), including P. falciparum St. Lucia, Plasmodium vivax Panama in Aotus, Plasmodium brasilianum Peruvian III in Saimiri, Plasmodium cynomolgi bastianellii in Rhesus, P. cynomolgi Smithsonian in Rhesus, Plasmodium fragile–type strain in Rhesus, Plasmodium simium Howler in Saimiri, Plasmodium knowlesi H strain, and P. falciparum FCR-3/Gambia clone D-4, knobless. Negative controls were included, and all the tests were run in duplicate. M. tuberculosis real-time PCR for the D516V mutation in the rpoB gene conferring rifampicin resistance was run by making a master mix with a 250-nmol/L final concentration of each primer/probe (MTb cF, MTb P, and one of MTb cR1, MTb cR2, MTb cR3, MTb cR4, MTb cR5, MTb cR6, MTb cR7, MTb cR8, or MTb cR9), a 5-mmol/L final concentration of MgCl2, and an additional 0.275 U per reaction of GoTaq polymerase in GoTaq colorless master mix (Promega Corp.). Fifty thousand copies of template (MTb WT or MTb D516V) were added to each reaction. Each reaction was run in duplicate. The reaction was run using the ABI 7500 system (Applied Biosystems) and included a 20-second denaturing step at 95°C followed by 45 cycles at 95°C for 3 seconds and 55°C for 32 seconds. The CTs were automatically determined by the machine with a threshold of 10,000, and the ΔRn was taken from cycle 45 of the exported data. To evaluate the concept for cooperative primers, the first step was to see whether they would even amplify and, if so, with what efficiency (Figure 2). The beta-actin forward cooperative primer (b-act cF) had a Tm that was 2.7°C below the reaction temperature, and the reverse cooperative primer (b-act cR) had a Tm 6.9°C below the reaction temperature. Even so, the primer set amplified with near perfect efficiency, with a calculated amplification efficiency of 110%. Once the amplification efficiency was shown to be sufficient, we tested the central hypothesis behind cooperative primers: the ability to eliminate propagation of primer-dimers. We spiked up to 600,000 primer-dimers (100 fmol/L final concentration) into a malaria reaction with only 60 copies of P. falciparum template (Figure 3). There was no visible amplification of spiked-in primer-dimers or dampening of the amplification product when cooperative primers were used. In contrast, the addition of only 600 primer-dimers to a reaction with normal primers resulted in false-negatives. Next, we determined whether a traditional antibody-mediated hot start could stop primer-dimer propagation with regular primers (Figure 4). However, the results were similar with or without hot start. Primer-dimers were already competing with the template with only 60 primer-dimers and completely eclipsed the template amplification with 600 primer-dimers. Hot starts are capable only of preventing primer-dimer formation during reaction setup. Once primer-dimers form, they cannot stop primer-dimer propagation.Figure 4Effect of hot start on primer-dimer (P-D) propagation in reactions with normal primers. A hot start does not stop propagation of low-copy-number P-Ds spiked into the reaction with normal primers. Sixty P-Ds competed with template amplification, and 600 P-Ds eclipsed template amplification, resulting in a false-negative. Each concentration was run in duplicate.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In a subsequent experiment, we attempted to find the limit of specificity for cooperative primers (Figure 5). Only once the primer-dimer concentration was within an order of magnitude of the primer concentration with 150,000,000,000 primer-dimers spiked into the 10-μL reaction were primer-dimers finally formed and the product eclipsed. In contrast, it took only 600 primer-dimers to eclipse the P. falciparum amplification product using normal primers with or without a hot start. This is consistent with our experience that a 10-fold excess of a competitive reaction product is sufficient to result in false-negatives when using normal primers. Cooperative primers were spiked with up to 150,000,000 primer-dimers, 2.5 million times more primer-dimers than template, with no signs of dampening of the amplification product. To verify that the result was truly due to cooperativity, the cooperative primers were created without a capture sequence. These isolated, low-Tm primers did not amplify primer-dimers but were also incapable of detectably amplifying even up to 600,000 copies of P. falciparum DNA (data not shown). In contrast, cooperative primers exhibited efficient amplification and detection of low copy numbers, demonstrating the importance of the cooperative link to the capture sequence. To evaluate cooperative primers in complex samples, two different cooperative primers, one with a long capture sequence (PfcF inv62) and the other with a short capture sequence (PfcF), were compared with normal primers PfnF and PfnR (Table 2). Five thousand copies of Plasmodium DNA were spiked into 0.6, 1.2, or 3 μg of human gDNA. All the primers were able to successfully amplify the Plasmodium sequence in a background of 0.6 μg of gDNA, but the cooperative primer with the 62°C-Tm capture sequence did not amplify template in a background of 1.2 μg of gDNA. The short capture sequence cooperative primer and the normal primers did not amplify the template in a background of 3 μg of gDNA.Table 2Summary of Amplification Results in gDNAgDNA (μg)52.8°C capture62°C captureNormal primers0AmplifiedAmplifiedAmplified0.6AmplifiedAmplifiedAmplified1.2AmplifiedFailedAmplified3.0FailedFailedFailedCooperative primers and normal primers amplify the target in a background of 0.6 μg of gDNA but not in a background of 3.0 μg of gDNA. The cooperative primer with a longer capture sequence (Tm of 62°C) was not as effective as the cooperative primer with a shorter capture sequence (Tm of 52.8°C) at amplifying the target in a background of gDNA. Open table in a new tab Cooperative primers and normal primers amplify the target in a background of 0.6 μg of gDNA but not in a background of 3.0 μg of gDNA. The cooperative primer with a longer capture sequence (Tm of 62°C) was not as effective as the cooperative primer with a shorter capture sequence (Tm of 52.8°C) at amplifying the target in a background of gDNA. Because probes incorporated into primers have shown relatively high signal to noise in the past,18Whitcombe D. Theaker J. Guy S.P. Brown T. Little S. Detection of PCR products using self-probing amplicons and fluorescence.Nat Biotechnol. 1999; 17: 804-807Crossref PubMed Scopus (620) Google Scholar we attempted to incorporate a probe into the cooperative primer. This was done by labeling the capture sequence. First, inverted primers were attached to the 5′ end of capture sequences. To characterize the effectiveness of labeling the capture sequence, three different capture sequences were used. The first had a Tm below the reaction temperature (PfcF inv), the second had a Tm above the reaction temperature (PfcF inv62), and the third formed a hairpin to encourage greater quenching (PfcF inv 62HP). However, very little signal was observed from any of these primers (data not shown), and ele
Referência(s)