Voltar
Artigo Acesso aberto Revisado por pares
BIBTEX RIS

The Mre11/Rad50/Nbs1 Complex Plays an Important Role in the Prevention of DNA Rereplication in Mammalian Cells

2007; Elsevier BV; Volume: 282; Issue: 44 Linguagem: Inglês

10.1074/jbc.m705486200

ISSN

1083-351X

Autores

Alan Yueh‐Luen Lee, Enbo Liu, Xiaohua Wu,

Tópico(s)

Genomics and Chromatin Dynamics

Resumo

The Mre11/Nbs1/Rad50 complex (MRN) plays multiple roles in the maintenance of genome stability, including repair of double-stranded breaks (DSBs) and activation of the S-phase checkpoint. Here we demonstrate that MRN is required for the prevention of DNA rereplication in mammalian cells. DNA replication is strictly regulated by licensing control so that the genome is replicated once and only once per cell cycle. Inactivation of Nbs1 or Mre11 leads to a substantial increase of DNA rereplication induced by overexpression of the licensing factor Cdt1. Our studies reveal that multiple mechanisms are likely involved in the MRN-mediated suppression of rereplication. First, both Mre11 and Nbs1 are required for facilitating ATR activation when Cdt1 is overexpressed, which in turn suppresses rereplication. Second, Cdt1 overexpression induces ATR-mediated phosphorylation of Nbs1 at Ser343 and this phosphorylation depends on the FHA and BRCT domains of Nbs1. Mutations at Ser343 or in the FHA and BRCT domains lead to more severe rereplication when Cdt1 is overexpressed. Third, the interaction of the Mre11 complex with RPA is important for the suppression of rereplication. This suggests that modulating RPA activity via a direct interaction of MRN is likely one of the effector mechanisms to suppress rereplication. Moreover, we demonstrate that MRN is also required for preventing the accumulation of DSBs when rereplication is induced. Therefore, our studies suggest new roles of MRN in the maintenance of genome stability through preventing rereplication and rereplication-associated DSBs when licensing control is compromised. The Mre11/Nbs1/Rad50 complex (MRN) plays multiple roles in the maintenance of genome stability, including repair of double-stranded breaks (DSBs) and activation of the S-phase checkpoint. Here we demonstrate that MRN is required for the prevention of DNA rereplication in mammalian cells. DNA replication is strictly regulated by licensing control so that the genome is replicated once and only once per cell cycle. Inactivation of Nbs1 or Mre11 leads to a substantial increase of DNA rereplication induced by overexpression of the licensing factor Cdt1. Our studies reveal that multiple mechanisms are likely involved in the MRN-mediated suppression of rereplication. First, both Mre11 and Nbs1 are required for facilitating ATR activation when Cdt1 is overexpressed, which in turn suppresses rereplication. Second, Cdt1 overexpression induces ATR-mediated phosphorylation of Nbs1 at Ser343 and this phosphorylation depends on the FHA and BRCT domains of Nbs1. Mutations at Ser343 or in the FHA and BRCT domains lead to more severe rereplication when Cdt1 is overexpressed. Third, the interaction of the Mre11 complex with RPA is important for the suppression of rereplication. This suggests that modulating RPA activity via a direct interaction of MRN is likely one of the effector mechanisms to suppress rereplication. Moreover, we demonstrate that MRN is also required for preventing the accumulation of DSBs when rereplication is induced. Therefore, our studies suggest new roles of MRN in the maintenance of genome stability through preventing rereplication and rereplication-associated DSBs when licensing control is compromised. In each cell cycle, the genome has to be precisely replicated and segregated into daughter cells. To ensure the accuracy of DNA replication, it is essential that no segment of chromosome DNA is replicated more than once (1Bell S.P. Kim A. Annu. Rev. Biochem. 2002; 71: 333-374Crossref PubMed Scopus (1410) Google Scholar, 2Arias E.E. Kim J.C. Genes Dev. 2007; 21: 497-518Crossref PubMed Scopus (327) Google Scholar). Re-initiation of DNA replication, even from limited sites of the genome, would inevitably lead to genome instability, which is a common feature of cancer cells (3Karakaidos P. Kim S. Vassiliou L.V. Zacharatos P. Kastrinakis N.G. Kougiou D. Kouloukoussa M. Nishitani H. Papavassiliou A.G. Lygerou Z. Gorgoulis V.G. Am. J. Pathol. 2004; 165: 1351-1365Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 4Pinyol M. Kim I. Bea S. Fernandez V. Colomo L. Campo E. Jares P. Int. J. Cancer. 2006; 119: 2768-2774Crossref PubMed Scopus (26) Google Scholar). DNA replication is strictly regulated by the licensing mechanism, which allows formation of prereplication complexes (pre-RCs) only in late mitosis and prior to S phase (1Bell S.P. Kim A. Annu. Rev. Biochem. 2002; 71: 333-374Crossref PubMed Scopus (1410) Google Scholar, 5Blow J.J. Kim A. Nat. Rev. Mol. Cell Biol. 2005; 6: 476-486Crossref PubMed Scopus (536) Google Scholar). Licensing begins with the recruitment of Cdc6 and Cdt1 to origins by chromatin-bound ORC, which in turn facilitates chromatin loading of the MCM2–7 complexes. Two protein kinases, cyclin-dependent kinase (CDK) and Dbf4-dependent kinase (DDK), are required to activate the licensed origins to initiate DNA replication by stimulating DNA unwinding from the origins. After the onset of replication initiation, the origins are converted to an unlicensed state by disassembling the pre-RCs, which leaves only ORC bound to chromatin. To avoid a second round of DNA initiation, multiple mechanisms are involved in the prevention of reassembly of pre-RCs within the same cell cycle. Among these mechanisms, control of Cdt1 activity in a cell cycle-regulated manner has been shown to be critical (2Arias E.E. Kim J.C. Genes Dev. 2007; 21: 497-518Crossref PubMed Scopus (327) Google Scholar, 5Blow J.J. Kim A. Nat. Rev. Mol. Cell Biol. 2005; 6: 476-486Crossref PubMed Scopus (536) Google Scholar). Cdt1 is stable in G1 and is targeted for degradation at the onset of S-phase (6Zhong W. Kim H. Santiago F.E. Kipreos E.T. Nature. 2003; 423: 885-889Crossref PubMed Scopus (261) Google Scholar, 7Arias E.E. Kim J.C. Genes Dev. 2005; 19: 114-126Crossref PubMed Scopus (167) Google Scholar, 8Li X. Kim Q. Liao R. Sun P. Wu X. J. Biol. Chem. 2003; 278: 30854-30858Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar, 9Nishitani H. Kim S. Lygerou Z. Nishimoto T. J. Biol. Chem. 2001; 276: 44905-44911Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar). Geminin, expressed after cells enter S-phase, binds to Cdt1 and directly inhibits Cdt1 function at origins (10Wohlschlegel J.A. Kim B.T. Dhar S.K. Cvetic C. Walter J.C. Dutta A. Science. 2000; 290: 2309-2312Crossref PubMed Scopus (589) Google Scholar, 11Tada S. Kim A. Maiorano D. Mechali M. Blow J.J. Nat. Cell Biol. 2001; 3: 107-113Crossref PubMed Scopus (392) Google Scholar). Recent studies demonstrated that overexpression of Cdt1 or down-regulation of geminin disrupts the licensing control and induces rereplication, which consequently causes genome instability (12Vaziri C. Kim S. Jeon Y. Lee C. Murata K. Machida Y. Wagle N. Hwang D.S. Dutta A. Mol. Cell. 2003; 11: 997-1008Abstract Full Text Full Text PDF PubMed Scopus (342) Google Scholar, 13Zhu W. Kim Y. Dutta A. Mol. Cell Biol. 2004; 24: 7140-7150Crossref PubMed Scopus (206) Google Scholar, 14Melixetian M. Kim A. Masiero L. Gasparini P. Zamponi R. Bartek J. Lukas J. Helin K. J. Cell Biol. 2004; 165: 473-482Crossref PubMed Scopus (218) Google Scholar). Unbalanced expression of Cdt1 or other replication licensing factors as well as DNA hyperreplication has been observed to be associated with tumorigenesis (3Karakaidos P. Kim S. Vassiliou L.V. Zacharatos P. Kastrinakis N.G. Kougiou D. Kouloukoussa M. Nishitani H. Papavassiliou A.G. Lygerou Z. Gorgoulis V.G. Am. J. Pathol. 2004; 165: 1351-1365Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 4Pinyol M. Kim I. Bea S. Fernandez V. Colomo L. Campo E. Jares P. Int. J. Cancer. 2006; 119: 2768-2774Crossref PubMed Scopus (26) Google Scholar, 15Arentson E. Kim P. Seo J. Moon E. Studts J.M. Fremont D.H. Choi K. Oncogene. 2002; 21: 1150-1158Crossref PubMed Google Scholar, 16Di Micco R. Kim M. Cicalese A. Piccinin S. Gasparini P. Luise C. Schurra C. Garre M. Nuciforo P.G. Bensimon A. Maestro R. Pelicci P.G. d'Adda di Fagagna F. Nature. 2006; 444: 638-642Crossref PubMed Scopus (1425) Google Scholar). DNA rereplication causes accumulation of DNA lesions and triggers DNA damage responses observed in multiple organisms (12Vaziri C. Kim S. Jeon Y. Lee C. Murata K. Machida Y. Wagle N. Hwang D.S. Dutta A. Mol. Cell. 2003; 11: 997-1008Abstract Full Text Full Text PDF PubMed Scopus (342) Google Scholar, 13Zhu W. Kim Y. Dutta A. Mol. Cell Biol. 2004; 24: 7140-7150Crossref PubMed Scopus (206) Google Scholar, 17Archambault V. Kim A.E. Drapkin B.J. Cross F.R. Mol. Cell Biol. 2005; 25: 6707-6721Crossref PubMed Scopus (68) Google Scholar, 18Green B.M. Kim J.J. Mol. Biol. Cell. 2005; 16: 421-432Crossref PubMed Scopus (53) Google Scholar, 19Li A. Kim J.J. EMBO J. 2005; 24: 395-404Crossref PubMed Scopus (115) Google Scholar, 20Zhu W. Kim A. Mol. Cell Biol. 2006; 26: 4601-4611Crossref PubMed Scopus (73) Google Scholar). The activation of damage checkpoint inhibits the extent of rereplication (19Li A. Kim J.J. EMBO J. 2005; 24: 395-404Crossref PubMed Scopus (115) Google Scholar) and arrests cell cycle at the G2/M stages (13Zhu W. Kim Y. Dutta A. Mol. Cell Biol. 2004; 24: 7140-7150Crossref PubMed Scopus (206) Google Scholar, 20Zhu W. Kim A. Mol. Cell Biol. 2006; 26: 4601-4611Crossref PubMed Scopus (73) Google Scholar). Our recent studies demonstrated that upon Cdt1 overexpression, single-stranded DNA (ssDNA) 3The abbreviations used are: ssDNA, single-stranded DNA; FACS, fluorescence-activated cell sorting; MRN, Mre11/Nbs1/Rad50 complex; DSB, double-stranded breaks; hpi, hour postinfection; pfu, plague-forming unit. is accumulated prior to the appearance of DSBs, which activates the ATR pathway that effectively prevents further rereplication (75Liu E. Kim A.Y.-L. Chiba T. Olson E. Sun P. Wu X. J. Cell Biol. 2007; (in press)Google Scholar). Therefore, cell cycle checkpoint is not only capable of detecting abnormal DNA structures when the licensing control is compromised, but is also actively involved in inhibiting rereplication. The Mre11/Rad50/Nbs1 complex (MRN) is a highly conserved protein complex that plays major roles in the maintenance of genome stability (21D'Amours D. Kim S.P. Nat. Rev. Mol. Cell Biol. 2002; 3: 317-327Crossref PubMed Scopus (721) Google Scholar, 22Assenmacher N. Kim K.P. Chromosoma. 2004; 113: 157-166Crossref PubMed Scopus (112) Google Scholar). Hypomorphic mutations in Nbs1 and Mre11 result in autosomal recessive diseases Nijmegen breakage syndrome (NBS) and ataxia-telangiectasia-like disorder (ATLD), respectively (23Shiloh Y. Annu. Rev. Genet. 1997; 31: 635-662Crossref PubMed Scopus (429) Google Scholar, 24Taylor A.M. Kim A. Byrd P.J. DNA Repair (Amst.). 2004; 3: 1219-1225Crossref PubMed Scopus (207) Google Scholar). The radioresistant DNA synthesis (RDS) phenotype of NBS and ATLD cells suggests a critical role of MRN in mediating the intra-S-phase checkpoint (23Shiloh Y. Annu. Rev. Genet. 1997; 31: 635-662Crossref PubMed Scopus (429) Google Scholar, 25Stewart G.S. Kim R.S. Stankovic T. Bressan D.A. Kaplan M.I. Jaspers N.G. Raams A. Byrd P.J. Petrini J.H. Taylor A.M. Cell. 1999; 99: 577-587Abstract Full Text Full Text PDF PubMed Scopus (862) Google Scholar). MRN binds directly to ATM and stimulates ATM kinase activity to phosphorylate its multiple substrates (26Lee J.H. Kim T.T. Science. 2004; 304: 93-96Crossref PubMed Scopus (592) Google Scholar, 27Uziel T. Kim Y. Moyal L. Andegeko Y. Mittelman L. Shiloh Y. EMBO J. 2003; 22: 5612-5621Crossref PubMed Scopus (854) Google Scholar, 28You Z. Kim C. Bailis J. Hunter T. Russell P. Mol. Cell Biol. 2005; 25: 5363-5379Crossref PubMed Scopus (342) Google Scholar). Meanwhile, Nbs1 is also a downstream substrate of ATM, with ATM-dependent phosphorylation of Nbs1 at least at serine residue 343 (Ser343) is required for mediating the intra-S-phase checkpoint (29Wu X. Kim V. Weisman D.S. Heine W.F. Ciccone D.N. O'Neill T.B. Crick K.E. Pierce K.A. Lane W.S. Rathbun G. Livingston D.M. Weaver D.T. Nature. 2000; 405: 477-482Crossref PubMed Scopus (376) Google Scholar, 30Zhao S. Kim Y.C. Yuan S.S. Lin Y.T. Hsu H.C. Lin S.C. Gerbino E. Song M.H. Zdzienicka M.Z. Gatti R.A. Shay J.W. Ziv Y. Shiloh Y. Lee E.Y. Nature. 2000; 405: 473-477Crossref PubMed Scopus (437) Google Scholar, 31Lim D.S. Kim S.T. Xu B. Maser R.S. Lin J. Petrini J.H. Kastan M.B. Nature. 2000; 404: 613-617Crossref PubMed Scopus (678) Google Scholar, 32Gatei M. Kim D. Cerosaletti K.M. Desai-Mehta A. Spring K. Kozlov S. Lavin M.F. Gatti R.A. Concannon P. Khanna K. Nat. Genet. 2000; 25: 115-119Crossref PubMed Scopus (412) Google Scholar). Recently, our studies demonstrated that a direct interaction of MRN with RPA is required for IR-induced suppression of DNA synthesis, suggesting that RPA is a target of MRN to mediate the intra-S-phase checkpoint (33Olson E. Kim C.J. Liu E. Lee A.Y. Chen L. Wu X. Mol. Cell. Biol. 2007; 27: 6053-6067Crossref PubMed Scopus (69) Google Scholar). Although substantial evidence suggests that MRN plays a key role in the ATM pathway in responses to DSBs, a connection between MRN and ATR was also described recently. MRN was co-purified with ATR (34Myers J.S. Kim D. J. Biol. Chem. 2006; 281: 9346-9350Abstract Full Text Full Text PDF PubMed Scopus (247) Google Scholar) and is a direct substrate of ATR under replication stress (35Olson E. Kim C.J. Lee A.Y. Chen L. Wu X. J. Biol. Chem. 2007; 282: 22939-22952Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 36O'Driscoll M. Kim V.L. Woods C.G. Jeggo P.A. Goodship J.A. Nat. Genet. 2003; 33: 497-501Crossref PubMed Scopus (644) Google Scholar). MRN is required for replication restart during the recovery from fork stalling and G2/M arrest following HU treatment, similar to the requirement of ATR in these damage responses (37Stiff T. Kim C. Alderton G.K. Woodbine L. O'Driscoll M. Jeggo P.A. EMBO J. 2005; 24: 199-208Crossref PubMed Scopus (157) Google Scholar, 38Trenz K. Kim E. Smith S. Costanzo V. EMBO J. 2006; 25: 1764-1774Crossref PubMed Scopus (166) Google Scholar, 39Zhong H. Kim A. Eckersdorff M. Ferguson D.O. Hum. Mol. Genet. 2005; 14: 2685-2693Crossref PubMed Scopus (49) Google Scholar). It has also been suggested that MRN is involved in facilitating ATR-mediated phosphorylation events, although the mechanism remains unclear (35Olson E. Kim C.J. Lee A.Y. Chen L. Wu X. J. Biol. Chem. 2007; 282: 22939-22952Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 37Stiff T. Kim C. Alderton G.K. Woodbine L. O'Driscoll M. Jeggo P.A. EMBO J. 2005; 24: 199-208Crossref PubMed Scopus (157) Google Scholar, 39Zhong H. Kim A. Eckersdorff M. Ferguson D.O. Hum. Mol. Genet. 2005; 14: 2685-2693Crossref PubMed Scopus (49) Google Scholar). In our previous studies, we demonstrated that Nbs1 inhibits the simian virus 40 (SV40) large T antigen-induced hyperreplication of chromosomal DNA and SV40 origin-containing replicons, suggesting a possible role of Nbs1 in limiting inappropriate DNA rereplication events (40Wu X. Kim D. Chiba T. Yan F. Zhao Q. Lin Y. Heng H. Livingston D. Genes Dev. 2004; 18: 1305-1316Crossref PubMed Scopus (74) Google Scholar). Here, we demonstrate that in mammalian cells, MRN plays an important role in the prevention of rereplication when the licensing control is disrupted by Cdt1 overexpression. Loss of Mre11 or Nbs1 function does not only increase levels of rereplication in rereplication-susceptible cell lines but also leads to substantial rereplication in the cell lines that are normally resistant to Cdt1 overexpression-induced rereplication. We also showed that a major mechanism by which MRN inhibits rereplication is through regulating the ATR pathway. MRN facilitates ATR activation to phosphorylate Chk1 upon Cdt1 overexpression, an event that appears to be important for inhibiting rereplication (19Li A. Kim J.J. EMBO J. 2005; 24: 395-404Crossref PubMed Scopus (115) Google Scholar, 75Liu E. Kim A.Y.-L. Chiba T. Olson E. Sun P. Wu X. J. Cell Biol. 2007; (in press)Google Scholar). Nbs1 phosphorylation at Ser343 by ATR is observed at an early stage after Cdt1 is overexpressed, and this phosphorylation is needed for the inhibition of rereplication. Moreover, the interaction of MRN with RPA that is required for mediating the intra-S-phase checkpoint (33Olson E. Kim C.J. Liu E. Lee A.Y. Chen L. Wu X. Mol. Cell. Biol. 2007; 27: 6053-6067Crossref PubMed Scopus (69) Google Scholar) is also required for the inhibition of rereplication. Collectively, these data suggest that MRN acts through the activation of the S-phase checkpoint in the ATR pathway to suppress DNA rereplication. Cell Culture, Retroviral Infections, and shRNA—U2OS, T98G, A549, 293T, GM847, or GM847-ATR-KD cells were grown in Dulbecco’s modified Eagle’s medium containing 5% fetal bovine serum and 5% super calf serum. The expression of ATR-KD in the GM847 fibroblasts was induced by the addition of 1 μg/ml of doxycycline to the media for 24 h (41Cliby W.A. Kim C.J. Cimprich K.A. Stringer C.M. Lamb J.R. Schreiber S.L. Friend S.H. EMBO J. 1998; 17: 159-169Crossref PubMed Scopus (487) Google Scholar). Silencing of endogenous Mre11, Nbs1, or ATR in U2OS, T98G, or A549 cells was performed by two rounds of retroviral infection using pMKO vector (42Masutomi K. Kim E.Y. Khurts S. Ben-Porath I. Currier J.L. Metz G.B. Brooks M.W. Kaneko S. Murakami S. DeCaprio J.A. Weinberg R.A. Stewart S.A. Hahn W.C. Cell. 2003; 114: 241-253Abstract Full Text Full Text PDF PubMed Scopus (659) Google Scholar) that expressed two different Mre11, Nbs1, or ATR shRNA target sequences. The shRNA retrovirus plasmids constructed by inserting annealed and phosphorylated shRNA oligos into pMKO retroviral vector. The shRNA target sequences used were Mre11: GAUGAGAACUCUUGGUUUAAC, and GAGUAUAGAUUUAGCAGAACA; Nbs1: GGAGGAAGAUGUCAAUGUUAG and GAAGAAACGUGAACUCAAGGA; ATR: CGAGACTTCTGCGGATTGCAG and AACCTCCGTGATGTTGCTTGA (43Casper A.M. Kim P. Arlt M.F. Glover T.W. Cell. 2002; 111: 779Abstract Full Text Full Text PDF PubMed Scopus (485) Google Scholar). Adenovirus Construction and Infection—Production of recombinant adenoviruses is conducted by using the AdEasy system method (44He T.-C. Kim S. da Costa L.T. Yu J. Kinzler K.W. Vogelstein B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 2509-2514Crossref PubMed Scopus (3276) Google Scholar). Adenovirus plasmids constructed by inserting, full-length hCdt1, Nbs1 N-terminal fragment (Nbs1-N-1–478), full-length Mre11, and Mre11Δ521–543 into pAd-track-CMV shuttle vector. Then, in vivo recombination was performed by transforming pAd-track-CMV plasmid together with pAd-Easy-1 adenoviral vector into BJ5813 competent cell by electroporation (44He T.-C. Kim S. da Costa L.T. Yu J. Kinzler K.W. Vogelstein B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 2509-2514Crossref PubMed Scopus (3276) Google Scholar). The recombinant adenoviral plasmids were transfected into 293 cells to generate corresponding recombinant adenoviruses. Large scale purification of adenoviruses from 293 cells was accomplished by CsCI density gradient centrifugation. The concentration of purified virus was measured A260 using the equation 1A260 ≈ 1012 pfu (12Vaziri C. Kim S. Jeon Y. Lee C. Murata K. Machida Y. Wagle N. Hwang D.S. Dutta A. Mol. Cell. 2003; 11: 997-1008Abstract Full Text Full Text PDF PubMed Scopus (342) Google Scholar). Immunoblot Analysis and Antibodies—Cells were lysed in NETN (150 mm NaCl, 1 mm EDTA, 20 mm Tris-Cl pH 8.0, 0.5% Nonidet P-40 (v/v)) containing protease and phosphatase inhibitors (1.0 mm sodium orthovanadate, 50 μm sodium fluoride). For immunoblot analysis, proteins were separated by SDS-PAGE, transferred to nitrocellulose membranes (Bio-Rad), incubated overnight in primary antibodies followed by 1 h of incubation in horseradish peroxidase-conjugated secondary antibodies. Antibodies used in this study are listed as follows: antibodies to Cdt1 (8Li X. Kim Q. Liao R. Sun P. Wu X. J. Biol. Chem. 2003; 278: 30854-30858Abstract Full Text Full Text PDF PubMed Scopus (206) Google Scholar), Mre11 ((D27; Ref. 40Wu X. Kim D. Chiba T. Yan F. Zhao Q. Lin Y. Heng H. Livingston D. Genes Dev. 2004; 18: 1305-1316Crossref PubMed Scopus (74) Google Scholar), and Nbs1 (D29; Ref. 29Wu X. Kim V. Weisman D.S. Heine W.F. Ciccone D.N. O'Neill T.B. Crick K.E. Pierce K.A. Lane W.S. Rathbun G. Livingston D.M. Weaver D.T. Nature. 2000; 405: 477-482Crossref PubMed Scopus (376) Google Scholar) were described earlier, antibody to phospho-Chk1 (Ser317) was obtained from R & D Systems, phospho-Chk2 (Thr68) and phospho-Nbs1 (Ser343) antibodies were from Cell Signaling, antibodies to Chk1, Chk2, and Ku70 were purchased from Santa Cruz Biotechnology, RPA2 and ATR antibodies were from Oncogene, and Rad50 and γ-H2AX (Ser139) were from Upstate Biotechnology. Fluorescence-activated Cell Sorting (FACS) Analysis—Cells were rinsed with phosphate-buffered saline, collected by trypsinization and fixed with 70% ethanol overnight at 4 °C. After fixation, cells were stained with propidium iodide solution which containing 38 mm sodium citrate, 10 μg/ml RNase A and 15 μg/ml propidium iodide (Sigma). The labeled cells were analyzed with a Becton-Dickinson flow cytometer using Cellquest software. Plasmids and Mutagenesis—To generate mutations in Nbs1 (S343A, R28A(FHA), Y176A(BRCT), R28A/Y176A (FHA/BRCT)) and Mre11 (NAAIRS, D543A/D544A), Myc-tagged full-length Nbs1 and Mre11 cloned into mammalian expression vector pcDNA3β was used as template for site-directed mutagenesis (QuikChange, Stratagene). Wild-type and mutant forms of Myc-tagged Nbs1 and Mre11 were cloned into the retroviral vector pBabepuro. Single Cell Gel Electrophoresis (Comet Assay)—The neutral comet assay was performed as described (45Ostling O. Kim K.J. Biochem. Biophys. Res. Commun. 1984; 123: 291-298Crossref PubMed Scopus (1404) Google Scholar) with minor modifications (46Tice R.R. Kim E. Anderson D. Burlinson B. Hartmann A. Kobayashi H. Miyamae Y. Rojas E. Ryu J.C. Sasaki Y.F. Environ. Mol. Mutagen. 2000; 35: 206-221Crossref PubMed Scopus (4144) Google Scholar). Briefly, after treatment harvested cells were washed two times with cold phosphate-buffered saline at a concentration of 4 × 106 cells/ml. Cells were then resuspended in 0.8% low melting point agarose and spread on microscopic slides. Slides were incubated for 30 min in lysis solution (2.5 m NaCl, 100 mm EDTA, 10 mm Tris-Cl pH 10.0, 1% sodium N-lauroyl sarcosine, and 1% Triton X-100). Subsequently, Slides were subjected to electrophoresis in Tris borate-EDTA buffer at 1 V/cm for 20 min. After electrophoresis, the slides were dried, stained with ethidium bromide, and viewed under a fluorescent microscope. The presence of a tail (comet) reflects DNA damage (DSBs) in the cells. For quantitative measurement, nuclei with a comet tail larger than 2 nuclear diameters were counted as positive for DNA damage. The percentage of nuclei with tails was the number of positive for DNA damage divided by the total number of nuclei counted. Results are presented as range of at least three independent experiments. Depletion of MRN Leads to Rereplication When Licensing Control Is Disrupted by Cdt1 Overexpression—We previously showed that Nbs1 is involved in limiting SV40 T-mediated DNA hyperrereplication (40Wu X. Kim D. Chiba T. Yan F. Zhao Q. Lin Y. Heng H. Livingston D. Genes Dev. 2004; 18: 1305-1316Crossref PubMed Scopus (74) Google Scholar). To investigate whether MRN may also play a role in rereplication control other than SV40 T-mediated events, we overexpressed Cdt1 in mammalian cells. After infecting cells with a recombinant adenovirus (Ad-Cdt1), rereplication was monitored by accumulation of cells containing more than 4N DNA content as described (12Vaziri C. Kim S. Jeon Y. Lee C. Murata K. Machida Y. Wagle N. Hwang D.S. Dutta A. Mol. Cell. 2003; 11: 997-1008Abstract Full Text Full Text PDF PubMed Scopus (342) Google Scholar). Overexpression of Cdt1 is sufficient to induce DNA rereplication in U2OS (Fig. 1A, left panel, top, vector), but not in T98G and A549 cell lines despite higher titers of adenovirus used (Fig. 1A, middle and right panels, top, vector) (75Liu E. Kim A.Y.-L. Chiba T. Olson E. Sun P. Wu X. J. Cell Biol. 2007; (in press)Google Scholar). To inhibit the expression of MRN, Mre11-shRNA and Nbs1-shRNA sequences were introduced by retroviral infection using the MKO vector (42Masutomi K. Kim E.Y. Khurts S. Ben-Porath I. Currier J.L. Metz G.B. Brooks M.W. Kaneko S. Murakami S. DeCaprio J.A. Weinberg R.A. Stewart S.A. Hahn W.C. Cell. 2003; 114: 241-253Abstract Full Text Full Text PDF PubMed Scopus (659) Google Scholar). Silencing Mre11 or Nbs1 by shRNA resulted in a significant reduction in protein levels of Mre11 and Nbs1 in multiple cell lines as compared with the control cells infected with empty vector (Fig. 1A, bottom and data not shown). The expression of Rad50 and Nbs1 was also reduced when the expression of Mre11 was silenced, which is consistent with a reduced expression of Nbs1 and Rad50 in the Mre11-deficient ATLD cells (25Stewart G.S. Kim R.S. Stankovic T. Bressan D.A. Kaplan M.I. Jaspers N.G. Raams A. Byrd P.J. Petrini J.H. Taylor A.M. Cell. 1999; 99: 577-587Abstract Full Text Full Text PDF PubMed Scopus (862) Google Scholar). However, silence of Nbs1 expression does not influence the expression of Rad50 and Mre11. This is likely because of a crucial role of Mre11 to stabilize the MRN complex (47Takemura H. Kim V.A. Sordet O. Furuta T. Miao Z.H. Meng L. Zhang H. Pommier Y. J. Biol. Chem. 2006; 281: 30814-30823Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). Silencing the expression of Mre11 or Nbs1 led to a significantly higher level of rereplication in U2OS cells when Cdt1 was overexpressed by adenoviral infection (Fig. 1A, left panel). Strikingly, robust rereplication was observed in T98G and A549 cells where normally rereplication was not obviously induced by Cdt1-overexpression (Fig. 1A, middle and right panels). Similar results were obtained when Cdt1 was overexpressed by retroviral infection (supplemental Fig. S1 and data not shown). We also examined whether MRN is required for the suppression of rereplication induced by expressing shRNAs of DDB1 and Cdt2, the components of a Cul4 ubiquitin ligase that are required for Cdt1 ubiquitination and degradation (48Hu J. Kim C.M. Ohta T. Xiong Y. Nat. Cell Biol. 2004; 6: 1003-1009Crossref PubMed Scopus (297) Google Scholar, 49Jin J. Kim E.E. Chen J. Harper J.W. Walter J.C. Mol. Cell. 2006; 23: 709-721Abstract Full Text Full Text PDF PubMed Scopus (500) Google Scholar). Inhibition of the expression of DDB1 or Cdt2 in U2OS cells led to detectable Cdt1 accumulation (∼2-fold more) and rereplication. Silencing Mre11 by shRNAs prior to the depletion of DDB1 or Cdt2 significantly increased the rereplication levels compared with Mre11-proficient cells (Fig. 1B). These data suggest that MRN is involved in the suppression of rereplication when licensing control is disrupted. MRN Is Involved in Facilitating ATR-mediated Checkpoint Activation When Cdt1 Is Overexpressed—When Cdt1 is overexpressed, multiple ATR substrates are phosphorylated (75Liu E. Kim A.Y.-L. Chiba T. Olson E. Sun P. Wu X. J. Cell Biol. 2007; (in press)Google Scholar). However, when p27 and Cdc7 kinase dead mutant (Cdc7KD) were overexpressed prior to Cdt1 overexpression, both rereplication and the phosphorylation of ATR substrates including Chk1 and Nbs1 were inhibited although Cdt1 overexpression was not altered (supplemental Fig. S2). This suggests that activation of the ATR pathway is not caused by Cdt1 overexpression per se, but by Cdt1-induced rereplication. Under replication stress, MRN is important for facilitating certain ATR-mediated phosphorylation events (35Olson E. Kim C.J. Lee A.Y. Chen L. Wu X. J. Biol. Chem. 2007; 282: 22939-22952Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 37Stiff T. Kim C. Alderton G.K. Woodbine L. O'Driscoll M. Jeggo P.A. EMBO J. 2005; 24: 199-208Crossref PubMed Scopus (157) Google Scholar, 39Zhong H. Kim A. Eckersdorff M. Ferguson D.O. Hum. Mol. Genet. 2005; 14: 2685-2693Crossref PubMed Scopus (49) Google Scholar). Because ATR plays a critical role in the inhibition of rereplication (19Li A. Kim J.J. EMBO J. 2005; 24: 395-404Crossref PubMed Scopus (115) Google Scholar, 75Liu E. Kim A.Y.-L. Chiba T. Olson E. Sun P. Wu X. J. Cell Biol. 2007; (in press)Google Scholar), we examined the role of MRN in facilitating ATR activation when Cdt1 was overexpressed. To examine whether Nbs1 or Mre11 is involved in the activation of ATR, the expression of Mre11 or Nbs1 was silenced by shRNA as described in Fig. 1A. A reduction in Chk2 phosphorylation following IR in these Mre11 or Nbs1 shRNA-expressing cells confirmed effective silencing of Mre11 and Nbs1 (Fig. 2A). We monitored the phosphorylation of multiple ATR substrates including Chk1, RPA2, and Rad17 after Ad-GFP or Ad-Cdt1 infection in vector, or Nbs1-shRNA or Mre11-shRNA-expressing cells. Chk1 phosphorylation at serine 317, RPA2 phosphorylation, and Rad17 phosphorylation at serine 645 were all reduced in Nbs1- or Mre11-deficient cells (Fig. 2B), suggesting that MRN is important for activating ATR-mediated phosphorylation events when Cdt1 is overexpressed. Rereplication generates both ssDNA and DSBs and these two kinds of DNA lesions activate ATR and ATM, respectively (13Zhu W. Kim Y. Dutta A. Mol. Cell Biol. 2004; 24: 7140-7150Crossref PubMed Scopus (206) Google Scholar, 14Melixetian M. Kim A. Masiero L. Gasparini P. Zamponi R. Bartek J. Lukas J. Helin K. J. Cell Biol. 2004; 165: 473-482Crossref PubMed Scopus (218) Google Scholar, 20Zhu W. Kim A. Mol. Cell Biol. 2006; 26: 4601-4611Crossref PubMed Scopus (73) Google Scholar, 75Liu E. Kim A.Y.-L. Chiba T. Olson E. Sun P. Wu X. J. Cell Biol. 2007; (in press)Google Scholar). MRN plays a critical role in the activation of ATM in respo

Referência(s)